Electrical stimulation promoting the angiogenesis in diabetic rat perforator flap through attenuating oxidative stress-mediated inflammation and apoptosis

Animal and study protocols

This study was approved by the research ethics committee of the Second Hospital of Shandong University (KYLL-2019(KJ)A-0203). The experiments were performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. In addition, this research also followed the “Animal Research: Reporting In Vivo Experiments” (ARRIVE) Guidelines. A total of 79 healthy adult male Sprague–Dawley rats (weight: 300–350 g) were purchased from Jinan Pengyue Experimental Animal Co., Ltd (Jinan, China). Each cage contained one rat, rats were housed under standard conditions (humidity: 45–55%, temperature: 23–25 °C, and 12 h light/dark cycle) and fed with food and tap water at libitum. The feces were removed from the cages every 3 days. All rats were anesthetized before the experiment using 2% pentobarbital sodium (40 mg/kg, intraperitoneal injection) after isoflurane induction. All rats were euthanized by an intraperitoneal injection of pentobarbital sodium overdose (150 mg/kg) at the end of the experiment.

The rats with the direct anastomotic vessels in the flap donor site were excluded prior to the experiment. This study was performed in two parts. Part one consisted of the evaluation of the optimal duration of the ES preconditioning flap, performed using 28 normal rats randomly divided into the four groups: control group (no ES), ES 3-day group, ES 5-day group, and ES 7-day group. Part two consisted of the use of ES to improve the multi-territory flap viability by the induction of angiogenesis in diabetic rats, performed using 51 rats randomly divided into three groups: 17 normal rats used as control group (control: no ES), 17 diabetic rats as the DM group (DM, no ES), and 17 diabetic rats pretreated with ES used as the DM ES group (DMES). Flap viability, histological analysis and molecular biology analysis were performed in each group.

Animal model

Vascular anatomy: according to a previous report (Li et al., 2019), the flap can be classified into five zones: deep circumflex iliac (DCI) artery angiosome, proximal choke zone (PCZ), posterior intercostal (PIC) artery angiosome, distal choke zone (DCZ), and thoracodorsal (TD) artery angiosome from the caudal to the cranial part (Fig. 1A). Based on the anatomical theory between adjacent angiosomes (Cormack & Lamberty, 1984), the DCI is an anatomical territory, the PIC is a dynamic territory, and the TD is a potential territory in this flap. Thus, DCZ was selected for histological and molecular biology examination.

Flap design: after shaving, a rectangular flap of approximately 11 cm × 3 cm in dimension over the unilateral dorsum of the rat was designed based on the DCI artery perforator vessels (Fig. 1B). The caudal demarcation was situated at the superior edge of the musculus gluteus maximus and its cranial demarcation at the 7^th cervical spinous process; the medial demarcation of the flap was located at the midline of the spine.

Flap harvest: all surgical procedures were performed under standard sterile conditions. The skin flap was undermined above the panniculus carnosus, and the perforators of the TD and PIC arteries were ligated and cut off. The flaps were raised based on the DCI artery perforator vessels (Fig. 1C) and then were sutured in situ using 4–0 nonabsorbable suture.

Generation of the DM rats

Sprague–Dawley rats were fed with tailor-made high-sugar and high-fat fodder for 4 weeks. Afterwards, streptozotocin (50 mg/kg) dissolved in citrate buffer (pH = 4.5) was intraperitoneally injected for 2 days. Blood samples were collected form the tail vein to measure the random plasma glucose. The random plasma glucose value was ≥16.7 and ≤33.3 mmol/L, suggesting that the diabetic rat model was successfully constructed (Tam et al., 2014). A total of 34 diabetes rats were generated.

ES

After completing the flap design, both electrodes stickers of the electrostimulation equipment (Xiangyu Medical Equipment Co. Ltd., Anyang, China) placed the PCZ and DCZ of the flap respectively (Fig. 1D). ES was performed under isoflurane anesthesia for 40 min daily (Fig. 1D; Frequency: 1,000 Hz, current intensity: 10 mA).

Flap viability

The assessment of flap survival area was performed on day 7 after the surgery. Images of the skin flaps were captured using a digital camera (Canon EOS800D; Canon, Tokyo, Japan), and Adobe Photoshop CS6 imaging analysis was used to determine the survival area. This measurement was expressed as a percentage by dividing the survival area by the total area of the flap and multiplying by 100%.

