Ramazzottius subanomalus

Ramazzottius subanomalus (Biserov, 1985)

Locus typicus: Yango-Asker, Astrakhanskaya Oblast, Russia (Tables 4–5, Figures 1–33)

Description. Animals (morphometrics in Table 4): Pigmentation of the cuticle from light-red to red-brown chequered pattern on the dorsum. Cuticle smooth (without sculpture, granulation or gibbosities) (Figs 1–3). Eyes absent in live animals. Two elliptical organs on head only clearly visible under SEM (Fig. 2).

Bucco-pharyngeal apparatus of the Ramazzottius -type (Figs 4–12). Mouth opening antero-ventral. Oral cavity armature only partially visible under PCM, clearly visible under SEM. The armature composed of two bands of teeth, both located in the posterior oral cavity (Figs 4–5). The first band of teeth absent. The second band composed of very small cone-shaped teeth arranged in 3–5 irregular rows, located on the ring fold (Fig. 5, arrowhead). The third band composed of a single row of ten large and regularly spaced cone-shaped teeth located just behind the second band of teeth (Fig. 5, arrow). The second band of teeth not visible under PCM, the third band barely detectable under PCM in only some specimens. Apophyses for the insertion of stylet muscles (AISM) in the shape of blunt hooks and asymmetrical in size and shape with respect to the frontal plane (Figs 8–10). Stylet furcae with rounded ends (Fig. 7). Buccal tube with a posterior bend and thickened walls posteriorly from the stylet support insertion point. Pharyngeal bulb (bulbus) almost oval, with apophyses and two clearly separated macroplacoids. Pharyngeal apophyses triangular, smaller than macroplacoids. First macroplacoid slightly elongated, second roundish, but the size and shape of placoids exhibit considerable variation; particularly obvious under SEM (Figs 11 a,b,c–12a,b,c). Macroplacoids appear without constrictions under PCM, but slight constrictions in both macroplacoids are visible in the majority of buccal apparatuses observed under SEM (Figs 6, 11 a,b,c–12a,b,c). Macroplacoid length configuration 2<1. Microplacoid and septulum absent (Figs 6, 11–12).

Claws of the Ramazzottius - type. Primary branches of external and posterior claws long and thin. Internal and anterior claws much smaller and of a different shape than external claws (Fig. 13–15). Base of external and posterior claws distinctly enlarged, internal and anterior claws with small and smooth pseudolunules. Accessory points on primary branches of all claws, present. Bars and other cuticular thickenings on legs, absent.

Eggs (morphometrics in Table 5): Laid freely, white and spherical, covered with numerous small, thorn-, spine- or filament-shaped processes (Figs 16–29). Always triangular in shape, processes exhibit extreme diversity in size (both height and base width), morphology (e.g. single examples exhibiting transverse septa), as well as in their distribution on the egg surface (Figs 16–29). The greatest variability was observed between eggs, however exceptional variability can also sometimes be observed within an individual egg. There is also a considerable variability in process numbers on the egg surface—from fully covered to almost bald eggs with sparse and poorly developed processes. Egg processes and surface between processes smooth (Figs 16–29).

DNA: Obtained sequences were identical across the three analysed individuals (i.e. only a single haplotype was found).

The obtained COI sequence (GenBank: MF001999) is 822 bp long and it encompasses a longer fragment than the 358 bp long COI sequence provided in Stec et al. 2016a (i.e. KU900021):

TATATGGAACATTATATTTTATTTTCGGCATTTGAGCCGCCACTGTGGGCACCTCCTTAAGAATAATTATTCGATC AGAATTAAGAGAACCCGGATCATTGTTCGCGGAAGAACAACTATACAATGTAACAGTAACTAGACACGCTTTCATT ATGATTTTTTTCTTTGTTATACCCATCCTGATTGGAGGTTTTGGAAATTGATTAGTGCCTCTTATGGTTGGCGCGC CGGATATAGCTTTCCCCCGAATAAATAACTTAAGATTTTGACTACTACCCCCGTCATTTTTATTAATTTCTACAAG CACTATGAGAGAGCAGGGCGCAGGCACCGGATGAACAGTATACCCACCCCTCTCAAACTATTTCGCACATAGGGGA CCTGCCGTAGATTTAACTATTTTTTCTTTACATATTGCAGGTGTTTCCTCTATTTTAGGGGCCATTAATTTTATTT CCACAATTATAAATATACGAACCCCGTCAGTCAGATTAGAGAACATATCTCTCTTCGTTTGATCAGTCCTAATTAC TGCAGTATTATTACTTTTAGCGCTCCCAGTGCTCGCAGGAGCGATTACAATACTACTTCTAGATCGAAATTTTAAT ACCTCATTTTTTGATCCGGCAGGAGGTGGAGATCCGATTCTTTACCAACACCTGTTTTGATTTTTCGGACATCCAG AAGTTTACATTCTTATTTTGCCTGGTTTCGGTTTAGTGTCACAAATTATTGTCCACTACAGAGGGAAACACCTTAC GTTTGGACACTTAGGAATAATTTATGCTATAAGAACTATCGGTTTATTGGGGTTCATCGTTT

