Influence of Nitrogen on Grapevine Susceptibility to Downy Mildew
Abstract
:1. Introduction
2. Results
2.1. Nitrogen Content
2.2. Photosynthetic Activity of the Plants
2.3. Pathogen Development and Disease Severity
2.4. Expression of the Candidate Susceptibility/Resistance Genes
3. Discussion
3.1. N Fertilization Influences Leaf N Content and the Photosynthesis
3.2. Pathogen Development and Disease Severity Are Reduced in Absence of N Fertilization
3.3. The Expression of the Candidate Susceptibility/Resistance Genes Is Not Influenced by N Fertilization
4. Materials and Methods
4.1. Plant Material, Growth Conditions and Sampling
4.2. Nitrogen Quantification
4.3. Photosynthetic Performance Analysis
4.4. Pathogen Infection
4.5. Gene Expression Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Conklin, A.; Stilwell, T. World Food; John Wiley & Sons: Hoboken, NJ, USA, 2007; ISBN 9780470043820. [Google Scholar]
- Huber, D.; Thompson, I. Nitrogen and plant disease. In Mineral Nutrition and Plant Disease; Datnoff, L., Elmer, W., Huber, D., Eds.; APS Press: St. Paul, MN, USA, 2007; pp. 31–44. [Google Scholar]
- Verdenal, T.; Dienes-Nagy, Á.; Spangenberg, J.E.; Zufferey, V.; Spring, J.-L.; Viret, O.; Marin-Carbonne, J.; Van Leeuwen, C. Understanding and managing nitrogen nutrition in grapevine: A review. OENO One 2021, 55, 1–43. [Google Scholar] [CrossRef]
- Sun, Y.; Wang, M.; Mur, L.A.J.; Shen, Q.; Guo, S. Unravelling the roles of nitrogen nutrition in plant disease defences. Int. J. Mol. Sci. 2020, 21, 572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Keller, M. Deficit Irrigation and Vine Mineral Nutrition. Am. J. Enol. Vitic. 2005, 56, 267–283. [Google Scholar] [CrossRef]
- Wheeler, S.; Pickering, G.J. Effects of soil management techniques on grape and wine quality. In Fruits: Growth, Nutrition and Quality; Dris, R., Ed.; WFL Publisher: Helsinki, Finland, 2005; pp. 195–208. [Google Scholar]
- Thomidis, T.; Zioziou, E.; Koundouras, S.; Karagiannidis, C.; Navrozidis, I.; Nikolaou, N. Effects of nitrogen and irrigation on the quality of grapes and the susceptibility to Botrytis bunch rot. Sci. Hortic. 2016, 212, 60–68. [Google Scholar] [CrossRef]
- De Oliveira, A.F.; Serra, S.; Ligios, V.; Satta, D.; Nieddu, G. Assessing the effects of vineyard soil management on downy and powdery mildew development. Horticulturae 2021, 7, 209. [Google Scholar] [CrossRef]
- Simón, M.R.; Fleitas, M.C.; Castro, A.C.; Schierenbeck, M. How Foliar Fungal Diseases Affect Nitrogen Dynamics, Milling, and End-Use Quality of Wheat. Front. Plant Sci. 2020, 11, 1568. [Google Scholar] [CrossRef]
- Fröbel, S.; Zyprian, E. Colonization of Different Grapevine Tissues by Plasmopara viticola—A Histological Study. Front. Plant Sci. 2019, 10, 951. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fagard, M.; Launay, A.; Clement, G.; Courtial, J.; Dellagi, A.; Farjad, M.; Krapp, A.; Soulie, M.-C.; Masclaux-Daubresse, C. Nitrogen metabolism meets phytopathology. J. Exp. Bot. 2014, 65, 5643–5656. [Google Scholar] [CrossRef]
