The role of TRIF protein in regulating the proliferation and antigen presentation ability of myeloid dendritic cells through the ERK1/2 signaling pathway in chronic low-grade inflammation of intestinal mucosa mediated by flagellin-TLR5 complex signal

Main instruments

AB Step One plus Real Time PCR System (Applied Biosystems AB, Waltham, MA, USA); Stabilized DNA electrophoresis apparatus (Bio-Rad, Hercules, CA, USA); Trace DNA/RNA quantification instrument (Thermo Fisher Scientific, Waltham, MA, USA); Tanon-1600 gel imaging system (Tanon, Shanghai, China); Amicon Ultra-15 100 KDa concentrator (Millipore, USA); Flow cytometer (Beckman, USA); Multifunctional ELISA reader Varioskan LUX (Thermo Fisher Scientific).

Main reagents

RNAiso plus 9109 Q (TaKaRa Tokyo, Japan); Hifair^® III 1st Strand cDNA Synthesis Kit (gDNA digester plus)11139 ES 10 (YEASEN, Shanghai, China); Hieff UNICON^® Universal Blue Qpcr SYBR Green Master Mix 11184 ES 03 (YEASEN); Recombinant flagellin protein derivative CBLB502 (InvivoGen, Toulouse, France); TIRF-specific antagonist Pepinh-TRIFTFA (MCE, Sichuan, China); EMEM culture medium (ATCC, Manassas, VA, USA); DMSO (Sigma-Aldrich, St. Louis, MO, USA); Fetal bovine serum (Gibco, Waltham, MA, USA); Plasmid mini extraction kit (Omega, Norcross, GA, USA); Plasmid maxi extraction kit (Omega, Norcross, GA, USA); EcoRI (TaKaRa, Japan); BamHI (TaKaRa); RNAisoplus (TaKaRa); TLR5 antibody (rabbit source; Proteintech, Rosemont, IL, USA); TRIF antibody (rabbit source, Affinity, USA); P-ERK1/2 antibody (rabbit source; Abcam, Waltham, MA, USA); CD80 (B7-1) Monoclonal Antibody, PE (eBioscience, San Diego, CA, USA); CD86 (B7-2) Monoclonal Antibody, PE (eBioscience, San Diego, CA, USA); MHC Class I (H-2Kb) monoclonal antibody, PE (eBioscience, San Diego, CA, USA); MHC Class II (I-A/I-E) monoclonal antibody, PE (eBioscience); Cell Counting Kit (Beyotime Biotechnology Co., Ltd., Haimen, China); rat interleukin 4 (IL-4) ELISA (Jiangsu Jingmei Bioengineering Co., Ltd., Guangzhou City, China); rat interleukin 12 (IL-12) ELISA kit (Jiangsu Jingmei Bioengineering Co., Ltd., Guangzhou City, China).

Grouping

Divide mouse bone marrow-derived dendritic cell line DC2.4 into four groups.

Normal control group (BC): DC2.4 cells in normal culture group;

Single signal group of flagellin protein (DC2.4+CBLB502): DC2.4 cells were stimulated with 100ng/mL of flagellin protein derivative CBLB502.

TLR5-flagellin protein complex signal stimulation group (ov-TLR5-DC2.4+CBLB502): After TLR5 gene overexpression treatment of DC2.4 cell line, ov-TLR5-DC2.4 cells were established and stimulated with 100ng/mL of flagellin protein derivative CBLB502.

TRIF signal inhibition group (ov-TLR5-DC2.4+CBLB502+Pepinh-TRIFTFA): After stimulating ov-TLR5-DC2.4 cells with 100ng/mL of flagellin protein derivative CBLB502, TRIF-specific inhibitor Pepinh-TRIFTFA at 40 µM was added for intervention. See Fig. 1 for details.

Cell culture

Mouse bone marrow-derived dendritic cell line DC2.4 was cultured in EMEM medium containing 10% FBS and 1% penicillin-streptomycin double antibody. It was cultured in a cell culture incubator at 37 °C, 5% CO2, and 100% relative humidity; the cells adhered to the wall and were passaged for subsequent experiments.

QT-PCR

Validation of ov-TLR5-DC2.4 cell line TLR5 gene transfection efficiency: internal reference and target gene primers were designed according to the gene accession number published by NCBI:

