Characterization of Tetracalcium Phosphate/Monetite Biocement Modified by Magnesium Pyrophosphate
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Cement Mixture and Samples for Evaluation
2.2. Characterization Methods
2.3. Preparation of Mg Cement Extracts and In Vitro Cytotoxicity Testing of Extracts
2.4. Gene Expression and SDS PAGE Analysis of Specific Markers in Differentiated Rat MSCs in Long-Term Culture
Genes | Primers (5′–3′) | References |
---|---|---|
B-actin rat | F: GTAGCCATCCAGGCTGTGTT R: CCCTCATAGATGGGCAGAGT | [34] |
Osteocalcin rat | F: CCAGCTGACCTTCCTGCGCC R: CGGTGTGACTCGTGCAGCCA | [35] |
Osteonectin rat | F: ACAGACAAGTCCCACACAGCAACT R: CCTGCTTGGACATGAAGGCTTTGT | [36] |
Osteopontin rat | F: CCGATGAATCTGATGAGTCCTT R: TCCAGCTGACTTGACTCATGG | [37] |
Alkaline phosphatase rat | F: GGAAGCTGCAGAAGAGATGG R: TGCACACCTTTTCAAACTCG | [37] |
Osteonectin rat | F: AACCTGACTGACCCTTCCCTCT R: TCAATCCTGCCTCCTTCCACTA | [38] |
3. Results
3.1. Compressive Strength and Setting Time of Cements
3.2. Release of Ca2+, Mg2+, and Phosphate Ions from Cements to SBF and pH Measurement
3.3. XRD and FTIR Analyses of Powder Mixtures and Cements
3.4. SEM and TEM Analyses
3.5. In Vitro Testing of Cement Extracts, Live/Dead Staining of Cells, Gene Expression and Western Blotting
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Carey, L.E.; Xu, H.H.; Simon, C.G.; Takagi, S.; Chow, L.C.; Simonjr, C. Premixed rapid-setting calcium phosphate composites for bone repair. Biomaterials 2005, 26, 5002–5014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sheikh, Z.; Zhang, Y.L.; Grover, L.; Merle, G.E.; Tamimi, F.; Barralet, J. In vitro degradation and in vivo resorption of dicalcium phosphate cement based grafts. Acta Biomater. 2015, 26, 338–346. [Google Scholar] [CrossRef] [PubMed]
- Bigi, A.; Foresti, E.; Gregorini, R.; Ripamonti, A.; Roveri, N.; Shah, J.S. The role of magnesium on the structure of biological apatites. Calcif. Tissue Res. 1992, 50, 439–444. [Google Scholar] [CrossRef]
- Percival, M. Bone health & osteoporosis. Appl. Nutr. Sci. Rep. 1999, 5, 1–6. [Google Scholar]
- Castiglioni, S.; Cazzaniga, A.; Albisetti, W.; Maier, J.A.M. Magnesium and Osteoporosis: Current State of Knowledge and Future Research Directions. Nutrients 2013, 5, 3022–3033. [Google Scholar] [CrossRef] [Green Version]
- Li, R.W.; Kirkland, N.T.; Truong, J.; Wang, J.; Smith, P.N.; Birbilis, N.; Nisbet, D.R. The influence of biodegradable magnesium alloys on the osteogenic differentiation of human mesenchymal stem cells. J. Biomed. Mater. Res. Part A 2014, 102, 4346–4357. [Google Scholar] [CrossRef]
- Istrate, B.; Rau, J.V.; Munteanu, C.; Antoniac, I.V.; Saceleanu, V. Properties and in vitro assessment of ZrO2-based coatings obtained by atmospheric plasma jet spraying on biodegradable Mg-Ca and Mg-Ca-Zr alloys. Ceram. Int. 2020, 46, 15897–15906. [Google Scholar] [CrossRef]
- Klammert, U.; Reuther, T.; Blank, M.; Reske, I.; Barralet, J.E.; Grover, L.M.; Kübler, A.C.; Gbureck, U. Phase composition, me-chanical performance and in vitro biocompatibility of hydraulic setting calcium magnesium phosphate cement. Acta Biomater. 2010, 6, 1529–1535. [Google Scholar] [CrossRef]
- Eidelman, N.; Brown, W.E. Effect of pyrophosphate concentration on calcium phosphate growth on well-crystallized octacalci-um phosphate and hydroxyapatite seed crystals. J. Cryst. Growth 1991, 108, 385–393. [Google Scholar] [CrossRef]
