Nickel and cobalt resistance properties of Sinorhizobium meliloti isolated from Medicago lupulina growing in gold mine tailing

Bacterial strains, media and growth conditions

All bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli DH5 α was grown in Luria-Bertani (LB) medium at 37 °C. S. meliloti CCNWSX0020 and the mutants were grown at 28 °C in tryptone-yeast extract medium (TY medium: 5 g tryptone, 3 g yeast extract, 0.7 g CaCl₂ ⋅2 H₂O and 15 g agar per litre). Liquid culture of the cells was carried out in shaken tubes or Erlenmeyer flasks at 180 rpm. When necessary, media were supplemented with 100 µg/mL ampicillin (Amp), 50 µg/mL kanamycin (Km) or 50 µg/mL gentamicin (Gm).

qRT-PCR assays

S. meliloti CCNWSX0020 was cultured to logarithmic phase in TY liquid medium. Different heavy metals were added to the logarithmic phase medium, and the final concentrations of CoCl₂, NiCl₂, CuSO₄, ZnCl₂, Pb(NO₃) ₂ andCdCl₂ were adjusted to 0.3, 0.5, 0.5, 0.5, 0.5 and 0.2 mM. Then, culture medium was incubated for 15 min before the total RNA was extracted. Residual DNA in the total RNA was removed by DNase I. A TakaRa reverse transcription kit and SYBR Premix ExTaqTM II (Tli RNaseH Plus) kit were used for reverse transcription and qRT-PCR. All experimental operations were carried out according to the manufacturer’s instructions. To standardize the results, 16S rRNA was used as an internal standard and the relative levels of transcription were calculated using the 2^−ΔΔCtmethod (Livak & Schmittgen, 2001).

Bioinformation analyses

The draft genome of S. meliloti CCNWSX0020 (AGVV00000000) was previously sequenced and deposited in GenBank. The known DmeF protein sequences of most bacterial genomes used in this study were obtained from NCBI (https://www.ncbi.nlm.nih.gov). The whole set of bacterial DmeF sequences was aligned using ClustalW2 and the phylogenetic tree visualized with MEGA 6.0 (http://www.megasoftware.net). The DmeF membrane topology of strain CCNWSX0020 was generated and visualized by HMMTOP (version 2.0; http://www.enzim.hu/hmmtop/).

Generation of deletion mutants in dmeR and dmeF

The total genomic DNA of S. meliloti CCNWSX0020 was extracted according to the protocol of Wilson & Carson (2001). A 940-bp upstream and a 590-bp downstream fragment of dmeF were amplified using the primer pairs dmeFF1/dmeFR1 and dmeFF2/dmeFR2, respectively. The upstream and downstream PCR products were ligated by crossover PCR with primer pairs dmeFF1/dmeFR2 (Fig. 1B). The resulting 1.53-kb fragment was digested with Bam HI/XbaI and cloned into the Bam HI/XbaI site of the suicide vector pK18mobsacB to produce pK18-ΔdmeF. For the construction of pK18-ΔdmeR, 455-bp upstream and 405-bp downstream fragments of dmeR were amplified using the primer pairs dmeRF1/dmeRR1 and dmeRF2/dmeRR2, respectively. The upstream and downstream PCR products were ligated by crossover PCR with primers dmeRF1/dmeRR2. The resulting 860-bp fragment was digested with BamHI/XbaI and cloned into the BamHI/XbaI site of the suicide vector pK18mobsacB. All primers used in this study are listed in Table 1. The constructed suicide plasmid pK18-ΔdmeF or pK18-ΔdmeR was transferred into S. meliloti CCNWSX0020 by triparental mating, which included S. meliloti CCNWSX0020 (Amp ^r) as the recipient, E. coli JM109 cells containing pK18- ΔdmeF (Km^r) as the donor, and E. coli DH5α cells containing pRK2013 as helper cells. A single clone of transferred S. meliloti CCNWSX0020, which was resistant to both kanamycin and ampicillin, was grown in TY solid medium containing ampicillin and 10% (w/v) sucrose. Double crossover recombinants were confirmed by PCR using dmeFF1 and dmeFR2 as primers, and then the correct PCR products were sequenced. The resulting mutants were designated as SM0020ΔdmeF and SM0020ΔdmeR (Table 1).