- Toffolatti, S.L.; De Lorenzis, G.; Brilli, M.; Moser, M.; Shariati, V.; Tavakol, E.; Maddalena, G.; Passera, A.; Casati, P.; Pindo, M.; et al. Novel Aspects on The Interaction Between Grapevine and Plasmopara viticola: Dual-RNA-Seq Analysis Highlights Gene Expression Dynamics in The Pathogen and The Plant During The Battle For Infection. Genes 2020, 11, 261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zaidi, S.S.-A.; Mukhtar, M.S.; Mansoor, S. Genome Editing: Targeting Susceptibility Genes for Plant Disease Resistance. Trends Biotechnol. 2018, 36, 898–906. [Google Scholar] [CrossRef]
- Pirrello, C.; Zeilmaker, T.; Bianco, L.; Giacomelli, L.; Moser, C.; Vezzulli, S. Mining grapevine downy mildew susceptibility genes: A resource for genomics-based breeding and tailored gene editing. Biomolecules 2021, 11, 181. [Google Scholar] [CrossRef] [PubMed]
- Marcianò, D.; Ricciardi, V.; Marone Fassolo, E.; Passera, A.; Bianco, P.; Failla, O.; Casati, P.; Maddalena, G.; De Lorenzis, G.; Toffolatti, S. RNAi of a putative grapevine susceptibility gene as a possible downy mildew control strategy. Front. Plant Sci. 2021, 12, 667319. [Google Scholar] [CrossRef] [PubMed]
- Ricciardi, V.; Marcianò, D.; Sargolzaei, M.; Maddalena, G.; Maghradze, D.; Tirelli, A.; Casati, P.; Bianco, P.A.; Failla, O.; Fracassetti, D.; et al. From plant resistance response to the discovery of antimicrobial compounds: The role of volatile organic compounds (VOCs) in grapevine downy mildew infection. Plant Physiol. Biochem. 2021, 160, 294–305. [Google Scholar] [CrossRef]
- Ferrara, G.; Malerba, A.D.; Matarrese, A.M.S.; Mondelli, D.; Mazzeo, A. Nitrogen Distribution in Annual Growth of ‘Italia’ Table Grape Vines. Front. Plant Sci. 2018, 9, 1374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bavaresco, L.; Eibach, R. Investigations on the influence of N fertilizer on resistance to powdery mildew (Oidium tuckeri), downy mildew (Plasmopara viticola) and on phytoalexin synthesis in different grapevine varieties. Vitis 1987, 26, 192–200. [Google Scholar]
- Neumann, S.; Paveley, N.D.; Beed, F.D.; Sylvester-Bradley, R. Nitrogen per unit leaf area affects the upper asymptote of Puccinia striiformis f.sp. tritici epidemics in winter wheat. Plant Pathol. 2004, 53, 725–732. [Google Scholar] [CrossRef]
- Dietz, J.I.; Schierenbeck, M.; Simón, M.R. Impact of foliar diseases and its interaction with nitrogen fertilization and fungicides mixtures on green leaf area dynamics and yield in oat genotypes with different resistance. Crop Prot. 2019, 121, 80–88. [Google Scholar] [CrossRef]
- Luo, C.; Ma, L.; Zhu, J.; Guo, Z.; Dong, K.; Dong, Y. Effects of Nitrogen and Intercropping on the Occurrence of Wheat Powdery Mildew and Stripe Rust and the Relationship With Crop Yield. Front. Plant Sci. 2021, 12, 637393. [Google Scholar] [CrossRef]
- Judelson, H.S.; Ah-Fong, A.M.V. Exchanges at the Plant-Oomycete Interface That Influence Disease. Plant Physiol. 2019, 179, 1198–1211. [Google Scholar] [CrossRef] [Green Version]
