LoVo cells were derived from a human colon adenocarcinoma. 5-FU-resistant LoVo sub-line (LoVo/5-FU) was obtained from the LoVo cell line by selection with 5-FU[15], and maintained in medium containing 5 ng/mL 5-FU as described previously. LoVo/5-FU cells were kindly provided by Dr. Xue-Qing Yao. Monolayer cultures of LoVo and LoVo/5-FU were maintained in RPMI 1640 medium supplemented with 150 g/L heat-inactivated fetal calf serum (Sigma Chemical Co), 10 mL/L of a 200 mmol/L glutamine solution, 100 U/mL penicillin, 100 µg/mL streptomycin, and 10 g/L vitamin solution for minimum essential Eagle’s medium purchased from GIBICO-BRL (Gaithersburg, MD). Cell lines grown in the presence of agents were passed in drug-free medium 2 to 3 times prior to use. All cells were grown at 37 °C in a humidified atmosphere of 50 mL/L CO₂ and 950 mL/L air.

Construction and identification of Ad-p53 and Ad-LacZ were finished and kindly provide by Dr. Xin-Hua Yin. Briefly, recombinant p53 adenovirus, Ad5CMV-p53 containing cytomegalovirus promoter, wild-type p53 cDNA, and SV40 early lopyadenylation signal in a minigene cassette was inserted into the E1-deletion region of modified Ad5. p53 shuttle vector and recombinant plasmid pJM 17 were cotransfected into 293 cells (Ad-transformed human embryonic kidney cells) by a liposome-mediated technique. The culture supernatant of 293 cells showing the complete cytopathic effect was collected and used for subsequent infections. Control Ad-LacZ virus was generated in a similar manner. Viral titers were determined by plaque forming activity in 293 cells. Concentrated virus was dialyzed, aliquoted, and stored at -80 °C. Cells were harvested 36-40 h after infection, pelleted, resuspended in PBS, and lysed. Cell debris was removed by double cesium chloride gradient ultracentrifugation.

Adherent cells were plated in the wells of a 12-well plate. After 24 h, Ad-LacZ was transfected into the cells in different diluting densities. Forty-eight transfection, the cells were washed twice with PBS and fixed for 2 h with 40 g/L formaldehyde solution at 4 °C, then washed twice again with PBS and stained with 1 g/L X-gal solution for about 8 h at 37 °C. Observed under the electron microscope, the cells with blue staining were positive cells with LacZ expression, and calculated to determine the transfection efficiency.

Chemosensitizers in the various cell lines were determined by using the tetrazolium-based colorimetric assay (MTT [i.e., 3-(4,5-dimethy1-2-thiazoly1)- 2m 5-dipheny1-2H-tetrazolium bromide] assay). Cells (LoVo/5-FU/Ad-p53 cells, LoVo/5-FU cells, LoVo cells;) were seeded in a 96-well microtiter plate at a density of 1 × 10⁵ cells/well and each well contained 200 µL medium. Cells were exposed 24 h after plating to various concentrations of 5-FU for 4 h. After treatment, medium was removed and replaced with 200 µL of drug-free medium. Plates were incubated for further 72 h. At this time, 15 µL of MTT (4 mg/mL) solution was added to each well. After a 4-h incubation at 37 °C, the cellular supernant was gently aspirated, and insoluble formazan crystals were dissolved by adding 180 µL 1000 g/L DMSO (dimethyl sulfoxide) to each well, then the plates were shaken for about 10 min. The absorbance of each well was determined by a spectrophotometry at the wavelength of 570 nm with a microculture plate reader. Inhibition of cell growth was determined as a percentage of absorbance of vehicle-treated control cultures. IC₅₀ was the concentration of drugs that reduced staining (A₅₇₀) to 50% of vehicle-treated controls.