dmeF/dmeR deletion mutant complementation experiment

To complement the dmeF and dmeR mutants, the entire dmeRF including the dmeR promoter was amplified from S. meliloti CCNWSX0020 with primers dmeH1/dmeH2 (Fig. 1B). The PCR products were digested with SmaI/XbaI and inserted into a broad-range plasmid pBBR1MCS-5 to generate pBBR-dmeF. The complement plasmids were transformed into SM0020 ΔdmeF, and single clones harbouring pBBR-dmeF were selected on TY solid medium supplemented with 50 µg/mL Gm. The presence of the entire dmeF gene in the mutant strain was confirmed by PCR.

Determination of the metal sensitivity of the defective mutant

Heavy metal sensitive assays of CCNWSX0020 strain, SM0020 ΔdmeF and the complementary strain were carried out on TY solid medium. The wild-type strain and dmeF mutant were grown to mid-exponential phase in TY liquid medium at 28 °C with shaking at 150 rpm. Cells were grown to the exponential phase in TY liquid medium and diluted to an OD600 of 0.1. Five 10-fold dilutions were spotted on the TY solid medium and incubated at 28 °C for 24 h. Each experiment was repeated three times.

Determination of Maximum Tolerable Concentrations (MTCs)

S. meliloti CCNWSX0020, dmeF mutant and dmeF mutant carrying pBBR-dmeF plasmid were grown to mid-exponential phase in TY liquid medium at 28 °C with shaking at 200 rpm, and cell suspensions were prepared at the same OD600 of 1.0 (optical density at 600 nm). Then, 1% of the cell suspensions was added to fresh TY medium supplemented with a different concentration of CuCl₂, ZnCl₂, CoCl₂ and NiCl₂. The cells were incubated with shaking at 200 rpm for 48 h, and the growth was monitored at OD600. The data are shown as the means of biological triplicates±SD.

Plant tests

M. lupulina seeds were surface sterilized and germinated in petri dishes with water agar (5 g agar per litre) at 28 °C for 48 h, and then seedlings were sown in pots filled with sterilized perlite-vermiculite (3:2) supplemented with different concentrations of CoCl₂ or NiCl₂ and grown in a greenhouse at 25 °C. When the first main leaf grew out, suspensions of either S. meliloti CCNWSX0020 or dmeF mutant were added to each plant root with a final concentration of 10⁸ CFU per root. Plants were harvested 21 days after inoculation, the number of nodules on the plant roots was counted, and the lengths of the shoots and roots were measured. Nitrogenase activity in nodules was measured by the acetylene reduction assay as described by Hardy et al. (1968). Fresh nodules from M. lupulina inoculated with S. meliloti CCNWSX0020 and the dmeF mutant in the presence of 100 mg/kg cobalt or nickel were fixed in FAA solution (90 mL 70% ethanol, 5 mL acetic acid, and 5 mL 40% methanol) for 16 h. Dehydrating and clearing processing were carried out through a graded ethanol series and chloroform series, respectively, followed by embedding and sectioning of the paraffin blocks. Paraffin-embedded nodule sections of 5–10-µm thickness were stained by 0.05% (w/v) toluidine blue solution for observation with a BX53 biological microscope (Olympus, Tokyo, Japan).

Statistical analysis

SPSS 18.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis of the data. Data were compared by analysis of variance and multiple comparison tests.

