Only Low Effects of Water Filters on the Enteric Carriage of Gastrointestinal Pathogen DNA in Colombian Indigenous People
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Diagnostic Assessments
2.3. Statistical Assessments
2.4. Ethics
3. Results
3.1. Epidemiological Baseline Data from the Study Population
3.2. Diagnostic Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Target Pathogen | Target Gene | Forward Primer Sequence | Reverse Primer Sequence | Probe Sequence | Reference, Providing More Details |
---|---|---|---|---|---|
Ancylostoma spp. | ITS2 | GAATGACAGCAAACTCGTTGTTG | ATACTAGCCACTGCCGAAACGT | ATCGTTTACCGACTTTAG | [42] |
Ascaris lumbricoides | ITS1 | GTAATAGCAGTCGGCGGTTTCTT | GCCCAACATGCCACCTATTC | TTGGCGGACAATTGCATGCGAT | [42] |
Campylobacter jejuni | gyrA | CTATAACAACTGCACCTACTAAT | AAGTGTAAGCACACAAGGTA | CTTAATAGCCGTCACCCCAC | [44] |
Cryptosporidium parvum | 138-bp fragment inside the C. parvum-specific 452-bp fragment | CGCTTCTCTAGCCTTTCATGA | CTTCACGTGTGTTTGCCAAT | CCAATCACAGAATCATCAGAATCGACTGGTATC | [42] |
Entamoeba histolytica | SSU rRNA gene | ATTGTCGTGGCATCCTAACTCA | GCGGACGGCTCATTATAACA | TCATTGAATGAATTGGCCATTT | [42] |
Enterobius vermicularis | ITS1 | CGGTGTAATTTTGTTGGTGTCTATG | TGGCAGCATTGCAAACTAATG | TGTGCCAGTCAACGCCTAAACCGTC | [42] |
Giardia intestinalis | SSU rRNA gene | GACGGCTCAGGACAACGGTT | TTGCCAGCGGTGTCCG | CCCGCGGCGGTCCCTGCTAG | [42] |
Hymenolepis nana | ITS1 | CATTGTGTACCAAATTGATGATGAGTA | CAACTGACAGCATGTTTCGATATG | CGTGTGCGCCTCTGGCTTACCG | [42] |
Necator americanus | ITS2 | CTGTTTGTCGAACGGTACTTGC | ATAACAGCGTGCACATGTTGC | CTGTACTACGCATTGTATAC | [42] |
Salmonella spp. | ttrC | ATTGTTGATTCAGGTACAAAC | AATTAGCCATGTTGTAATCTC | CAAGTTCAACGCGCAATTTA | [44] |
Schistosoma spp. | ITS2 | GGTCTAGATGACTTGATYGAGATGCT | TCCCGAGCGYGTATAATGTCATTA | TGGGTTGTGCTCGAGTCGTGGC | [42] |
Shigella spp./Escherichia coli, enteroinvasive (EIEC) | ipaH | CAGAAGAGCAGAAGTATGAG | CAGTACCTCGTCAGTCAG | ACAGGTGATGCGTGAGACTG | [44] |
Strongyloides stercoralis | 18S rRNA gene | GAATTCCAAGTAAACGTAAGTCATTAGC | TGCCTCTGGATATTGCTCAGTTC | ACACACCGGCCGTCGCTGC | [42] |
Taenia saginata | ITS1 | GCGTCGTCTTTGCGTTACAC | TGACACAACCGCGCTCTG | CCACAGCACCAGCGACAGCAGCAA | [42] |
Taenia solium | ITS1 | ATGGATCAATCTGGGTGGAGTT | ATCGCAGGGTAAGAAAAGAAGGT | TGGTACTGCTGTGGCGGCGG | [42] |
Trichuris trichiura | 18S rRNA gene | TTGAAACGACTTGCTCATCAACTT | CTGATTCTCCGTTAACCGTTGTC | CGATGGTACGCTACGTGCTTACCATGG | [42] |
Yersinia spp. | ail | GCATTAACGAATATGTTAGC | ATCGAGTTTGGAGTATTCAT | CCGCTTCCAAATTTTGTCAT | [44] |
References
- Wolf, J.; Hunter, P.R.; Freeman, M.C.; Cumming, O.; Clasen, T.; Bartram, J.; Higgins, J.P.T.; Johnston, R.; Medlicott, K.; Boisson, S.; et al. Impact of drinking water, sanitation and handwashing with soap on childhood diarrhoeal disease: Updated meta-analysis and meta-regression. Trop. Med. Int. Health 2018, 23, 508–525. [Google Scholar] [CrossRef] [PubMed]