- Duplessis, S.; Cuomo, C.A.; Lin, Y.C.; Aerts, A.; Tisserant, E.; Veneault-Fourrey, C.; Joly, D.L.; Hacquard, S.; Amselem, J.; Cantarel, B.L.; et al. Obligate biotrophy features unraveled by the genomic analysis of rust fungi. Proc. Natl. Acad. Sci. USA 2011, 108, 9166–9171. [Google Scholar] [CrossRef] [Green Version]
- Brilli, M.; Asquini, E.; Moser, M.; Bianchedi, P.L.; Perazzolli, M.; Si-Ammour, A. A multi-omics study of the grapevine-downy mildew (Plasmopara viticola) pathosystem unveils a complex protein coding-A nd noncoding-based arms race during infection. Sci. Rep. 2018, 8, 757. [Google Scholar] [CrossRef] [PubMed]
- Possamai, T.; Wiedemann-Merdinoglu, S. Phenotyping for QTL identification: A case study of resistance to Plasmopara viticola and Erysiphe necator in grapevine. Front. Plant Sci. 2022, 13, 930954. [Google Scholar] [CrossRef] [PubMed]
- Massi, F.; Marcianò, D.; Russo, G.; Stuknyté, M.; Arioli, S.; Mora, D.; Toffolatti, S.L. Evaluation of the characteristics and infectivity of the secondary inoculum produced by Plasmopara viticola on grapevine leaves by means of flow cytometry and cell sorting. Appl. Environ. Microbiol. 2022, 88, e01010-22. [Google Scholar] [CrossRef] [PubMed]
- Bove, F.; Rossi, V. Components of partial resistance to Plasmopara viticola enable complete phenotypic characterization of grapevine varieties. Sci. Rep. 2020, 10, 585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Delmotte, F.; Mestre, P.; Schneider, C.; Kassemeyer, H.H.; Kozma, P.; Richart-Cervera, S.; Rouxel, M.; Delière, L. Rapid and multiregional adaptation to host partial resistance in a plant pathogenic oomycete: Evidence from European populations of Plasmopara viticola, the causal agent of grapevine downy mildew. Infect. Genet. Evol. 2014, 27, 500–508. [Google Scholar] [CrossRef] [PubMed]
- Toffolatti, S.L.; Venturini, G.; Maffi, D.; Vercesi, A. Phenotypic and histochemical traits of the interaction between Plasmopara viticola and resistant or susceptible grapevine varieties. BMC Plant Biol. 2012, 12, 124. [Google Scholar] [CrossRef] [Green Version]
- Kennelly, M.M.; Gadoury, D.M.; Wilcox, W.F.; Magarey, P.A.; Seem, R.C. Primary infection, lesion productivity, and survival of sporangia in the grapevine downy mildew pathogen Plasmopara viticola. Phytopathology 2007, 97, 512–522. [Google Scholar] [CrossRef] [Green Version]
- Hernández, I.; Gutiérrez, S.; Ceballos, S.; Palacios, F.; Toffolatti, S.L.; Maddalena, G.; Diago, M.P.; Tardaguila, J. Assessment of downy mildew in grapevine using computer vision and fuzzy logic. Development and validation of a new method. OENO One 2022, 56, 41–53. [Google Scholar] [CrossRef]
- Tomasi, N.; Monte, R.; Varanini, Z.; Cesco, S.; Pinton, R. Induction of nitrate uptake in Sauvignon Blanc and Chardonnay grapevines depends on the scion and is affected by the rootstock. Aust. J. Grape Wine Res. 2015, 21, 331–338. [Google Scholar] [CrossRef]
- The, S.V.; Snyder, R.; Tegeder, M. Targeting Nitrogen Metabolism and Transport Processes to Improve Plant Nitrogen Use Efficiency. Front. Plant Sci. 2021, 11, 628366. [Google Scholar] [CrossRef]