Identification of nickel- and cobalt-resistant genes

S. meliloti CCNWSX0020, isolated from the root nodules of M. lupulina growing in gold mine tailings in northwest China, could be resistant to many types of heavy metals, such as Cu²⁺, Zn²⁺, Pb²⁺ and Cd²⁺ (Fan et al., 2011). In our previous work, we found that the expression of two putative genes SM0020-17742 and SM0020-17737 was induced by Cu²⁺ through transcriptome sequencing. The 966-bp-long open reading frame of SM0020-17742 encodes a 321-amino-acid protein, and the deduced protein shows high identity with several previously characterized cobalt- and nickel-resistant proteins: DmeF of C. metallidurans (ABF07084, 37%) and DmeF of A. fabrum (AAK86697, 52%), so we designated the SM0020-17742 gene dmeF. In C. metallidurans and A. tumefaciens, the DmeF protein has an important role in cobalt and nickel resistance (Dokpikul et al., 2016; Munkelt, Grass & Nies, 2004). However, the phylogenetic tree based on the DmeF protein sequence showed that the DmeF proteins of S. meliloti CCNWSX0020, S. arboris and S. medicae are more closely related to each other than that of C. metallidurans and A. tumefaciens (Fig. S1). DmeF of S. meliloti SM0020 contained six predicted transmembrane segments (http://www.cbs.dtu.dk/services/TMHMM), with the histidine-rich stretch located between TMD4 and TMD5 (Fig. 1A). Another gene, SM0020_17737, is located directly upstream of dmeF (SM0020_17742) and predicted to be in the same operon with dmeF (Fig. 1B). SM0020_17737 encodes a 90-amino-acid protein that is highly homologous with DmeR belonging to the RcnR/CsoR family of metal-responsive transcriptional regulators. E. coli RncR binds to the rncA promoter DNA fragment in the absence of Ni²⁺ or Co²⁺, and the affinity of RncR for this promoter is reduced in the presence of excess nickel or cobalt. Alignment of sequences revealed that the upstream region of SM0020_17737 contains an inverted repeat (ATAGGGTACCCCCCTATGCTATG) between -35 and -10 similar to the dmeRF promoter of A. tumefaciens (Dokpikul et al., 2016). These observations suggest that the expression of both SM0020_17737 and SM0020_17742 (dmeF) might be regulated by the SM0020_17737 gene product, so the SM0020_17737 gene was designated as dmeR.

Nickel and cobalt induced dmeRF gene transcription in S. meliloti CCNWSX0020

Since heavy metal efflux systems of other bacteria are activated in the presence of the corresponding metal cation, we decided to investigate which metal could affect the expression of the dmeR and dmeF genes in S. meliloti CCNWSX0020 besides Cu²⁺. Expression of the dme R and dmeF genes was analysed first in free-living cells from S. meliloti CCNWSX0020 under different metal stresses. The expression of dmeF was strongly up-regulated by Ni²⁺, Co²⁺ and Cu²⁺ exposure (∼30-fold for 0.5 mM Ni²⁺, ∼40-fold for 0.3 mM Co²⁺ and ∼25-fold for 0.5 mM Cu²⁺), while the expression of dmeR was induced by Ni²⁺ (30-fold), Co²⁺ (30-fold) and Cu²⁺ (20-fold) (Fig. 2A). No significant induction of dmeR and dmeF was observed when Zn²⁺, Pb²⁺, or Cd²⁺ was added at concentrations up to 0.5 mM (Cd²⁺, 0.2 mM). The dmeR gene was located directly upstream of dmeF, and deletion of dmeR led to enhancement of the dmeF gene expression with or without nickel/cobalt stresses; meanwhile, the expression of dme RF was increased by cobalt and nickel treatment (Figs. 2B and 2C). These results suggested that DmeR is a cobalt/nickel sensor and regulates the expression of dmeF and its own.

Functional analysis of dmeF in the CCNWSX0020 strain

To determine the function of DmeF in S. meliloti CCNWSX0020, the dmeF mutants were constructed by homologous recombination, resulting in strain SM0020ΔdmeF. Since the DmeF protein, belonging to a cation diffusion facilitator, was responsible for resistance to nickel and cobalt in A. tumefaciens C58 (Dokpikul et al., 2016), the sensitivities of S. meliloti CCNWSX0020 and dmeF mutant were characterized using metal-tolerance growth assays in TY solid medium. The dmeF mutant was more sensitive to 0.3 mM CoCl₂ (10-fold) and 0.5 mM NiCl₂ (10³-fold) than the wild type, and the growth of the dmeF mutant was completely inhibited by 0.4 mM CoCl₂ (Fig. 3). However, the resistance of the dmeF mutant to other metals, including CuSO₄, CdCl₂, Pb(NO₃)₂, and ZnCl₂, was similar to the wild type. Surprisingly, the gene expression of dmeF was strongly induced by 0.5 mM CuSO₄ (Fig. 2A), but there was no difference in the growth of the dmeF mutant and wild type under copper stress. It is probable that Cu²⁺ could bind to DmeR and induce the expression of the dmeRF operon, but DmeF was only the specific transporter of Co²⁺ and Ni²⁺. To verify the presence of the dmeF genes that were responsible for cobalt and nickel resistance, the dmeF PCR fragments containing the 550-bp upstream sequence of dmeR were inserted into the pBBR1MCS-5 vector, transformed into the corresponding mutant and then tested for these metal tolerances. Figure 3 shows that complemented strains could restore the cobalt and nickel resistance of the mutants. These results demonstrated that DmeF plays an important role in resistance to cobalt and nickel in S. meliloti CCNWSX0020.