- Kirby, M.A.; Nagel, C.L.; Rosa, G.; Zambrano, L.D.; Musafiri, S.; Ngirabega, J.D.; Thomas, E.A.; Clasen, T. Effects of a large-scale distribution of water filters and natural draft rocket-style cookstoves on diarrhea and acute respiratory infection: A cluster-randomized controlled trial in Western Province, Rwanda. PLoS Med. 2019, 16, e1002812. [Google Scholar] [CrossRef] [Green Version]
- Kirby, M.A.; Nagel, C.L.; Rosa, G.; Umupfasoni, M.M.; Iyakaremye, L.; Thomas, E.A.; Clasen, T.F. Use, microbiological effectiveness and health impact of a household water filter intervention in rural Rwanda-A matched cohort study. Int. J. Hyg. Environ. Health 2017, 220, 1020–1029. [Google Scholar] [CrossRef]
- Tiwari, S.S.; Schmidt, W.P.; Darby, J.; Kariuki, Z.G.; Jenkins, M.W. Intermittent slow sand filtration for preventing diarrhoea among children in Kenyan households using unimproved water sources: Randomized controlled trial. Trop. Med. Int. Health 2009, 14, 1374–1382. [Google Scholar] [CrossRef] [Green Version]
- Pavlinac, P.B.; Naulikha, J.M.; Chaba, L.; Kimani, N.; Sangaré, L.R.; Yuhas, K.; Singa, B.O.; John-Stewart, G.; Walson, J.L. Water filter provision and home-based filter reinforcement reduce diarrhea in Kenyan HIV-infected adults and their household members. Am. J. Trop. Med. Hyg. 2014, 91, 273–280. [Google Scholar] [CrossRef] [Green Version]
- Lindquist, E.D.; George, C.M.; Perin, J.; Neiswender de Calani, K.J.; Norman, W.R.; Davis, T.P.; Perry, H. A cluster randomized controlled trial to reduce childhood diarrhea using hollow fiber water filter and/or hygiene-sanitation educational interventions. Am. J. Trop. Med. Hyg. 2014, 91, 190–197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larson, K.L.; Hansen, C.; Ritz, M.; Carreño, D. Acceptance and Impact of Point-of-Use Water Filtration Systems in Rural Guatemala. J. Nurs. Scholarsh. 2017, 49, 96–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tintle, N.; Heynen, A.; Van De Griend, K.; Ulrich, R.; Ojo, M.; Boven, E.; Brokus, S.; Wade, R.; Best, A.A. Evaluating the efficacy of point-of-use water filtration units in Fiji. Trop. Med. Health 2019, 47, 48. [Google Scholar] [CrossRef] [PubMed]
- Stauber, C.E.; Kominek, B.; Liang, K.R.; Osman, M.K.; Sobsey, M.D. Evaluation of the impact of the plastic BioSand filter on health and drinking water quality in rural Tamale, Ghana. Int. J. Environ. Res. Public. Health 2012, 9, 3806–3823. [Google Scholar] [CrossRef]
- Clasen, T.F.; Brown, J.; Collin, S.; Suntura, O.; Cairncross, S. Reducing diarrhea through the use of household-based ceramic water filters: A randomized, controlled trial in rural Bolivia. Am. J. Trop. Med. Hyg. 2004, 70, 651–657. [Google Scholar] [CrossRef] [Green Version]
- Stauber, C.E.; Printy, E.R.; McCarty, F.A.; Liang, K.R.; Sobsey, M.D. Cluster randomized controlled trial of the plastic BioSand Water filter in Cambodia. Environ. Sci. Technol. 2012, 46, 722–728. [Google Scholar] [CrossRef]