The obtained 28S rRNA sequence (GenBank: MF001998) is 787 bp long:

TACTAAGCGGAGGAAAAGAAACCAACGGGGATTCCCATAGTAACTGCGAGTGAAAGGGGAAGAGCCCAGCGCCGAA TCCTACTGCTGGCAACGGTGGTAGGAACTGTGGCGTGAAGACAGTCTATTCCAGTGCGGCTAGCTTGCGTAAGTTC TCCTGAGTGAGGCTCCATCCCATGGAGGGTGCAAGGCCCGTATCGTAAGCAGCTGGTGCTGGTATCAGCTGTCGGA GAGTCGCCTTGTTTGCGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGA TAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTTAGA GGCAAGCAGATGGGGCCTCGAAGGCAAAGCAGTGAATTCAGCTGGTAGTCCGTAGTGCCGGCCTGCATTACAGATC GCAAGACTGTGGCAGGTTGTGAGGCTGCGGCTGCTAGTGCACTTTCACTGTTTGTACGCCACCGCCGTTGAGCGAG CGTCCGTCTAGCTGGCGTGTGAAGCCTTGTTCCCTTTACGGGGTTACAGGTGTCTTACTGCCGGTCACGACGCGTT CGCACCTCAACCGGTCATGTCAGCGTGTGCCAGCGTATTGCGTTGGGCTCGTTCACCCTGGTGTGCGTCGGAGATG ACAAGCTCGCTTGGCTCACTGGCGTATTGCCTGGGAATGGGCGGGTTTGCAACGTAGGCACATTGTCGATTCGGTG GCGAGTAGACGGCTGCCCATCTAACCC

The obtained 18S rRNA sequence (GenBank: MF001997) is 1034 bp long:

AGATCGTACAGTTTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCATTCAGCTCGCTCTCTCGGGAGCG AGCGCAGTTATTAGAATAAAACCAATCCGGCCTTCGGGTCGGTAAAATTGGTGACTCTGAATAACCGAAGCGGAGC GCATGGTCTCGTACCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTCGTAGGTAGGTTATGTGCCTACCTAG GCTCTTACGGGTAACGGGGTGTCAGGGCCCGACACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAG GCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATGCGAGAGCTTTTAGCT TTTCGTAATCGGAATGGGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCG CGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGTTGTTCGA GCGAGCGGTGCGTCTTCACGGCGTAACTGTTTGTTCGGCACCACAGCCCGGTTATGTCTTGCATGCCCTTCACTGG GTGTGCTTGGCGACCGGAACGTTTACTTTGAAAAAATTAGAGTGCTCAAAGCAGGCGTATGGCCTTGCATAATGGT GCATGGAATAATAGAATAGGACCTCGGTTCTATTTTGTTGGTTTTCGGAGCTCGAGGTAATGATTAATAGGAACAG ACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGGATCGTCGCAAGACGCACTACTGCGAAAGCATTTG CCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAGGCGATCAGATACCGCCCTAGTTCTAACCAT AAACGATGCCAACCAGCGATCCGTCGGTGTTTGTTTTATGACTCGACGGGCAGCTTCCGGGAAACCAAAGTGTTTA GGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGAATGAC

See also Stec et al. (2016a) for the sequences of the two known ITS-2 haplotypes (KU900019 –20).

CHARACTER R. anomalus R. subanomalus R. subanomalus (holotype) (holotype) (a Polish specimen) Intraspecific variability in morphology and morphometry. In the same population of R. subanomalus as used for this study, Stec et al. (2016a) analysed intra-specific variability in the standard morphometric traits of both animals and eggs in relation to the genetic variation uncovered. However, Stec et al. (2016a) concentrated on analysing the determinants of eggshell variability, and thus their study lacked a comparison of the recorded variability with that described by Biserov (1985) in the original description of R. subanomalus. Compared to the type series (measurements by Biserov 1985 provided in Table 6 and new photomicrographs in Figs 30–35), our Polish population of R. subanomalus exhibited a wider range for several morphometric traits, e.g. macroplacoid I length (2.3–4.5 µm in the type population vs. 3.8–6.0 µm in the Polish population), egg process height (3.0–6.6 µm in the type population vs. 1.5–12.5 µm in the Polish population), egg process base diameter (2.0–4.5 µm in the type population vs. 0.5–9.9 µm in the Polish population). Thus, the most striking variability in R. subanomalus was observed not in the animals, but in the number, size and shape of the egg processes (Figs 16–29; see also Stec et al. 2016a). Biserov (1985) described R. subanomalus eggs as covered with cone-shaped processes of similar size, but our observations considerably widen the range of chorion morphology in this species. We suspect that if, for example, eggs shown in Figs 16, 20, 26 and 29 were found in different samples, it is very likely that they would be classified as four different species. Even though egg morphology is considered to provide key taxonomic traits for the differentiation of many eutardigrade taxa, including the genus Ramazzottius, the evidence presented in this paper plus that provided by Biserov (1996) for Ramazzottius montivagus (Dastych, 1983) and in Biserov (1997/8) for Ramazzottius caucasicus Biserov, 1998 and Ramazzottius ljudmilae Biserov, 1998, suggest egg morphology has a limited value for the differentiation of at least some Ramazzottius species. Since the taxonomy of Ramazzottius was based solely on alpha taxonomy (i.e. morphology and morphometrics), there is a problem even if the stability of egg traits is assumed. Our study, therefore, underlines the importance of providing an integrated analysis of species, combining classic taxonomy with the molecular approach, to delineate the species in this genus (see also Stec et al. 2016a).

