The Overexpression of YALI0B07117g Results in Enhanced Erythritol Synthesis from Glycerol by the Yeast Yarrowia lipolytica
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Strains, Media and Culture Conditions
4.2. Cloning and Transformation Protocols
4.3. Gene Disruption
4.4. Construction of the Overexpression Vectors
4.5. Bioscreen C Analysis
4.6. Bioreactor Studies
4.7. Analytical Methods
4.8. Calculation of the Fermentation Parameters
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Martău, G.A.; Coman, V.; Vodnar, D.C. Recent advances in the biotechnological production of erythritol and mannitol. Crit. Rev. Biotechnol. 2020, 40, 608–622. [Google Scholar] [CrossRef] [PubMed]
- Hruby, A.; Manson, J.E.; Qi, L.; Malik, V.S.; Rimm, E.B.; Sun, Q.; Willett, W.C.; Hu, F.B. Determinants and Consequences of Obesity. Am. J. Public Health 2016, 106, 1656–1662. [Google Scholar] [CrossRef]
- Rzechonek, D.A.; Dobrowolski, A.; Rymowicz, W.; Mirończuk, A.M. Recent advances in biological production of erythritol. Crit. Rev. Biotechnol. 2018, 38, 620–633. [Google Scholar] [CrossRef]
- Rzechonek, D.A.; Szczepańczyk, M.; Wang, G.; Borodina, I.; Mirończuk, A.M. Hog-independent osmoprotection by erythritol in yeast yarrowia lipolytica. Genes 2020, 11, 1424. [Google Scholar] [CrossRef] [PubMed]
- Grembecka, M. Sugar alcohols—their role in the modern world of sweeteners: A review. Eur. Food Res. Technol. 2015, 241, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Mirończuk, A.M.; Biegalska, A.; Zugaj, K.; Rzechonek, D.A.; Dobrowolski, A. A Role of a Newly Identified Isomerase from Yarrowia lipolytica in Erythritol Catabolism. Front. Microbiol. 2018, 9, 1122. [Google Scholar] [CrossRef] [PubMed]
- Woelnerhanssen, B.K.; Cajacob, L.; Keller, N.; Doody, A.; Rehfeld, J.F.; Drewe, J.; Peterli, R.; Beglinger, C.; Meyer-Gerspach, A.C. Gut hormone secretion, gastric emptying, and glycemic responses to erythritol and xylitol in lean and obese subjects. Am. J. Physiol. Metab. 2016, 310, E1053–E1061. [Google Scholar] [CrossRef] [Green Version]
- Noda, K.; Nakayama, K.; Oku, T. Serum glucose and insulin levels and erythritol balance after oral administration of eryth-ritol in healthy subjects. Eur. J. Clin. Nutr. 1994, 48, 286–292. [Google Scholar] [PubMed]
- De Cock, P.; Mäkinen, K.; Honkala, E.; Saag, M.; Kennepohl, E.; Eapen, A. Erythritol Is More Effective Than Xylitol and Sorbitol in Managing Oral Health Endpoints. Int. J. Dent. 2016, 2016, 9868421. [Google Scholar] [CrossRef]
- Hootman, K.C.; Trezzi, J.-P.; Kraemer, L.; Burwell, L.; Dong, X.; Guertin, K.; Jaeger, C.; Stover, P.J.; Hiller, K.; Cassano, P.A. Erythritol is a pentose-phosphate pathway metabolite and associated with adiposity gain in young adults. Proc. Natl. Acad. Sci. USA 2017, 114, E4233–E4240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, S.-J.; Wen, C.-Y.; Wang, P.-M.; Huang, J.-C.; Wei, C.-L.; Chang, J.-W.; Chu, W.-S. High-level production of erythritol by mutants of osmophilic Moniliella sp. Process. Biochem. 2010, 45, 973–979. [Google Scholar] [CrossRef]