- Abebe, L.S.; Smith, J.A.; Narkiewicz, S.; Oyanedel-Craver, V.; Conaway, M.; Singo, A.; Amidou, S.; Mojapelo, P.; Brant, J.; Dillingham, R. Ceramic water filters impregnated with silver nanoparticles as a point-of-use water-treatment intervention for HIV-positive individuals in Limpopo Province, South Africa: A pilot study of technological performance and human health benefits. J. Water Health 2014, 12, 288–300. [Google Scholar] [CrossRef] [Green Version]
- Francis, M.R.; Sarkar, R.; Roy, S.; Jaffar, S.; Mohan, V.R.; Kang, G.; Balraj, V. Effectiveness of Membrane Filtration to Improve Drinking Water: A Quasi-Experimental Study from Rural Southern India. Am. J. Trop. Med. Hyg. 2016, 95, 1192–1200. [Google Scholar] [CrossRef] [Green Version]
- Du Preez, M.; Conroy, R.M.; Wright, J.A.; Moyo, S.; Potgieter, N.; Gundry, S.W. Use of ceramic water filtration in the prevention of diarrheal disease: A randomized controlled trial in rural South Africa and zimbabwe. Am. J. Trop. Med. Hyg. 2008, 79, 696–701. [Google Scholar] [CrossRef] [PubMed]
- Stauber, C.E.; Ortiz, G.M.; Loomis, D.P.; Sobsey, M.D. A randomized controlled trial of the concrete biosand filter and its impact on diarrheal disease in Bonao, Dominican Republic. Am. J. Trop. Med. Hyg. 2009, 80, 286–293. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.; Sobsey, M.D.; Loomis, D. Local drinking water filters reduce diarrheal disease in Cambodia: A randomized, controlled trial of the ceramic water purifier. Am. J. Trop. Med. Hyg. 2008, 79, 394–400. [Google Scholar] [CrossRef] [PubMed]
- Aiken, B.A.; Stauber, C.E.; Ortiz, G.M.; Sobsey, M.D. An assessment of continued use and health impact of the concrete biosand filter in Bonao, Dominican Republic. Am. J. Trop. Med. Hyg. 2011, 85, 309–317. [Google Scholar] [CrossRef]
- Kern, E.; Verguet, S.; Yuhas, K.; Odhiambo, F.H.; Kahn, J.G.; Walson, J. Provision of bednets and water filters to delay HIV-1 progression: Cost-effectiveness analysis of a Kenyan multisite study. Trop. Med. Int. Health 2013, 18, 916–924. [Google Scholar] [CrossRef] [PubMed]
- Walson, J.L.; Sangaré, L.R.; Singa, B.O.; Naulikha, J.M.; Piper, B.K.; Yuhas, K.; Onchiri, F.M.; Otieno, P.A.; Mermin, J.; Zeh, C.; et al. Evaluation of impact of long-lasting insecticide-treated bed nets and point-of-use water filters on HIV-1 disease progression in Kenya. Aids 2013, 27, 1493–1501. [Google Scholar] [CrossRef]
- Verguet, S.; Kahn, J.G.; Marseille, E.; Jiwani, A.; Kern, E.; Walson, J.L. Are long-lasting insecticide-treated bednets and water filters cost-effective tools for delaying HIV disease progression in Kenya? Glob. Health Action 2015, 8, 27695. [Google Scholar] [CrossRef] [Green Version]
- CDC Provides Guidelines on Suspect Water Supplies. Centers for Disease Control and Prevention. AIDS Alert 1995, 10, 101–103. Available online: https://pubmed.ncbi.nlm.nih.gov/11362676/ (accessed on 26 January 2022).