- Martin, R.I.; Brown, P.W. The Effects of Magnesium on Hydroxyapatite Formation In Vitro from CaHPO4 and Ca4(PO4)2O at 37.4 °C. Calcif. Tissue Res. 1997, 60, 538–546. [Google Scholar] [CrossRef] [PubMed]
- Mestres, G.; Ginebra, M.-P. Novel magnesium phosphate cements with high early strength and antibacterial properties. Acta Biomater. 2011, 7, 1853–1861. [Google Scholar] [CrossRef] [PubMed]
- Mestres, G.; Abdolhosseini, M.; Bowles, W.; Huang, S.-H.; Aparicio, C.; Gorr, S.-U.; Ginebra, M.-P. Antimicrobial properties and dentin bonding strength of magnesium phosphate cements. Acta Biomater. 2013, 9, 8384–8393. [Google Scholar] [CrossRef] [PubMed]
- Christel, T.; Christ, S.; Barralet, J.E.; Groll, J.; Gbureck, U. Chelate Bonding Mechanism in a Novel Magnesium Phosphate Bone Cement. J. Am. Ceram. Soc. 2015, 98, 694–697. [Google Scholar] [CrossRef]
- Grobardt, C.; Ewald, A.; Grover, L.M.; Barralet, J.E.; Gbureck, U. Passive and active in vitro resorption of calcium and magnesium phosphate cements by osteoclastic cells. Tissue Eng. 2010, 16, 3687–3695. [Google Scholar] [CrossRef]
- Ewald, A.; Kreczy, D.; Brückner, T.; Gbureck, U.; Bengel, M.; Hoess, A.; Fuchs, A. Development and bone regeneration capacity of premixed magnesium phosphate cement pastes. Materials 2019, 12, 2119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klammert, U.; Ignatius, A.; Wolfram, U.; Reuther, T.; Gbureck, U. In vivo degradation of low temperature calcium and magnesium phosphate ceramics in a heterotopic model. Acta Biomater. 2011, 7, 3469–3475. [Google Scholar] [CrossRef]
- Liu, W.; Zhai, D.; Huan, Z.; Wu, C.; Chang, J. Novel tricalcium silicate/magnesium phosphate composite bone cement having high compressive strength, in vitro bioactivity and cytocompatibility. Acta Biomater. 2015, 21, 217–227. [Google Scholar] [CrossRef]
- Sopcak, T.; Medvecky, L.; Giretova, M.; Stulajterova, R.; Durisin, J. Hydrolysis, setting properties and in vitro characterization of wollastonite/newberyite bone cement mixtures. J. Biomater. Appl. 2017, 32, 871–885. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Liu, J.; Li, F.; Pan, Z.; Ni, X.; Shen, Y.; Xu, H.; Huang, Q. Bioactive calcium sulfate/magnesium phosphate cement for bone substitute applications. Mater. Sci. Eng. C 2014, 35, 70–76. [Google Scholar] [CrossRef]
- Arise, R.O.; Davies, F.F.; Malomo, S.O. Independent and interactive effects of Mg2+ and Co2+ on some kinetic parameters of rat kidney alkaline phosphatase. Sci. Res. Ess. 2008, 3, 488–494. [Google Scholar]
- Goldberg, M.A.; Smirnov, V.V.; Antonova, O.S.; Khairutdinova, D.R.; Smirnov, S.V.; Krylov, A.I.; Sergeeva, N.S.; Sviridova, I.K.; Kirsanova, V.A.; Ahmedova, S.A.; et al. Magnesium-substituted calcium phosphate bone cements containing MgO as a separate phase: Synthesis and in vitro behavior. Mendeleev Commun. 2018, 28, 329–331. [Google Scholar] [CrossRef]
- Lu, J.; Wei, J.; Yan, Y.; Li, H.; Jia, J.; Wei, S.; Guo, H.; Xiao, T.; Liu, C. Preparation and preliminary cytocompatibility of magnesium doped apatite cement with degradability for bone regeneration. J. Mater. Sci. Mater. Med. 2011, 22, 607–615. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.; Wei, J.; Guo, H.; Chen, F.; Hong, H.; Liu, C. Self-setting bioactive calcium–magnesium phosphate cement with high strength and degradability for bone regeneration. Acta Biomater. 2008, 4, 1873–1884. [Google Scholar] [CrossRef]