- Lejay, L.; Gojon, A. Root Nitrate Uptake. In Membrane Transport in Plants; Elsevier: Amsterdam, The Netherlands, 2018; pp. 139–169. [Google Scholar]
- Dechorgnat, J.; Nguyen, C.T.; Armengaud, P.; Jossier, M.; Diatloff, E.; Filleur, S.; Daniel-Vedele, F. From the soil to the seeds: The long journey of nitrate in plants. J. Exp. Bot. 2011, 62, 1349–1359. [Google Scholar] [CrossRef]
- Okamoto, M.; Kumar, A.; Li, W.; Wang, Y.; Siddiqi, M.Y.; Crawford, N.M.; Glass, A.D.M. High-Affinity Nitrate Transport in Roots of Arabidopsis Depends on Expression of the NAR2-Like Gene AtNRT3.1. Plant Physiol. 2006, 140, 1036–1046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toffolatti, S.L.; De Lorenzis, G.; Costa, A.; Maddalena, G.; Passera, A.; Bonza, M.C.; Pindo, M.; Stefani, E.; Cestaro, A.; Casati, P.; et al. Unique resistance traits against downy mildew from the center of origin of grapevine (Vitis vinifera). Sci. Rep. 2018, 8, 12523. [Google Scholar] [CrossRef]
- Lea, P.J.; Blackwell, R.D.; Chen, F.-L.; Hecht, U. Enzymes of Ammonia Assimilation. In Enzymes of Primary Metabolism; Elsevier: Amsterdam, The Netherlands, 1990; pp. 257–276. [Google Scholar]
- Woodall, J.; Forde, B.G. Glutamine synthetase polypeptides in the roots of 55 legume species in relation to their climatic origin and the partitioning of nitrate assimilation. Plant Cell Environ. 1996, 19, 848–858. [Google Scholar] [CrossRef]
- Asselbergh, B.; Curvers, K.; França, S.C.; Audenaert, K.; Vuylsteke, M.; Van Breusegem, F.; Höfte, M. Resistance to Botrytis cinerea in sitiens, an Abscisic Acid-Deficient Tomato Mutant, Involves Timely Production of Hydrogen Peroxide and Cell Wall Modifications in the Epidermis. Plant Physiol. 2007, 144, 1863–1877. [Google Scholar] [CrossRef] [Green Version]
- Liu, G.; Ji, Y.; Bhuiyan, N.H.; Pilot, G.; Selvaraj, G.; Zou, J.; Wei, Y. Amino Acid Homeostasis Modulates Salicylic Acid–Associated Redox Status and Defense Responses in Arabidopsis. Plant Cell 2010, 22, 3845–3863. [Google Scholar] [CrossRef] [Green Version]
- Moison, M.; Marmagne, A.; Dinant, S.; Soulay, F.; Azzopardi, M.; Lothier, J.; Citerne, S.; Morin, H.; Legay, N.; Chardon, F.; et al. Three cytosolic glutamine synthetase isoforms localized in different-order veins act together for N remobilization and seed filling in Arabidopsis. J. Exp. Bot. 2018, 69, 4379–4393. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Park, J.; Lee, J.; Shin, D.; Marmagne, A.; Lim, P.O.; Masclaux-Daubresse, C.; An, G.; Nam, H.G. OsASN1 Overexpression in Rice Increases Grain Protein Content and Yield under Nitrogen-Limiting Conditions. Plant Cell Physiol. 2020, 61, 1309–1320. [Google Scholar] [CrossRef] [PubMed]
- Wong, H.-K.; Chan, H.-K.; Coruzzi, G.M.; Lam, H.-M. Correlation of ASN2 Gene Expression with Ammonium Metabolism in Arabidopsis. Plant Physiol. 2004, 134, 332–338. [Google Scholar] [CrossRef] [Green Version]