The effect of chemosensitizers on drug resistance was studied by exposing cells to a range of concentrations of cytotoxic drugs in the absence or presence of concentrations of chemosensitizers. Dose-response curves were corrected for the inhibition of cell growth caused by chemosensitizers alone, and the “fold reversal” of MDR for 5-FU plus chemosensitizer combination was calculated as follows: Fold reversal = IC₅₀ drug alone/(IC₅₀ drug + chemosensitizer)

Cells infected with the indicated adenovirus and MOI were grown to about 80% confluence in 10-cm plates. After washed with PBS, cells were scraped from the plate, washed once with ice-cold PBS containing 1 mmol/L phenylmethylsulfonyl fluoride, and centrifuged at 1000 r/min for 4 min. The cell pellet was resuspended in ice-cold radioimmunoprecipitation assay buffer (1% NP40, 0.5% sodium deoxycholate, and 1 g/L SDS, 10 µg/mL aprotinin, 10 µg/mL leupeptin and 1 µg/mL pepstatin A) and sonicated. After centrifugation at 12000 g at 4 °C for 20 min, the resulting supernatant was harvested as the total cell lysate. The protein was aliquoted and stored at -70 °C until use. Protein samples were electrophoresed through a 125 g/L polyacrylamide gel containing 1 g/L SDS and the gel was run at 30 mA for 3 h. Separated proteins were transferred onto nitrocellulose paper by electroblotting. After blocked with 50 mL/L blocking reagent, the nitrocellulose membrane was probed with a monoclonal antibody against human wild-type p53 from Oncogene Science. Detection was accomplished using ECL western blotting detection reagents from Amersham Pharmacia Corp.

Expression of the MDR1 gene was determined by measuring the mRNA level from total RNA by SUPERSCRIPT^TM first-strand synthesis system (GIBCO BRL,Gaithersburg, MD), using MDR1-specific primer pairs. Briefly, total RNA was extracted from established lines with TRIzol reagent (Life Technologies, Inc.). Equal amounts of RNA, as determined by absorbance at 260 nm, were denatured and size was fractionated by electrophoresis through a 12 g/L agarose gel containing formaldehyde and 2 µg/dL ethidium bromide (Figure 1). Equal amounts (1 µg) of total RNA from each tissue were treated with RNase-free DNAse I to remove any contaminated DNA. DNAse-treated RNA was then used to synthesize single-strand cDNAs by AMV reverse transcriptase in the presence of random primers, followed by PCR amplification. The primers used for PCR reaction were: MDR1-1,GTACCCATCATTGCAATAGC and MDR1-2,CAAACTTCTGCTCCTGAGTC. These two MDR1 primers bracketed the COOH-terminal region of the MDR1 cDNA and gave a PCR product of 147 bp. PCR amplification was performed by pre-denaturing at 95 °C for 3 min, and then running 30 cycles in the following conditions: denaturation at 94 °C for 40 s, annealing for 40 s at 55 °C, and extension at 72 °C for 50 s. As internal control, RT-PCR for β-actin was carried out using 5’CGTGGGCCGCCCTAGGCACCA3’ (forward primer) and 5’TTGGCCTTAGGGTTCAGGGGG3’ (reverse primer) in the same conditions as described for MDR1, and showed a PCR product of 243 bp. The PCR products were electrophoresed in a 20 g/L agarose gel with 0.5 µg/mL ethidium bromide and visualized under UV light. Quantitation of relative band volume counts was performed using Molecular analyst for windows software. To estimate MDR1 expression levels, a MDR1 index was designated as a band volume count ratio of MDR1 to constitutively expressed β-actin, because β-actin mRNA was expressed constitutively in cells. The higher the MDR1 index, the higher the expression level of MDR1 mRNA in cells.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 Effect of wild-type p53 on the growth rate of LoVo/ 5-FU cells.