Histological analysis

The skin flap was raised at the scheduled time and flattened on the wooden board under a standard condition to maintain its accurate size. The flap was photographed using a digital camera (Canon EOS800D; Canon, Tokyo, Japan) to allow the vascular morphological analysis, using a plastic rule as a reference.

A tissue specimen measuring 3 × 0.5 cm was obtained from the DCZ for the purpose of histological analysis. The specimen was fixed in a solution of neutral buffered formalin for a duration of 24 h, after which it underwent dehydration. Subsequently, the tissue was embedded in paraffin and sectioned into slices measuring 3 μm in thickness. Hematoxylin and eosin (H&E) staining, as well as immunohistochemical (IHC) staining, were conducted. The stained sections were then captured using the Nanozoomer Digital Pathology (NDP) scanner S60 (NDP Scan C13210-01; Hamamatsu Photonics K.K., Hamamatsu, Japan) in order to convert the images into the NDP format.

The quantification of vessels with a diameter (D) greater than 0.1 mm (circumference [C] exceeding 0.314 mm; C = πD) in the subdermis and muscle layers was conducted through the utilization of H&E staining. The measurement of vascular circumference was accomplished using the NDP view software on the NDP image.

Microvessels density (N/mm2) in the subdermis was assessed through IHC staining of CD31 (rabbit anti-rat CD31, #: ab281583, 1:100 dilution; Abcam). Any aggregation of brown endothelial cells was regarded as a single quantifiable microvessel. Five randomly chosen high power fields (20× magnification, 0.85 × 0.48 mm/field) were examined, and the microvessel count was determined for each NDP image.

DNA damage by oxidative stress was assessed using the IHC staining of 8-OHdG antibody (#ab48508; Abcam, Cambridge, MA, USA; 1:200 dilution). Apoptosis was measured by the IHC staining of cleaved caspase-3 (CC3; #9664; CST, Danvers, MA, USA; 1:1,000 dilution). Any brown endothelial cell cluster was considered as a single countable positive cell. Five high power fields (20× magnification, 0.85 × 0.48 mm/field) including the vessels were randomly selected in the subdermis in each slice, and the number of positive cells and total cells were counted in each field.

Western blotting

A tissue sample of 3 × 1 cm in size was collected from the DCZ. The sample was lysed using radioimmunoprecipitation assay lysis buffer to extract the total proteins, which were subsequently separated by gel electrophoresis using gels at different concentrations (range, 8 to 15%) and transferred onto a polyvinylidene fluoride membrane.

The membrane was incubated with the following primary antibodies at 4 °C overnight: VEGF (#sc-7269, 1:500 dilution; Santa Cruz Biotechnology), matrix metalloproteinase-2 (MMP2: ab92536, 1:1,000 dilution; Abcam), matrix metalloproteinase-9 (MMP9: ab76003, 1:1,000 dilution; Abcam), monocyte chemoattractant protein-1 (MCP-1: #AF7437, 1:500 dilution, Beyotime), transforming growth factor β (TGFβ: #AF0297; 1:1,000 dilution; Beyotime), Bax (#14796, 1:500 dilution; Cell Signaling Technology, Danvers, MA, USA), β-actin (#AC026; 1:5,000 dilution; ABclonal, Wuhan, China). The membrane was treated with the corresponding secondary antibody and the bands were visualized using the automatic chemiluminescence/fluorescence image analysis system (Tanon 4800). The intensity of the bands was assessed by ImageJ2 software (NIH, Bethesda, MD, USA) and represented as fold change relative to that of β-actin.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from the DCZ tissue. Reverse transcription was performed to obtain cDNA. qPCR was carried out using SYBR® Premix Ex Taq (TaKaRa) and the fluorescence qPCR instrument (ABI QuantStudio 5). Each amplification was performed in triplicate. Relative gene expression was calculated by the 2^–ΔΔCT method, using β-actin as the normalization control. The primer sequences used in this study were the following: interleukin-1β (IL-1β): CCAGGATGAGGACCCAAGCA (forward), TCCCGACCATTGCTGTTTCC (reverse);β-actin:CACCATGTACCCAGGCATTG (forward), TCGTACTCCTGCTTGCTGAT (reverse).