- Osuna, D.; Gálvez-Valdivieso, G.; Piedras, P.; Pineda, M.; Aguilar, M. Cloning, characterization and mRNA expression analysis of PVAS1, a type I asparagine synthetase gene from Phaseolus vulgaris. Planta 2001, 213, 402–410. [Google Scholar] [CrossRef]
- Antunes, F.; Aguilar, M.; Pineda, M.; Sodek, L. Nitrogen stress and the expression of asparagine synthetase in roots and nodules of soybean (Glycine max). Physiol. Plant 2008, 133, 736–743. [Google Scholar] [CrossRef] [PubMed]
- Seifi, H.S.; De Vleesschauwer, D.; Aziz, A.; Höfte, M. Modulating plant primary amino acid metabolism as a necrotrophic virulence strategy. Plant Signal. Behav. 2014, 9, e27995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hwang, I.S.; An, S.H.; Hwang, B.K. Pepper asparagine synthetase 1 (CaAS1) is required for plant nitrogen assimilation and defense responses to microbial pathogens. Plant J. 2011, 67, 749–762. [Google Scholar] [CrossRef] [PubMed]
- Camañes, G.; Pastor, V.; Cerezo, M.; García-Andrade, J.; Vicedo, B.; García-Agustín, P.; Flors, V. A deletion in NRT2.1 attenuates Pseudomonas syringae-induced hormonal perturbation, resulting in primed plant defenses. Plant Physiol. 2012, 158, 1054–1066. [Google Scholar] [CrossRef] [Green Version]
- Brancadoro, L.; Rabotti, G.; Scienza, A.; Zocchi, G. Mechanisms of Fe-efficiency in roots of Vitis spp. in response to iron deficiency stress. Plant Soil 1995, 171, 229–234. [Google Scholar] [CrossRef]
- Bianchi, D.; Brancadoro, L. Water use efficiency and nutritional status of a new grapevine rootstock selection. Horticulturae 2021, 7, 503. [Google Scholar] [CrossRef]
- Colombo, M.; Masiero, S.; Rosa, S.; Caporali, E.; Toffolatti, S.L.; Mizzotti, C.; Tadini, L.; Rossi, F.; Pellegrino, S.; Musetti, R.; et al. NoPv1: A synthetic antimicrobial peptide aptamer targeting the causal agents of grapevine downy mildew and potato late blight. Sci. Rep. 2020, 10, 17574. [Google Scholar] [CrossRef]
- Perreault, F.; Oukarroum, A.; Pirastru, L.; Sirois, L.; Gerson Matias, W.; Popovic, R. Evaluation of Copper Oxide Nanoparticles Toxicity Using Chlorophyll a Fluorescence Imaging in Lemna gibba. J. Bot. 2010, 2010, 763142. [Google Scholar] [CrossRef] [Green Version]
- Schreiber, U.; Quayle, P.; Schmidt, S.; Escher, B.I.; Mueller, J.F. Methodology and evaluation of a highly sensitive algae toxicity test based on multiwell chlorophyll fluorescence imaging. Biosens. Bioelectron. 2007, 22, 2554–2563. [Google Scholar] [CrossRef]
- Mattos, A.P.; Tolentino Júnior, J.B.; Itako, A.T. Determination of the severity of Septoria leaf spot in tomato by using digital images. Australas. Plant Pathol. 2020, 49, 329–356. [Google Scholar] [CrossRef]
- Bock, C.H.; Barbedo, J.G.A.; Del Ponte, E.M.; Bohnenkamp, D.; Mahlein, A.-K. From visual estimates to fully automated sensor-based measurements of plant disease severity: Status and challenges for improving accuracy. Phytopathol. Res. 2020, 2, 9. [Google Scholar] [CrossRef]