- Wei, J.; Jia, J.; Wu, F.; Wei, S.; Zhou, H.; Zhang, H.; Shin, J.W.; Liu, C. Hierarchically microporous/macroporous scaffold of magnesium–calcium phosphate for bone tissueregeneration. Biomaterials 2010, 31, 1260–1269. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Ma, X.; Lin, D.; Shi, H.; Yuan, Y.; Tang, W.; Zhou, H.; Guo, H.; Qian, J.; Liu, C. Magnesium modification of a calcium phosphate cement alters bone marrow stromal cell behavior via an integrin-mediated mechanism. Biomaterials 2015, 53, 251–264. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Luthringer, B.J.; Feyerabend, F.; Schilling, A.F.; Willumeit, R. Effects of extracellular magnesium on the differentiation and function of human osteoclasts. Acta Biomater. 2014, 10, 2843–2854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Yang, Z.; Chen, Z.; Kang, T.; Ding, X.; Li, Y.; Liao, Y.; Chen, C.; Yuan, H.; Peng, H. A study on bone cement con-taining magnesium potassium phosphate for bone repair. Cogent Biol. 2018, 4, 1487255. [Google Scholar] [CrossRef]
- Farzadia, A.; Bakhshib, F.; Solati-Hashjina, M.; Asadi-Eydivanda, M.; abu Osman, N.A. Magnesium incorporated hydroxyapatite: Synthesis and structural properties characterization. Ceram. Int. 2014, 40, 6021–6029. [Google Scholar] [CrossRef] [Green Version]
- Brodziak-Dopierala, B.; Kwapulinski, J.; Kusz, D.; Gajda, Z.; Sobczyk, K. Interactions between concentrations of chemical elements in human femoral heads. Arch. Environ. Contam. Toxicol. 2009, 57, 203–210. [Google Scholar] [CrossRef]
- Medvecky, L.; Giretova, M.; Stulajterova, R.; Luptakova, L.; Sopcak, T. Tetracalcium Phosphate/Monetite/Calcium Sulfate Hemihydrate Biocement Powder Mixtures Prepared by the One-Step Synthesis for Preparation of Nanocrystalline Hydroxy-apatite Biocement—Properties and in Vitro Evaluation. Materials 2021, 14, 2137. [Google Scholar] [CrossRef]
- Giretova, M.; Medvecky, L.; Petrovova, E.; Cizkova, D.; Danko, J.; Mudronova, D.; Slovinska, L.; Bures, R. Polyhydroxybutyr-ate/chitosan 3D scaffolds promote in vitro and in vivo chondrogenesis. Appl. Biochem. Biotechnol. 2019, 189, 556–575. [Google Scholar] [CrossRef] [PubMed]
- ISO 10993-12; Biological Evaluation of Medical Devices—Part 12: Sample Preparation and Reference Materials. International Organization for Standardization: Geneva, Switzerland, 2012.
- ISO 10993-5; ISO 10993-5 Biological Evaluation of Medical Devices- Part 5: Tests for In Vitro Cytotoxicity. International Organization for Standardization: Geneva, Switzerland, 2003.
- Grässel, S.; Ahmed, N.; Göttl, C.; Grifka, J. Gene and protein expression profile of naive and osteo-chondrogenically differentiated rat bonemarrow-derived mesenchymal progenitor cells. Int. J. Mol. Med. 2009, 23, 745–755. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Chen, X.; Yuan, T.; Yang, X.; Fan, Y.; Zhang, X. Regulation of the secretion of immunoregulatory factors of mesen-chymal stem cells(MSCs) by collagen-based scaffolds during chondrogenesis. Mater. Sci. Eng. C. 2017, 70, 983–991. [Google Scholar] [CrossRef] [PubMed]
- Yusop, N.; Battersby, P.; Alraies, A.; Sloan, A.J.; Moseley, R.; Waddington, R.J. Isolation and characterisation of mesen-chymal stem cells from rat bone marrow and the Endosteal niche: A comparative study. Stem Cells Int. 2018, 2018, 6869128. [Google Scholar] [CrossRef]
- Karaoz, E.; Aksoy, A.; Ayhan, S.; Sarıboyaci, A.E.; Kaymaz, F.; Kasap, M. Char-acterization of mesenchymal stem cells from rat bone marrow: Ultra-structural properties, differentiation potential and immunophenotypic markers. Histochem. Cell Biol. 2009, 132, 533–546. [Google Scholar] [CrossRef]