Determination of ROS and GSH

A tissue sample of 3 × 0.5 cm in size was isolated from the DCZ and mechanically homogenized. The supernatant was collected to measure the amount of ROS and glutathione peroxidase (GSH) according to the manufacturer’s instructions. Tissue ROS intensity was evaluated using the tissue ROS assay kit (#BB-460512, Bestbio, Shanghai), and expressed as florescence intensity (RFU)/protein concentration (μg/L). Tissue GSH concentration (μmol/g protein) was measured using the reduced GSH assay kit (#A006-2-1; Nanjing Jiancheng Bioengineering).

Tissue GSH concentration (μmol/g protein) was calculated as follows = [(Measured OD value- Blank OD value)/(Standard OD value-Blank OD value)] × standard sample concentration (20 μmol/L) × dilution fold (two folds) ÷ protein concentration (g prot/L).

Statistical analysis

Statistical analysis was performed using GraphPad Prism 9. All measurements were performed by two researchers in a double-blind manner. Results were expressed as mean ± standard deviation. The gaussian distribution was evaluated using the Shapiro-Wilk test. Groups were compared using the t-test or Mann-Whitney U test. A value of P < 0.05 was considered statistically significant.

Optimal duration of the ES preconditioning flap

The flap survival area percentage was 80.3% in the control group, 87.3% in the 3-day group, 88.2% in the 5-day group, 94.0% in the 7-day group (Fig. 2; original data: Table S1). The flap survival area percentage in the 7-day group was significantly increased in contrast to that in the control group (Fig. 2, P = 0.0026). Therefore, the optimal duration of ES preconditioning flap was 7 days, since it corresponded to the maximum survival area (Fig. 2).

ES increased the diabetes flap viability

The flap survival area percentage was 80% in the control group, 72% in the DM group, and 92% in the DMES group (Fig. 3A). The statistical analysis revealed that the flap survival area percentage in the DM group was significantly less than that in the control group (Fig. 3B, P = 0.0043; original data: Table S2), while the flap survival area percentage in the DMES group was remarkably more than that in the control group (Fig. 3B, P = 0.0022; original data: Table S2) and DM group (Fig. 3B, P = 0.0022; original data: Table S2).

The vascular morphological changes showed that the vascular network of the DM group was much sparser than that of the control group, while the vascular network of the DMES group was much denser than that of the control and DM group (Fig. 4A). The results of the H&E staining revealed that the number of vessels greater than 0.1 mm in diameter in the DM group was significantly lower than that in the control group (Fig. 4B, P = 0.024; original data: Table S3), while the number of vessels greater than 0.1 mm in diameter in the DMES group was markedly greater than that in the control group (Fig. 4B, P = 0.023; original data: Table S3) and DM group (Fig. 4B, P = 0.003; original data: Table S3). IHC staining of CD31 showed that CD31-positive microvessels density in the DM group was less than that in the control group, while CD31-positive microvessels density in the DMES group was more than that in the control and DM group (Fig. 5; original data: Table S4).

MMP-2 and MMP-9 are widely considered as the main proteolytic enzymes involved in the degradation of the extracellular matrix in the vascular basement membrane (Zhang et al., 2020). The proangiogenic factor VEGF activates MMP2 and MMP9, regulating the remodeling of the endothelial extracellular matrix, promoting the degradation of the EC basement membrane, favoring the migration of ECs and creating an advantageous environment to tubule formation (Zhang et al., 2020). It is worth noting that the expression of MMP-2 and MMP-9 is consistent with the change of neovascularization (Zhang et al., 2020). Thus, MMP2 and MMP9 were considered as angiogenic markers and measured. Western blotting showed that VEGF protein expression in the DM group was significantly reduced compared to the control group (1.0 ± 0.14 vs 0.42 ± 0.16, P = 0.0306; Fig. 6A), while VEGF protein expression in the DMES group was significantly increased compared to the DM group (1.3 ± 0.43 vs 0.42 ± 0.16, P = 0.0029; Fig. 6A; original band: Fig. S1). MMP2 protein expression in the DMES group was significantly upregulated compared to the control group (1.4 ± 0.3 vs 1.0 ± 0.08, P = 0.0240; Fig. 6B; original band: Fig. S1) and DM group (1.4 ± 0.3 vs 0.76 ± 0.1, P = 0.0018; Fig. 6B; original band: Fig. S1). MMP9 protein expression in the DMES group was much higher than in the control group (2.13 ± 0.21 vs 1.0 ± 0.45, P = 0.0014; Fig. 6C; original band: Fig. S1) and DM group (2.13 ± 0.21 vs 0.71 ± 0.17, P = 0.0003; Fig. 6C; original band: Fig. S1). These results indicated that DM significantly reduced vascular density and ES increased vascular density by the improvement of angiogenesis.