- Ryu, Y.W.; Park, C.Y.; Park, J.B.; Kim, S.Y.; Seo, J.H. Optimization of erythritol production by Candida magnoliae in fed-batch culture. J. Ind. Microbiol. Biotechnol. 2000, 25, 100–103. [Google Scholar] [CrossRef]
- Papanikolaou, S.; Aggelis, G. Modeling lipid accumulation and degradation in Yarrowia lipolytica cultivated on industrial fats. Curr. Microbiol. 2003, 46, 398–402. [Google Scholar] [CrossRef] [PubMed]
- Papanikolaou, S.; Aggelis, G. Lipid production by Yarrowia lipolytica growing on industrial glycerol in a single-stage continuous culture. Bioresour. Technol. 2002, 82, 43–49. [Google Scholar] [CrossRef]
- Lazar, Z.; Liu, N.; Stephanopoulos, G. Holistic approaches in lipid production by Yarrowia lipolytica. Trends Biotechnol. 2018, 36, 1157–1170. [Google Scholar] [CrossRef] [PubMed]
- Rakicka-Pustułka, M.; Biegalska, A.; Rymowicz, W.; Dobrowolski, A.; Mirończuk, A.M. Polyol production from waste materials by genetically modified Yarrowia lipolytica. Bioresour. Technol. 2017, 243, 393–399. [Google Scholar] [CrossRef] [PubMed]
- Mirończuk, A.M.; Kosiorowska, K.E.; Biegalska, A.; Rakicka-Pustułka, M.; Szczepańczyk, M.; Dobrowolski, A. Heterologous overexpression of bacterial hemoglobin VHb improves erythritol biosynthesis by yeast Yarrowia lipolytica. Microb. Cell Factories 2019, 18, 176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rymowicz, W.; Fatykhova, A.R.; Kamzolova, S.V.; Rywińska, A.; Morgunov, I.G. Citric acid production from glycerol-containing waste of biodiesel industry by Yarrowia lipolytica in batch, repeated batch, and cell recycle regimes. Appl. Microbiol. Biotechnol. 2010, 87, 971–979. [Google Scholar] [CrossRef]
- Rzechonek, D.A.; Dobrowolski, A.; Rymowicz, W.; Mirończuk, A.M. Aseptic production of citric and isocitric acid from crude glycerol by genetically modified Yarrowia lipolytica. Bioresour. Technol. 2019, 271, 340–344. [Google Scholar] [CrossRef]
- Papanikolaou, S.; Galiotou-panayotou, M.; Fakas, S. Citric acid production by Yarrowia lipolytica cultivated on olive-mill wastewater-based media. Bioresour. Technol. 2008, 99, 2419–2428. [Google Scholar] [CrossRef] [PubMed]
- Dobrowolski, A.; Mituła, P.; Rymowicz, W.; Mirończuk, A.M. Efficient conversion of crude glycerol from various industrial wastes into single cell oil by yeast Yarrowia lipolytica. Bioresour. Technol. 2016, 207, 237–243. [Google Scholar] [CrossRef]
- Janek, T.; Dobrowolski, A.; Biegalska, A.; Mirończuk, A.M. Characterization of erythrose reductase from Yarrowia lipolytica and its influence on erythritol synthesis. Microb. Cell Factories 2017, 16, 118. [Google Scholar] [CrossRef] [Green Version]
- Wang, N.; Chi, P.; Zou, Y.; Xu, Y.; Xu, S.; Bilal, M. Metabolic engineering of Yarrowia lipolytica for thermoresistance and enhanced erythritol productivity. Biotechnol. Biofuels 2020, 13, 176. [Google Scholar]
- Rymowicz, W.; Rywińska, A.; Marcinkiewicz, M. High-yield production of erythritol from raw glycerol in fed-batch cultures of Yarrowia lipolytica. Biotechnol. Lett. 2009, 31, 377–380. [Google Scholar] [CrossRef] [PubMed]