- Sun, X.; Su, W.; Ma, X.; Zhang, H.; Sun, Z.; Li, X. Comparison of the osteogenic capability of rat bone mesenchymal stem cells on collagen, collagen/hydroxyapatite, hydroxyapatite and biphasic calcium phosphate. Regen. Biomater. 2017, 5, 93–103. [Google Scholar] [CrossRef] [Green Version]
- Moseke, C.; Gbureck, U. Tetracalcium phosphate: Synthesis, properties and biomedical applications. Acta Biomater. 2010, 6, 3815–3823. [Google Scholar] [CrossRef]
- Jalota, S.; Tas, A.C.; Bhaduri, S.B. Synthesis of HA-Seeded TTCP (Ca4(PO4)2O) Powders at 1230 °C from Ca(CH3COO)2·H2O and NH4H2PO4. J. Am. Ceram. Soc. 2005, 88, 3353–3360. [Google Scholar] [CrossRef]
- Xu, J.; Butler, I.S.; Gilson, D.F.R. FT-Raman and high-pressure infrared spectroscopic studies of dicalcium phosphate dehydrate (CaHPO4. 2H2O) and anhydrous dicalcium phosphate (CaHPO4 ). Spectrochim. Acta Part A 1999, 55, 2801–2809. [Google Scholar] [CrossRef]
- Harcharras, M.; Ennaciri, A.; Rulmont, A.; Gilbert, B. Vibrational spectra and structures of double diphosphates M2CdP2O7 (M = Li, Na, K, Rb, Cs). Spectrochim. Acta Part A: Mol. Biomol. Spectrosc. 1997, 53, 345–352. [Google Scholar] [CrossRef]
- Mata, N.A.; Velasquez, P.; Murciano, A.; De Aza, P.N. Multilayer Mg-pyrophosphate glass ceramic with discontinuous bioac-tivity. Physicochemical characterization. Ceram. Int. 2021, 47, 14612–14620. [Google Scholar] [CrossRef]
- Mahajan, R.; Prakash, R. Effect of Sm3+ doping on optical properties of Mg2P2O7 and Mg3P2O8 phosphors. Mater. Chem. Phys. 2020, 246, 122826. [Google Scholar] [CrossRef]
- Ren, F.; Ding, Y.; Leng, Y. Infrared spectroscopic characterization of carbonated apatite: A combined experimental and computational study. J. Biomed. Mater. Res. Part A 2014, 102A, 496–505. [Google Scholar] [CrossRef] [PubMed]
- Grunenwald, A.; Keyser, C.; Sautereau, A.; Crubézy, E.; Ludes, B.; Drouet, C. Revisiting carbonate quantification in apatite (bio)minerals: A validated FTIR methodology. J. Archaeol. Sci. 2014, 49, 134–141. [Google Scholar] [CrossRef] [Green Version]
- Shijian, F.; Bing, C. Experimental study of phosphate salts influencing properties of magnesium phosphate cement. Constr. Build. Mater. 2014, 65, 480–485. [Google Scholar]
- Zhang, X.; Chen, Q.; Mao, X. Magnesium Enhances Osteogenesis of BMSCs by Tuning Osteoimmunomodulation. BioMed Res. Int. 2019, 2019, 1–13. [Google Scholar] [CrossRef]
- Yu, Y.; Guo, H.; Pujari-Palmer, M.; Stevensson, B.; Grins, J.; Engqvist, H.; Edén, M. Advanced solid-state 1 H/31P NMR char-acterization of pyrophosphate-doped calcium phosphate cements for biomedical applications: The structural role of pyro-phosphate. Ceram. Inter. 2019, 45, 20642–20655. [Google Scholar] [CrossRef]
- Gras, P.; Rey, C.; Marsan, O.; Sarda, S.; Combes, C. Synthesis and Characterisation of Hydrated Calcium Pyrophosphate Phases of Biological Interest. Eur. J. Inorg. Chem. 2013, 2013, 5886–5895. [Google Scholar] [CrossRef]
- Lala, S.; Ghosh, M.; Das, P.K.; Das, D.; Kar, T.; Pradhan, S.K. Magnesium substitution in carbonated hydroxyapatite: Structural and microstructural characterization by Rietveld’s refinement. Mat. Chem. Phys. 2016, 170, 319–329. [Google Scholar] [CrossRef]
- Landi, E.; Logroscino, G.; Proietti, L.; Tampieri, A.; Sandri, M.; Sprio, S. Biomimetic Mg-substituted hydroxyapatite: From syn-thesis to in vivo behaviour. J. Mater. Sci. Mater. Med. 2008, 19, 239–247. [Google Scholar] [CrossRef]