- Figueiredo, A.; Monteiro, F.; Sebastiana, M. First clues on a jasmonic acid role in grapevine resistance against the biotrophic fungus Plasmopara viticola. Eur. J. Plant Pathol. 2015, 142, 645–652. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- De Mendiburu, F.; Simon, R. Agricolae-Ten years of an open source statistical tool for experiments in breeding, agriculture and biology. PeerJ PrePrints 2015, 3, e1404v1. [Google Scholar] [CrossRef]
- Segarra, J.; Jeger, M.J.; Bosch, F. Van Den Epidemic Dynamics and Patterns of Plant Diseases. Phytopathology 2001, 91, 1001–1010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thom, H. A note on the gamma distribution. Mon. Weather Rev. 1958, 86, 117–122. [Google Scholar] [CrossRef]
- Van den Bosch, F.; Zadoks, J.; Metz, J. Focus Expansion in Plant Disease. II: Realistic Parameter-Sparse Models. Phytopathology 1988, 78, 59–64. [Google Scholar] [CrossRef]
- Hintze, J.L.; Nelson, R.D. Violin plots: A box plot-density trace synergism. Am. Stat. 1998, 52, 181–184. [Google Scholar] [CrossRef]
Ca(NO3)2 Concentration (mM) | t1 | t15 |
---|---|---|
0 | 0.68 ± 0.08 a | 0.30 ± 0.08 a |
0.05 | 0.71 ± 0.04 ab | 0.38 ± 0.07 b |
1 | 0.74 ± 0.02 cd | 0.37 ± 0.05 b |
2 | 0.75 ± 0.02 d | 0.38 ± 0.04 b |
5 | 0.73 ± 0.03 bc | 0.39 ± 0.05 b |
Ca(NO3)2 Concentration (mM) | SA (mm2) | S (Sporangia mm–2) | ||
---|---|---|---|---|
T1 | T2 | T3 | T3 | |
0 | 9.9 ± 6.37 cd | 5.01 ± 4.96 abc | 2.99 ± 5.14 a | 56.97 ± 54.02 a |
0.05 | 3.94 ± 3.35 ab | 8.84 ± 6.58 c | 6.6 ± 7.83 abc | 128.84 ± 121.99 ab |
1 | 7.59 ± 3.76 bc | 7.93 ± 6.08 bc | 9.64 ± 6.68 cd | 168.55 ± 160.54 bc |
2 | 9.00 ± 6.03 cd | 7.48 ± 5.3 bc | 15.37 ± 11.73 d | 244.04 ± 230.84 c |
5 | 8.12 ± 5.28 bc | 7.61 ± 5.71 bc | 8.42 ± 7.62 bcd | 103.58 ± 127.62 ab |
Gene | Gene ID | Protein Name | Primers (5′ → 3′) |
---|---|---|---|
VvNRT3.1 | XM_002279825.3 | high-affinity nitrate transporter 3.1 | F: TTCCAACAATTCCGTAGAGTGG R: AGTTACGGTTTCTCTAATCACC |
VvGS | XM_002274103.2 | glutamine synthetase leaf isozyme | F: GCTGATCTCCAGAACATCAACC R: CGGCAGTTGCGCTGGGCCAGTG |
VvAS1 | NM_001281237.1 | asparagine synthetase | F: GCAATGGATATTGACCCTGAGTG R: AAAAGCCCTCCTGAGAACCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marcianò, D.; Ricciardi, V.; Maddalena, G.; Massafra, A.; Marone Fassolo, E.; Masiero, S.; Bianco, P.A.; Failla, O.; De Lorenzis, G.; Toffolatti, S.L. Influence of Nitrogen on Grapevine Susceptibility to Downy Mildew. Plants 2023, 12, 263. https://doi.org/10.3390/plants12020263
Marcianò D, Ricciardi V, Maddalena G, Massafra A, Marone Fassolo E, Masiero S, Bianco PA, Failla O, De Lorenzis G, Toffolatti SL. Influence of Nitrogen on Grapevine Susceptibility to Downy Mildew. Plants. 2023; 12(2):263. https://doi.org/10.3390/plants12020263
Chicago/Turabian StyleMarcianò, Demetrio, Valentina Ricciardi, Giuliana Maddalena, Annamaria Massafra, Elena Marone Fassolo, Simona Masiero, Piero Attilio Bianco, Osvaldo Failla, Gabriella De Lorenzis, and Silvia Laura Toffolatti. 2023. "Influence of Nitrogen on Grapevine Susceptibility to Downy Mildew" Plants 12, no. 2: 263. https://doi.org/10.3390/plants12020263