- Fagerli, K.; Gieraltowski, L.; Nygren, B.; Foote, E.; Gaines, J.; Oremo, J.; Odhiambo, A.; Kim, S.; Quick, R. Use, Acceptability, Performance, and Health Impact of Hollow Fiber Ultrafilters for Water Treatment in Rural Kenyan Households, 2009–2011. Am. J. Trop. Med. Hyg. 2020, 103, 465–471. [Google Scholar] [CrossRef] [PubMed]
- Boisson, S.; Kiyombo, M.; Sthreshley, L.; Tumba, S.; Makambo, J.; Clasen, T. Field assessment of a novel household-based water filtration device: A randomised, placebo-controlled trial in the Democratic Republic of Congo. PLoS ONE 2010, 5, e12613. [Google Scholar] [CrossRef] [PubMed]
- Fabiszewski de Aceituno, A.M.; Stauber, C.E.; Walters, A.R.; Meza Sanchez, R.E.; Sobsey, M.D. A randomized controlled trial of the plastic-housing BioSand filter and its impact on diarrheal disease in Copan, Honduras. Am. J. Trop. Med. Hyg. 2012, 86, 913–921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chard, A.N.; Garn, J.V.; Chang, H.H.; Clasen, T.; Freeman, M.C. Impact of a school-based water, sanitation, and hygiene intervention on school absence, diarrhea, respiratory infection, and soil-transmitted helminths: Results from the WASH HELPS cluster-randomized trial. J. Glob. Health 2019, 9, 020402. [Google Scholar] [CrossRef]
- Tintle, N.; Van De Griend, K.; Ulrich, R.; Wade, R.D.; Baar, T.M.; Boven, E.; Cooper, C.E.A.; Couch, O.; Eekhoff, L.; Fry, B.; et al. Diarrhea prevalence in a randomized, controlled prospective trial of point-of-use water filters in homes and schools in the Dominican Republic. Trop. Med. Health 2021, 49, 1. [Google Scholar] [CrossRef] [PubMed]
- Morris, J.F.; Murphy, J.; Fagerli, K.; Schneeberger, C.; Jaron, P.; Moke, F.; Juma, J.; Ochieng, J.B.; Omore, R.; Roellig, D.; et al. A Randomized Controlled Trial to Assess the Impact of Ceramic Water Filters on Prevention of Diarrhea and Cryptosporidiosis in Infants and Young Children-Western Kenya, 2013. Am. J. Trop. Med. Hyg. 2018, 98, 1260–1268. [Google Scholar] [CrossRef] [Green Version]
- Mellor, J.; Abebe, L.; Ehdaie, B.; Dillingham, R.; Smith, J. Modeling the sustainability of a ceramic water filter intervention. Water Res. 2014, 49, 286–299. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Wang, Q.; Lou, W.; Wang, Y.; Zhu, X. Microbiological safety of household membrane water filter. J. Environ. Biol. 2013, 34, 481–487. [Google Scholar] [PubMed]
- Hill, C.L.; McCain, K.; Nyathi, M.E.; Edokpayi, J.N.; Kahler, D.M.; Operario, D.J.; Taylor, D.D.J.; Wright, N.C.; Smith, J.A.; Guerrant, R.L.; et al. Impact of Low-Cost Point-of-Use Water Treatment Technologies on Enteric Infections and Growth among Children in Limpopo, South Africa. Am. J. Trop. Med. Hyg. 2020, 103, 1405–1415. [Google Scholar] [CrossRef] [PubMed]
- Bradley, I.; Straub, A.; Maraccini, P.; Markazi, S.; Nguyen, T.H. Iron oxide amended biosand filters for virus removal. Water Res. 2011, 45, 4501–4510. [Google Scholar] [CrossRef] [Green Version]
- Addiss, D.G.; Pond, R.S.; Remshak, M.; Juranek, D.D.; Stokes, S.; Davis, J.P. Reduction of risk of watery diarrhea with point-of-use water filters during a massive outbreak of waterborne Cryptosporidium infection in Milwaukee, Wisconsin, 1993. Am. J. Trop. Med. Hyg. 1996, 54, 549–553. [Google Scholar] [CrossRef] [PubMed]
- Zambrano, L.D.; Priest, J.W.; Ivan, E.; Rusine, J.; Nagel, C.; Kirby, M.; Rosa, G.; Clasen, T.F. Use of Serologic Responses against Enteropathogens to Assess the Impact of a Point-of-Use Water Filter: A Randomized Controlled Trial in Western Province, Rwanda. Am. J. Trop. Med. Hyg. 2017, 97, 876–887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Divelbiss, D.W.; Boccelli, D.L.; Succop, P.A.; Oerther, D.B. Environmental health and household demographics impacting biosand filter maintenance and diarrhea in Guatemala: An application of structural equation modeling. Environ. Sci. Technol. 2013, 47, 1638–1645. [Google Scholar] [CrossRef]