Maximum tolerable concentration of the dmeF mutant

S. meliloti CCNWSX0020 and the dmeF mutant were cultured in TY medium supplemented with increasing concentrations of CoCl₂, NiCl₂, ZnCl₂ and CuSO₄, and the growth of the wild type and dmeF mutant was analysed after 48 h. As shown in Fig. 4, the dmeF mutant exhibited sensitivity to different concentrations of Co²⁺ and Ni²⁺ but not to other metals. The growth of the dmeF mutant was significantly inhibited if the concentration of nickel or cobalt was higher than 0.8 mM or 0.6 mM, respectively. The maximum tolerances of the S. meliloti CCNWSX0020 wild type to Co²⁺ and Ni²⁺ were 1.0 mM and 1.2 mM in TY liquid medium. In contrast, ZnCl₂ and CuCl₂ had no obvious effect on the growth of the wild type or mutant.

Deletions of dmeF decreased nodule number

To determine the effects of dmeF on the symbiotic capacity of S. meliloti CCNWSX0020, M. lupulina seedlings were inoculated with the wild-type strain CCNWSX0020 or the dmeF mutant. The plant length, nodule numbers and nitrogenase activities were determined to evaluate the symbiotic efficiency. Both S. meliloti CCNWSX0020 and the dmeF mutant can form well-defined rod-shaped pink nodules with M. lupulina. No significant difference was observed in the nodule number between the wild-type strain and the dmeF mutant without Ni²⁺ or Co²⁺ stress. However, the number of nodules produced by the dmeF mutant decreased significantly (P < 0.01) compared to the nodule numbers generated by the wild-type strain under Ni²⁺ or Co²⁺ stress (Fig. 5).

For single metal treatment, the nodule number of the plant inoculated with the dmeF mutant decreased by about 32.2% or 24.9% compared to the wild-type strain under 50 mg/kg or 100 mg/kg nickel stress, respectively. The same trend was observed when perlite-vermiculite were supplemented with CoCl₂. The nodule number of M. lupulina inoculated with the dmeF mutant was about 31.9% or 24% less than those inoculated with S. meliloti CCNWSX0020 in the presence of 50 mg/kg or 100 mg/kg CoCl₂, respectively. No significant decreases (P < 0.05) in the root and shoot length of M. lupulina inoculated with the dmeF mutant were observed compared with those inoculated with S. meliloti CCNWSX0020 in the presence of Ni²⁺ or Co²⁺ (Fig. S2). Since the nodulation of plants inoculated with the dmeF mutant showed a significant reduction by treatment with CoCl₂ and NiCl₂ compared to the controls, the nitrogenase activity of the nodules formed by the wild-type strain and dmeF mutant were determined. Table 2 indicates that the nitrogenase activities per plant for M. lupulina inoculated with dmeF mutant were reduced by ∼44% or 40% compared to that of S. meliloti CCNWSX0020 under 100 mg/kg Ni²⁺ or Co²⁺ stress. However, when standardized by nodule wet weight, the rate of acetylene reduction by nodules infected with the dmeF mutant was not statistically different from nodules infected with the wild-type strain. When rhizobium successfully infected the nodule cells, it would be dyed blue by toluidine blue. The histological organization of nodules showed that the proportion of infected cells (blue-stained N-fixing cells) within the nodule tissue induced by the dmeF mutant was not significantly lower than that of the wild-type strain (Fig. 6).