- Liu, Q.; Chen, Z.; Pan, H.; Darvell, B.W.; Matinlinna, J.P. Effect of Magnesium on the Solubility of Hydroxyapatite. Eur. J. Inorg. Chem. 2016, 2016, 5623–5629. [Google Scholar] [CrossRef]
- Cox, S.; Jamshidi, P.; Grover, L.; Mallick, K.K. Preparation and characterisation of nanophase Sr, Mg, and Zn substituted hydroxyapatite by aqueous precipitation. Mater. Sci. Eng. C 2014, 35, 106–114. [Google Scholar] [CrossRef]
- Goldberg, M.; Krohicheva, P.; Fomin, A.; Khairutdinova, D.; Antonova, O.; Baikin, A.; Smirnov, V.; Fomina, A.; Leonov, A.; Mikheev, I.; et al. In situ magnesium calcium phosphate cements formation: From one pot powders precursors synthesis to in vitro investigations. Bioact. Mater. 2020, 5, 644–658. [Google Scholar] [CrossRef]
- Mestres, G.; Aguilera, F.S.; Manzanares, N.; Sauro, S.; Osorio, R.; Toledano, M.; Ginebra, M.-P. Magnesium phosphate cements for endodontic applications with improved long-term sealing ability. Int. Endod. J. 2013, 47, 127–139. [Google Scholar] [CrossRef]
- Grover, L.M.; Wright, A.J.; Gbureck, U.; Bolarinwa, A.; Song, J.; Liu, Y.; Farrar, D.F.; Howling, G.; Rose, J.; Barralet, J.E. The effect of amorphous pyrophosphate on calcium phosphate cement resorption and bone generation. Biomaterials 2013, 34, 6631–6637. [Google Scholar] [CrossRef] [Green Version]
- Bondarenko, A.; Angrisani, N.; Meyer-Lindenberg, A.; Seitz, J.M.; Waizy, H.; Reifenrath, J. Magnesium-based bone implants: Immunohistochemical analysis of peri-implant osteogenesis by evaluation of osteopontin and osteocalcin expression. J. Biomed. Mater. Res. Part A 2013, 102, 1449–1457. [Google Scholar] [CrossRef]
- McKee, M.D.; Pedraza, C.E.; Kaartinen, M.T. Osteopontin and Wound Healing in Bone. Cells Tissues Organs 2011, 194, 313–319. [Google Scholar] [CrossRef]
- Termine, J.D.; Kleinman, H.K.; Whitson, S.; Conn, K.M.; McGarvey, M.L.; Martin, G.R. Osteonectin, a bone-specific protein linking mineral to collagen. Cell 1981, 26, 99–105. [Google Scholar] [CrossRef]
- Nourisa, J.; Zeller-Plumhoff, B.; Helmholz, H.; Luthringer-Feyerabend, B.; Ivannikov, V.; Willumeit-Römer, R. Magnesium ions regulate mesenchymal stem cells population and osteogenic differentiation: A fuzzy agent-based modeling approach. Comput. Struct. Biotechnol. J. 2021, 19, 4110–4122. [Google Scholar] [CrossRef]
- Xu, J.; Bai, Y.; Jin, J.; Zhang, J.; Zhang, S.; Cui, L.; Zhang, H. Magnesium modulates the expression levels of calcification-associated factors to inhibit calcification in a time-dependent manner. Exp. Ther. Med. 2015, 9, 1028–1034. [Google Scholar] [CrossRef] [Green Version]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stulajterova, R.; Medvecky, L.; Giretova, M.; Sopcak, T.; Luptakova, L.; Bures, R.; Szekiova, E. Characterization of Tetracalcium Phosphate/Monetite Biocement Modified by Magnesium Pyrophosphate. Materials 2022, 15, 2586. https://doi.org/10.3390/ma15072586
Stulajterova R, Medvecky L, Giretova M, Sopcak T, Luptakova L, Bures R, Szekiova E. Characterization of Tetracalcium Phosphate/Monetite Biocement Modified by Magnesium Pyrophosphate. Materials. 2022; 15(7):2586. https://doi.org/10.3390/ma15072586
Chicago/Turabian StyleStulajterova, Radoslava, Lubomir Medvecky, Maria Giretova, Tibor Sopcak, Lenka Luptakova, Radovan Bures, and Eva Szekiova. 2022. "Characterization of Tetracalcium Phosphate/Monetite Biocement Modified by Magnesium Pyrophosphate" Materials 15, no. 7: 2586. https://doi.org/10.3390/ma15072586