- De Ver Dye, T.; Apondi, R.; Lugada, E.; Kahn, J.G.; Sandiford-Day, M.A.; Dasbanerjee, T. A qualitative assessment of beliefs, attitudes, and behaviors related to diarrhea and water filtration in rural Kenya. Am. J. Public Health 2011, 101, 1515–1520. [Google Scholar] [CrossRef] [PubMed]
- Clasen, T.F.; Alexander, K.T.; Sinclair, D.; Boisson, S.; Peletz, R.; Chang, H.H.; Majorin, F.; Cairncross, S. Interventions to improve water quality for preventing diarrhoea. Cochrane Database Syst. Rev. 2015, 2015, CD004794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clasen, T.F.; Brown, J.; Collin, S.M. Preventing diarrhoea with household ceramic water filters: Assessment of a pilot project in Bolivia. Int. J. Environ. Health. Res. 2006, 16, 231–239. [Google Scholar] [CrossRef] [PubMed]
- Rosa, G.; Majorin, F.; Boisson, S.; Barstow, C.; Johnson, M.; Kirby, M.; Ngabo, F.; Thomas, E.; Clasen, T. Assessing the impact of water filters and improved cook stoves on drinking water quality and household air pollution: A randomised controlled trial in Rwanda. PLoS ONE 2014, 9, e91011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolf, J.; Prüss-Ustün, A.; Cumming, O.; Bartram, J.; Bonjour, S.; Cairncross, S.; Clasen, T.; Colford, J.M., Jr.; Curtis, V.; De France, J.; et al. Assessing the impact of drinking water and sanitation on diarrhoeal disease in low- and middle-income settings: Systematic review and meta-regression. Trop. Med. Int. Health 2014, 19, 928–942. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.; Colosi, L.M.; Smith, J.A. Evaluating the sustainability of ceramic filters for point-of-use drinking water treatment. Environ. Sci. Technol. 2013, 47, 11206–11213. [Google Scholar] [CrossRef]
- Clasen, T.; Garcia Parra, G.; Boisson, S.; Collin, S. Household-based ceramic water filters for the prevention of diarrhea: A randomized, controlled trial of a pilot program in Colombia. Am. J. Trop. Med. Hyg. 2005, 73, 790–795. [Google Scholar] [CrossRef] [PubMed]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in human stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Hoffmann, T.; Köller, T.; Hahn, A.; Podbielski, A.; Landt, O.; Loderstädt, U.; Tannich, E. Comparison of five commercial real-time PCRs for in-vitro diagnosis of Entamoeba histolytica, Giardia duodenalis, Cryptosporidium spp., Cyclospora cayetanensis, and Dientamoeba fragilis in human stool samples. Travel Med. Infect. Dis. 2021, 41, 102042. [Google Scholar] [CrossRef]
- Wiemer, D.; Loderstaedt, U.; von Wulffen, H.; Priesnitz, S.; Fischer, M.; Tannich, E.; Hagen, R.M. Real-time multiplex PCR for simultaneous detection of Campylobacter jejuni, Salmonella, Shigella and Yersinia species in fecal samples. Int. J. Med. Microbiol. 2011, 301, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Tanida, K.; Hahn, A.; Frickmann, H. Comparison of two commercial and one in-house real-time PCR assays for the diagnosis of bacterial gastroenteritis. Eur. J. Microbiol. Immunol. 2020, 10, 210–216. [Google Scholar] [CrossRef]
- Loderstädt, U.; Hagen, R.M.; Hahn, A.; Frickmann, H. New Developments in PCR-Based Diagnostics for Bacterial Pathogens Causing Gastrointestinal Infections-A Narrative Mini-Review on Challenges in the Tropics. Trop. Med. Infect. Dis. 2021, 6, 96. [Google Scholar] [CrossRef]