The IHC staining of 8-OHdG was performed to measure the oxidative stress damage in the flap tissue among the control, DM and DMES group since it is a marker for DNA oxidation during oxidative stress (Wang et al., 2020b). The results showed that the percentage of positive 8-OHdG in vascular endothelial cells of the flap tissue in the DM group was markedly increased compared to that in the control and DMES group, while no significant difference was found between the control and DMES group (Fig. 7A). In addition, the overproduction of ROS is the main cause of oxidative stress; thus tissue ROS intensity was also evaluated. ROS intensity in the DM group was much higher than that in the control group (1.8 ± 0.25 vs 0.38 ± 0.01, P < 0.0001; Fig. 7B; original data: Table S5) and DMES group (1.8 ± 0.25 vs 0.35 ± 0.04, P < 0.0001; Fig. 7B; original data: Table S5), while no significant difference was observed between the control and DMES group (0.38 ± 0.01 vs 0.35 ± 0.04, P = 0.9733; Fig. 7B; original data: Table S5). GSH is an endogenous antioxidant enzyme that protects the tissue from oxidative damage. GSH concentration in the DMES group was significant higher to that in the control group (3.5 ± 0.48 vs 2.7 ± 0.12, P = 0.0480; Fig. 7C; original data: Table S6) and DM group (3.5 ± 0.48 vs 1.5 ± 0.28, P = 0.0007; Fig. 7C; original data: Table S6), and GSH concentration in the DM group was much less than that in the control group (1.5 ± 0.28 vs 2.7 ± 0.12, P = 0.0114; Fig. 7C; original data: Table S6). The pro-inflammatory cytokines IL-1β and MCP‑1, and the anti-inflammatory cytokine TGFβ were measured. RT-PCR results showed that IL-1β gene expression in the DM group was much higher than that in the control group (2.0 ± 0.24 vs 1.0 ± 0.37, P = 0.0427; Fig. 7D; original data: Table S7) and DMES group (2.0 ± 0.24 vs 0.90 ± 0.51, P = 0.0341; Fig. 7D; original data: Table S7), while no significant difference was found between the control and DMES group (1.0 ± 0.37 vs 0.90 ± 0.51, P = 0.8871; Fig. 7D; original data: Table S7). Western blotting showed that MCP-1 protein expression in the DM group was much higher than that in the control group (2.38 ± 0.53 vs 1.0 ± 0.31, P = 0.0021) and DMES group (2.38 ± 0.53 vs 1.40±0.31, P = 0.0163), while no significant difference in MCP-1 protein expression was observed between the control and DMES group (Figs. 7E and 7G; original band: Fig. S2). TGFβ protein expression in the DM group was significantly downregulated compared to the control group (0.43 ± 0.16 vs 1.0 ± 0.36, P = 0.0282) and DMES group (0.43 ± 0.16 vs 1.0 ± 0.19, P = 0.0276), while no significant difference in TGFβ protein expression was found between the control and DMES group (Figs. 7F and 7H; original band: Fig. S2). These results indicated that ES attenuated oxidative stress-mediated inflammation.

The expression of the pro-apoptotic proteins cleaved caspase-3 and Bax were measured. Caspase-3 is a pivotal regulatory protein of apoptosis and nuclear changes in apoptosis. It is cleaved to form cleaved caspase-3, which regulates the morphological and biochemical alterations in apoptosis (Silva et al., 2022). The immunohistochemical staining of cleaved caspase-3 showed that the percentage of positive cleaved caspase-3 in vascular endothelial cells of the flap tissue in the DM group was significantly increased compared to that in the control and DMES group, while no significant difference was observed between the control and DMES group (Fig. 8A). Western blotting showed that Bax protein expression in the DM group was significantly upregulated compared to the control group (1.6 ± 0.32 vs 1.0 ± 0.19, P = 0.0181) and DMES group (1.6 ± 0.32 vs 0.64 ± 0.42, P = 0.0142), while no significant difference in Bax protein expression was found between the control and DMES group (Figs. 8B and 8C; original band: Fig. S3).