- Rzechonek, D.A.; Neuvéglise, C.; Devillers, H.; Rymowicz, W.; Mirończuk, A.M. EUF1-A newly identified gene involved in erythritol utilization in Yarrowia lipolytica. Sci. Rep. 2017, 7, 12507. [Google Scholar]
- Mirończuk, A.M.; Rzechonek, D.A.; Biegalska, A.; Rakicka, M. A novel strain of Yarrowia lipolytica as a platform for value-added product synthesis from glycerol. Biotechnol. Biofuels 2016, 9, 180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, H.; Wang, S.; Bilal, M.; Ge, X.; Zhang, C.; Fickers, P.; Cheng, H. Cheng et al. Identification, characterization of two NADPH-dependent erythrose reductases in the yeast Yarrowia lipolytica and improvement of erythritol productivity using metabolic engineering. Microb. Cell Factories 2018, 17, 133. [Google Scholar] [CrossRef] [PubMed]
- Mirończuk, A.M.; Biegalska, A.; Dobrowolski, A. Functional overexpression of genes involved in erythritol synthesis in the yeast Yarrowia lipolytica. Biotechnol. Biofuels 2017, 10, 77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blazeck, J.; Hill, A.; Jamoussi, M.; Pan, A.; Miller, J.; Alper, H.S. Metabolic engineering of Yarrowia lipolytica for itaconic acid production. Metab. Eng. 2015, 32, 66–73. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef]
- Fickers, P.; Le Dall, M.; Gaillardin, C.; Thonart, P.; Nicaud, J. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J. Microbiol. Methods 2003, 55, 727–737. [Google Scholar] [CrossRef] [PubMed]
- Wojtatowicz, M.; Rymowicz, W. Effect of inoculum on kinetics and yield of citric acids production on glucose by Yarrowia lipolytica A-101. Acta Aliment. Pol. 1991, 41, 137–143. [Google Scholar]
- Rakicka, M.; Biegalska, A.; Rymowicz, W.; Miron, A.M.; Dobrowolski, A. Bioresource Technology A two-stage fermen-tation process of erythritol production by yeast Y. lipolytica from molasses and glycerol. Bioresour. Technol. 2015, 198, 445–455. [Google Scholar]
Strain | Time (h) | Erythritol (g/L) | Mannitol (g/L) | Arabitol (g/L) | Citric Acid (g/L) | Glycerol (g/L) |
---|---|---|---|---|---|---|
A101 | 24 | 0.35 ± 0.09 | 0 | 0.01 ± 0.01 | 1.18 ± 0.34 | 87.74 ± 3.78 |
AJD ΔB07117 | 0.27 ± 0.15 | 0 | 0 | 0.10 ± 0.08 | 107.15 ± 3.2 | |
AJD pAD-B07117 | 0.35 ± 0.11 | 0 | 0 | 0 | 107.4 ± 1 | |
A101 | 48 | 16.54 ± 0.96 | 1.02 ± 0.16 | 1.61 ± 0.03 | 5.70 ± 0.59 | 38.16 ± 1.86 |
AJD ΔB07117 | 15.03 ± 1.92 | 4.61 ± 1.18 | 2.10 ± 0.46 | 12.04 ± 2.08 | 57.61 ± 7.17 | |
AJD pAD-B07117 | 11.0 ± 2.4 | 0.13 ± 0.11 | 0.15 ± 0.13 | 8.08 ± 1.20 | 65.1 ± 6.39 | |
A101 | 72 | 30.02 ± 1.39 | 2.43 ± 0.20 | 2.48 ± 0.44 | 5.85 ± 0.82 | 0.1 ± 0.18 |
AJD ΔB07117 | 28.22 ± 0.78 | 7.48 ± 1.49 | 5.07 ± 0.44 | 17.12 ± 3.83 | 12.5 ± 4.73 | |
AJD pAD-B07117 | 30.60 ± 3.14 | 1.07 ± 0.18 | 0.75 ± 0.17 | 9.79 ± 1.60 | 21.78 ± 6.23 | |
A101 | 96 | 15.16 ± 1.20 | 0.95 ± 0.03 | 1.30 ± 0.16 | 7.16 ± 0.67 | 0 |
AJD ΔB07117 | 29.52 ± 1.64 | 8.01 ± 1.10 | 6.10 ± 0.22 | 18.08 ± 2.87 | 0 | |
AJD pAD-B07117 | 39.79 ± 1.60 | 1.00 ± 0.07 | 1.71 ± 0.03 | 9.80 ± 1.32 | 0 |