- Zautner, A.E.; Groß, U.; Emele, M.F.; Hagen, R.M.; Frickmann, H. More Pathogenicity or Just More Pathogens?—On the Interpretation Problem of Multiple Pathogen Detections with Diagnostic Multiplex Assays. Front. Microbiol. 2017, 8, 1210. [Google Scholar] [CrossRef]
- Kann, S.; Bruennert, D.; Hansen, J.; Mendoza, G.A.C.; Gonzalez, J.J.C.; Quintero, C.L.A.; Hanke, M.; Hagen, R.M.; Backhaus, J.; Frickmann, H. High Prevalence of Intestinal Pathogens in Indigenous in Colombia. J. Clin. Med. 2020, 9, 2786. [Google Scholar] [CrossRef]
- Frickmann, H.; Warnke, P.; Frey, C.; Schmidt, S.; Janke, C.; Erkens, K.; Schotte, U.; Köller, T.; Maaßen, W.; Podbielski, A.; et al. Surveillance of Food- and Smear-Transmitted Pathogens in European Soldiers with Diarrhea on Deployment in the Tropics: Experience from the European Union Training Mission (EUTM) Mali. Biomed. Res. Int. 2015, 2015, 573904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kann, S.; Hartmann, M.; Alker, J.; Hansen, J.; Dib, J.C.; Aristizabal, A.; Concha, G.; Schotte, U.; Kreienbrock, L.; Frickmann, H. Seasonal pattern of enteric pathogens in Colombian Indigenous people—A more pronounced effect on bacteria than on parasites. Pathogens 2022, 11, 214. [Google Scholar] [CrossRef] [PubMed]
Real-Time PCR Parameter (Included Sample Count) | 2018 and 2020 Concordantly Negatives | 2018 and 2020 Concordantly Positives | 2020 Newly Negatives (Which Were Still Positive in 2018) | 2020 Newly Positives | Difference of Newly Negatives Minus Newly-Positives | Significance Level as Indicated by McNemar’s Test | Simple Kappa Coefficient (95% Confidence Interval) |
---|---|---|---|---|---|---|---|
| |||||||
Campylobacter spp. (n = 89) | 44 | 14 | 16 | 15 | 1 | p = 0858 | 0.214 (0.003, 0.425) |
Shigella spp./EIEC (n = 89) | 79 | 0 | 3 | 7 | −4 | p = 0.206 | −0.050 (−0.091, −0.008) |
| |||||||
Entamoeba histolytica (n = 89) | 86 | 1 | 2 | 0 | 2 | p = 0.157 | 0.491 (−0.109, 1.000) |
Giardia duodenalis (n = 89) | 15 | 41 | 19 | 14 | 5 | p = 0.384 | 0.192 (−0.016, 0.400) |
Cryptosporidium spp. (n = 89) | 87 | 0 | 1 | 1 | 0 | p = 1.000 | −0.011 (−0.227, 0.004) |
| |||||||
Ascaris spp. (n = 89) | 78 | 0 | 9 | 2 | 7 | p = 0.035 | −0.038 (−0.083, 0.006) |
Hymenolepis nana (n = 78) | 59 | 1 | 13 | 5 | 8 | p = 0.059 | −0.009 (−0.202, 0.185) |
Necator americanus (n = 89) | 80 | 1 | 6 | 2 | 4 | p = 0.157 | 0.160 (−0.176, 0.497) |
Strongyloides stercoralis (n = 89) | 85 | 3 | 1 | 0 | 2 | p = 0.317 | −0.017 (−0.043, 0.009) |
Taenia spp. (n = 78) | 74 | 0 | 1 | 3 | −2 | p = 0.317 | −0.020 (−0.049, 0.010) |
Trichuris trichiura (n = 78) | 73 | 0 | 4 | 1 | 3 | p = 0.180 | −0.021 (−0.054, 0.013) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kann, S.; Concha, G.; Hartmann, M.; Köller, T.; Alker, J.; Schotte, U.; Kreienbrock, L.; Frickmann, H.; Warnke, P. Only Low Effects of Water Filters on the Enteric Carriage of Gastrointestinal Pathogen DNA in Colombian Indigenous People. Microorganisms 2022, 10, 658. https://doi.org/10.3390/microorganisms10030658
Kann S, Concha G, Hartmann M, Köller T, Alker J, Schotte U, Kreienbrock L, Frickmann H, Warnke P. Only Low Effects of Water Filters on the Enteric Carriage of Gastrointestinal Pathogen DNA in Colombian Indigenous People. Microorganisms. 2022; 10(3):658. https://doi.org/10.3390/microorganisms10030658
Chicago/Turabian StyleKann, Simone, Gustavo Concha, Maria Hartmann, Thomas Köller, Juliane Alker, Ulrich Schotte, Lothar Kreienbrock, Hagen Frickmann, and Philipp Warnke. 2022. "Only Low Effects of Water Filters on the Enteric Carriage of Gastrointestinal Pathogen DNA in Colombian Indigenous People" Microorganisms 10, no. 3: 658. https://doi.org/10.3390/microorganisms10030658