β-actin-F GATATCGCTGCGCTGGTCG 132 bp

β-actin-R CATTCCCACCATCACACCCT 132 bp

TLR5-F CCACATCATGGGGTTCTGGCT 100 bp

TLR5-R AAGGTCCAGTTGTAGCACCG 100 bp

A total of 1 ml of RNAiso was added to the cell samples. A homogenate was made and the supernatant was centrifuged. Isopropanol was added to precipitate the RNA. The supernatant, and 1 ml of 75% ethanol was added, centrifuged for 5 min, dried at room temperature. The appropriate amount of RNase-free water was added to dissolve the precipitate, and then an ultra-micro-spectrophotometer was used to determine the quantity and concentration of the RNA. The quality and concentration of RNA were determined by ultra-micro spectrophotometer. qPCR was performed after reverse transcription of RNA, and the reverse transcription reaction system was prepared as follows: Hieff UNICON Univeral Blue Qpcr SYBR Green Master Mix 5 µL; forward and reverse primers (10 µM each) 0.4/0.4 µL; Template DNA/cDNA 1 µL; Template DNA/cDNA 1 µL; Template DNA/cDNA 1 µL; Template DNA/cDNA 1 µL. cDNA 1 µL; RNase Free ddH2O Up to 10 µL. Reverse transcription reaction conditions were set: 95 °C for 2 min for 1 cycle, 95 °C for 10 s for 40 cycles, 60 °C for 30 s for 40 cycles. The final plasmid copy number was calculated: slope−3.219; Y-Inter: 7.349; R²: 0.994; Eff%: 104.482.

Drug intervention

Recombinant flagellin protein derivative CBLB502 for mice: 10 ug powder dissolved in 0.1 ml DMSO. A stock solution was prepared with a concentration of 100 ug/mL for later use; TRIF-specific inhibitor Pepinh-TRIFTFA: A total of 500 ug of powder was dissolved in 0.0374 mL of DMSO to prepare a stock solution with a concentration of 50 mM.

(1) Cells were resuspended and plated in separate dishes for each group until the cell fusion degree reaches about 80%; (2) Different doses of drugs were added according to the grouping information mentioned above; (3) and incubated in a culture box for 24 h.

WB detection of TRIF and p-ERK1/2 protein expression in each group of cells

Add 0.1 ml cell lysis buffer to lyse cells in every 106 cells. Then, after preparing the BSA standard curve, each group sample was tested. A total of 100 µL of the diluted test sample was added to the microplate, with three parallel samples for each sample, and then 100 µL of working solution was added and mixed. The reaction was carried out at 37 °C for 60 min and then cooled to room temperature. Finally, the spectrophotometer was set to a wavelength of 562 nm for measurement. The protein concentration of the test sample was calculated based on the standard curve by subtracting the average absorbance value of the blank from that of each sample solution, and SDS-PAGE electrophoresis and exposure were performed.

CCK8 assay was used to detect the proliferation of dendritic cells in each group

After drug intervention, the cells were tested at three time points of d3, d5, and d7, and four sub-wells were set up for each group of cells. A total of 50 µL of CCK-8 solution was added to each well, and the culture plate was incubated in a culture box for 3 h. After incubation, the plate was evenly shaken and 100 µL was taken from each well and placed in a 96-well plate. The absorbance value at 450 nm was measured using an enzyme-linked immunosorbent assay (ELISA) reader. Cell absorbance value = sample well absorbance value - blank control well absorbance value.

Flow cytometry was used to detect the expression of surface MHCI molecules, MHCII molecules, CD80, and CD86 in each group of DCs

The cells in each group were treated with trypsin, centrifuged to obtain cell pellets, and resuspended in approximately 1 mL of pre-cooled PBS. After centrifugation, the cells were resuspended in 400 ul of PBS (approximately 2 × 106 cells) and divided into four sample tubes, as well as a control tube. CD80/PE (1:200), CD86/PE (1:100), MHCClassI/PE (1:80), and MHCClassII/PE (1:200) flow cytometry antibodies were added to each of the four sample tubes and incubated at room temperature in the dark for 20 min. The tubes were then centrifuged at 1,000 rpm at 4 °C for 5 min, and the supernatant was discarded. This washing process was repeated three times. Finally, cells were resuspended in 100 µL PBS and analyzed by flow cytometry.

IL-12 and IL-4 cytokine levels were detected by ELISA in each group

Purified rat IL-12 and IL-4 capture antibodies were coated onto microplates to make solid-phase antibodies using IL-12 and IL-4 ELISA kits. IL-12 and IL-4 were added to the coated microplates, followed by binding with HRP-labeled detection antibodies to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, TMB substrate was added for color development. The absorbance (OD value) was measured at 450 nm wavelength using an ELISA reader, and the IL-12 and IL-4 content were calculated in the sample based on the standard curve.

Statistical methods

Quantitative data are expressed as mean ± standard deviation, and qualitative data are expressed as frequency (n) and percentage (%). Depending on the specific situation after testing for data independence, normality, and homogeneity of variance, single-factor analysis of variance (ANOVA) or Kruskal–Wallis test is used for within-group comparison. When there is within-group difference, Bonferroni or Tukey post-hoc test is used for pairwise comparison between groups. Data statistical analysis is performed using Graphpad Prism software (GraphPad Software, La Jolla, CA, USA), and figures are made using Graphpad Prism and Figdraw software. P < 0.05 is considered statistically significant.