R. subanomalus vs. R. anomalus. The spine-shaped egg processes and qualitative as well as quantitative characters of the adults, indicate Ramazzottius subanomalus is most similar to Ramazzottius anomalus (Ramazzotti, 1962) (Figs 36–38). The two species are very similar with the only recorded qualitative difference between them being the presence (R. anomalus; Fig. 37, indented arrowhead) or absence (R. subanomalus; Figs 16–29 and 34) of a fine granulation on the eggshell surface. It also appears that the egg processes of R. anomalus have a more evident septa between their basal and distal parts (Figs 37–38). In addition, Biserov (1985) also noted that the egg processes are on average 6.7 µm taller in R. anomalus than R. subanomalus. However, our observations (see Figs 16–29 and Table 5) now question whether the number, size and shape of egg processes are a reliable taxonomically trait in differentiating the two species: i.e. process height in the Polish population of R. subanomalus ranged from 1.5 to 12.5 µm, and thus largely overlap the values reported by Ramazzotti (1962) for R. anomalus (i.e. 5.0–12.0 µm).

In the absence of eggs, differentiating between individuals of R. anomalus and R. subanomalus relies exclusively on three morphometric differences: R. anomalus has a shorter buccal tube and placoids (both macroplacoids in absolute values, but only the first macroplacoid in pt values). The remaining morphometric characters are very similar in the two species (see Table 6 for a full comparison). However, as R. anomalus was described over half a century ago and tardigrade taxonomy has moved forward, the original description lacks many key measurements (Table 6), so there could be more morphometric differences between R. anomalus and R. subanomalus which we are currently unaware of. In other words, a modern integrative re-description of R. anomalus is very desirable in order to confidently differentiate the species from other congeners with similar adult and egg morphology. Also, as this is only the second report for R. subanomalus, data from other populations of this species are required for the better estimation of the extent of R. subanomalus intraspecific variability.

Ramazzottius DNA sequences. The COI sequence for the Polish population of R. subanomalus proved to be distinct from all the Ramazzottius COI sequences that were available from GenBank and suitable for analysis, with p-distances ranging from 19.0 to 20.0% (EU251379 and EU251381, respectively). This figure is well above the 3% threshold proposed for species delineation (Cesari et al., 2009, but see also Michalczyk et al. 2012a). Similarly, our 28S rRNA sequence, with the p-distance of 3.1%, was distinct from the single available and suitable Ramazzottius sequence (FJ435768). Regarding the 18S rRNA, the p-distances ranged from 0.4% to 1.1% (FJ435727 –8 and HQ604950, AY582122, respectively). The scarcity of available molecular data for Ramazzottius spp. underlines the need for more integrated taxonomy and ecological studies to provide DNA sequences from a variety of populations for any given tardigrade species. Without such large-scale systematic studies, threshold values or barcode gaps for species delineation in tardigrades cannot be confidently estimated or used for species delineation.

Ramazzottius in Poland. Hitherto there have been four species of Ramazzottius reported from Poland: R. anomalus (in Dastych 1988), R. montivagus (in Dastych 1980), R. oberhaeuseri (in Kranz-Leśniewska 1933, Marcus 1936, Węglarska 1959a, b, Hęciak 1976, Węglarska & Korecka 1983, Dastych 1970, 1972, 1979, 1980, 1988, Kaczmarek & Michalczyk 2003ab, Zawierucha 2011, Zawierucha et al. 2012), and R. subanomalus (in Stec et al. 2016a). However, for the following reasons, we think that the Polish record of R. anomalus is invalid. First, the R. anomalus report by Dastych (1988) was for Jakubowo, which is only ca. 45 km from Poznań (where the population of R. subanomalus reported in this paper was found), whereas the type locality for R. anomalus was Cerro El Roble in Chile, over 12,500 km away. Second, the measurements provided for the Polish R. anomalus (see Dastych 1988) are similar to those of R. subanomalus. Third, the eggs of the Polish R. anomalus were described as having a smooth chorion between processes (see Dastych 1988), and are granulated in R. anomalus (see Fig. 39). Finally, at the time of publishing his monograph, Dastych (1988) was probably unaware of the Biserov (1985) publication in a Russian journal (not cited in Dastych 1988). Thus, it seems reasonable to conclude that the species Dastych (1988) recorded from Jakubowo in 1978 was actually R. subanomalus rather than R. anomalus. We therefore think that R. anomalus should be deleted from the list of Polish tardigrade species, and be substituted with R. subanomalus. However, this being an exchange rather than an addition to the record, the overall total number (103) of species recorded for Poland is unaffected.