The sensitivity of LoVo and LoVo/5-FU cells to 5-furouracil was evaluated using the MTT assay as shown in Table 1. Previous studies utilizing MTT assays have shown that the LoVo/5-FU cell line is 8.988-fold more resistant to 5-flurouracil than parental LoVo cells. We found the two cell lines showed differences in sensitivity to 5-flurouracil, too. The concentration inducing 50% inhibition of cell proliferation for 5-Flurouracil was 0.82 µg/mL for the parental line and 7.37 µg/mL for the LoVo/5-FU cells.

Figure 1 showed the effect of wild-type p53 on the LoVo/5-FU cells. It suggested that the dose of Ad-p53 for experiment didn’t affect the growth rate of LoVo/5-FU cells during the six days after transfection.

The effect of wild-type p53 on 5-flurouracil sensitivity was examined using the MTT assay. A dose of 8.17 × 10¹⁰ pfu/mL Ad-p53 was chosen as the dose to modulate 5-flurouracil sensitivity. For this study, cells were treated with wild-type p53 for 48 h, 5-flurouracil was then added to the final concentration of 0.25 to 15 µg/mL for 3 h, and then the medium was removed and replaced with a fresh medium without drugs and the incubation was continued. Cell growth was determined after an addition for 72 h. Treatment with wild-type p53 appeared to decrease the resistance of LoVo/5-FU cells to 5-flurouracil (Table 1).

The X-gal staining suggested that the dilution of 1:20 for Ad-p53 could make about more than 80% cells infected successfully. LoVo/5-FU was transduced in vitro with the human wild-type -p53 cDNA by exposing to Ad-p53 (1:20). To make sure that the constructed p53 expression vector, Ad-p53, efficiently expressed functional wild-type p53, we determined its protein expression and transactivating function. Western blot analysis showed a higher level of wild-type p53 protein expression as early as 48 h after infection with Ad-p53, and which lasted for 5 d, then decreased significantly on the sixth day. But no wild-type p53 was detected in parental (uninfected) cells or control cells infected with Ad-LacZ (data not shown), suggesting that the transfer and expression of p53 by Ad-p53 were highly efficient (Figure 2).

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Western blot analysis of wild-type p53 in LoVo/5-FU cell line and LoVo/5-FU cells transiently transfected with p53 expression vector (Ad-p53). Lane 1: LoVo/5-FU cell line. Lanes 2, 3, 4, 5, 6: LoVo/5-FU cells transiently transfected with Ad-p53 for 2, 3, 4, 5, 6 d accordingly. Levels of wild-type p53 protein (lanes 2-6) were determined by Western-blot analysis with an antibody which could detect wild-type forms of p53 protein.

We asked whether wild-type p53 expression could indeed inhibit endogenous MDR1 gene expression in LoVo/5-FU cells. Successful generation of cell lines constantly expressing wild-type p53 was tested in human LoVo/5-FU cells transfected with Ad-p53 as above, and these cells constantly maintained wild-type p53 for about 6 d and provided a valuable reagent for studying drug sensitivity. As seen in Figure 2, vector-transfected LoVo/5-FU cells expressing wild-type p53, had a lower MDR1 mRNA expression than LoVo/5-FU cells without wild-type p53 expression, as determined by RT-PCR. There was a decrease in MDR1 transcripts compared with the empty vector-transfected cell line, suggesting that constitutive expression of p53 could inhibit endogenous MDR1 transcription in LoVo/ 5-FU cells, and this suppression showed a time-dependent mode Figure 3, Figure 4 and Table 2, Table 3.

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Results of RT-PCR for expression of MDR1 mRNAs in p53-null and wild-type p53 expressing LoVo/5-FU cells. M: marker; Lanes 1 and 2: results of untransfected LoVo/5-FU cells; Lanes 3 and 4: results of transfected LoVo/5-FU cells.

Open in New Tab   Full Size Figure   Download Figure

Figure 4 Results of RT-PCR for expression of MDR1 mRNAs of transfected LoVo/5-FU cells at different time. M: marker; Lanes 1, 2, 3, 4, 5: the cells transfected with Ad-p53 for 2, 3, 4, 5, 6 d accordingly.