Strain | Time (h) | Erythritol (g/L) | Mannitol (g/L) | Arabitol (g/L) | Citric Acid (g/L) | Glycerol (g/L) |
---|---|---|---|---|---|---|
A101 | 24 | 5.68 ± 0.84 | 0.20 ± 0.09 | 0.13 ± 0.05 | 0.84 ± 0.30 | 127.92 ± 7.26 |
AJD pAD-B07117 | 7.37 ± 1.62 | 0.05 ± 0.09 | 0.04 ± 0.06 | 0.55 ± 0.21 | 127.25 ± 3.46 | |
A101 | 48 | 23.50 ± 2.27 | 1.59 ± 0.12 | 0.64 ± 0.12 | 2.58 ± 0.01 | 77.49 ± 5.62 |
AJD pAD-B07117 | 33.99 ± 3.45 | 2.12 ± 0.48 | 0.70 ± 0.06 | 6.20 ± 2.75 | 59.05 ± 2.84 | |
A101 | 72 | 41.15 ± 4.97 | 3.74 ± 0.09 | 1.06 ± 0.11 | 4.57 ± 1.69 | 21.28 ± 3.05 |
AJD pAD-B07117 | 59.83 ± 4.86 | 4.72 ± 0.29 | 1.19 ± 0.13 | 12.97 ± 8.03 | 3.42 ± 0.18 | |
A101 | 96 | 37.57 ± 7.59 | 2.09 ± 0.74 | 0.63 ± 0.14 | 9.99 ± 3.69 | 0.20 ± 0.35 |
AJD pAD-B07117 | 45.78 ± 5.76 | 4.05 ± 0.21 | 1.04 ± 0.07 | 18.60 ± 7.29 | 0 |
Strain | Genotype or Plasmid | Source |
---|---|---|
E. coli | ||
DH5α | F− endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK-mK+), λ– | [30] |
DH5α | pUCURA | [31] |
DH5α | pUCURA-B07117g | This study |
DH5α | pMCSUAS1B16-TEF-lacZ | [29] |
DH5α | pAD-B07117g | This study |
Y. lipolytica | ||
A101 | Wild-type | [32] |
AJD | MATA, A101: ura3-302 | [33] |
AJD ΔB07117 | MATA, A101: ura3-302 ΔB07117 | This study |
AJD-c-B07117 | MATA, A101: ura3-302, ΔB07117 pAD-B07117 | This study |
AJD pAD-B07117 | MATA, A101: ura3-302, pAD-B07117 | This study |
Primer | Sequence (5′ -> 3′) | Aim |
---|---|---|
YALI0B07117_up_F_HindIII | CGTAAGCTTTACACTCCCGCACAAAC | Knock-out of the YALI0B07117g gene |
YALI0B07117_up_R_SalI | CGTGTCGACGGTCTTGCTCGGATTC | |
YALI0B07117_down_F_NotI | TCAGCGGCCGCAGCTTGGTGAACCATATTT | |
YALI0B07117_down_R_SacII | TATCCGCGGGCTCCAGACGAGTAAATC | |
Test-YALI0B07117_F | CCCGGTTTATTGACCTCCTTACAGC | Verification of the knock-out |
Test-YALI0B7117_R | CGGAACTTCTGTTTCTGCCATCTGAC | |
URA_col_F | GGTACTGGTGCTTGACAGTG | |
URA_col_R | CTCGAGCTAACGTCCACAAG | |
YALI0B07117_F_AscI | ATAGGCGCGCCATGTTCCGGTCAGTATATAAAC | Overexpression cassette |
YALI0B07117_R_NheI | GCAGCTAGCTTAGCAGAAGTCAAAGTCGGGGAAT | |
TEF_F | GTCAACTCACACCCGAAATC | Verification of overexpression cassette integration |
YALI0B07117_R_NheI | GCAGCTAGCTTAGCAGAAGTCAAAGTCGGGGAAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szczepańczyk, M.; Rzechonek, D.A.; Dobrowolski, A.; Mirończuk, A.M. The Overexpression of YALI0B07117g Results in Enhanced Erythritol Synthesis from Glycerol by the Yeast Yarrowia lipolytica. Molecules 2021, 26, 7549. https://doi.org/10.3390/molecules26247549
Szczepańczyk M, Rzechonek DA, Dobrowolski A, Mirończuk AM. The Overexpression of YALI0B07117g Results in Enhanced Erythritol Synthesis from Glycerol by the Yeast Yarrowia lipolytica. Molecules. 2021; 26(24):7549. https://doi.org/10.3390/molecules26247549
Chicago/Turabian StyleSzczepańczyk, Mateusz, Dorota A. Rzechonek, Adam Dobrowolski, and Aleksandra M. Mirończuk. 2021. "The Overexpression of YALI0B07117g Results in Enhanced Erythritol Synthesis from Glycerol by the Yeast Yarrowia lipolytica" Molecules 26, no. 24: 7549. https://doi.org/10.3390/molecules26247549