New Set of EST-STR Markers for Discrimination of Related Papaver somniferum L. Varieties
Abstract
:1. Introduction
2. Materials and Methods
2.1. Papaver somniferum L. Genotypes
2.2. STR Analyses
2.3. Genetic Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shukla, S.; Yadav, H.K.; Rastogi, A.; Mishra, B.K.; Singh, S.P. Alkaloid diversity in relation to breeding for specific alkaloids in opium poppy (Papaver somniferum L.). Czech J. Genet. Plant Breed. 2010, 46, 164–169. [Google Scholar] [CrossRef]
- Yu, J.-K.; Chung, Y.-S. Plant variety protection: Current practices and insights. Genes 2021, 12, 1127. [Google Scholar] [CrossRef] [PubMed]
- Acharya, H.; Sharma, V. Molecular characterization of opium poppy (Papaver somniferum) germplasm. Am. J. Infect. Dis. 2009, 5, 148–153. [Google Scholar] [CrossRef]
- Parmaksiz, I.; Özcan, S. Morphological, chemical, and molecular analyses of Turkish Papaver accessions (Sect. Oxytona). Turk. J. Bot. 2011, 35, 1–16. [Google Scholar] [CrossRef]
- Saunders, J.A.; Pedroni, M.J.; Penrose, L.D.J.; Fist, A.J. AFLP Analysis of opium poppy. Crop Sci. 2001, 41, 1596–1601. [Google Scholar] [CrossRef]
- Lee, E.J.; Jin, G.N.; Lee, K.L.; Han, M.S.; Lee, Y.H.; Yang, M.S. Exploiting expressed sequence tag databases for the development and characterization of gene-derived simple sequence repeat markers in the opium poppy (Papaver somniferum L.) for forensic applications. J. Forensic Sci. 2011, 56, 1131–1135. [Google Scholar] [CrossRef] [PubMed]
- Şelale, H.; Çelik, I.; Gültekin, V.; Allmer, J.; Doğanlar, S.; Frafy, A. Development of EST-SSR markers for diversity and breeding studies in opium poppy. Plant Breed. 2013, 132, 344–351. [Google Scholar] [CrossRef]
- Celik, V.; Gultekin, J.; Allmer, S.; Doganlar, S.; Frafy, A. Development of genomic simple sequence repeat markers in opium poppy by next-generation sequencing. Mol. Breed. 2014, 34, 323–334. [Google Scholar] [CrossRef]
- Mičianová, V.; Ondreičková, K.; Muchová, D.; Klčová, L.; Hudcovicová, M.; Havrlentová, M.; Mihálik, D.; Kraic, J. Forensic application of EST-derived STR markers in opium poppy. Biologia 2017, 72, 587–594. [Google Scholar] [CrossRef]
- Guo, L.; Winzer, T.; Yang, X.; Li, Y.; Ning, Z.; Teodor, R.; Lu, Y.; Bowser, T.A.; Graham, I.A.; Ye, K. The opium poppy genome and morphinan production. Science 2018, 362, 343–347. [Google Scholar] [CrossRef]
- Benson, D.A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucl. Acids Res. 2013, 41, D36–D42. [Google Scholar] [CrossRef] [PubMed]
- Da Maia, L.C.; Palmieri, D.A.; De Souza, V.Q.; Kopp, M.M.; De Carvalho, F.I.F.; De Oliveira, A.C. SSR Locator: Tool for simple sequence repeat discovery integrated with primer design and PCR simulation. Int. J. Plant Genom. 2008, 2008, 412696. [Google Scholar] [CrossRef] [PubMed]
- You, F.M.; Huo, N.; Gu, Y.Q.; Luo, M.; Ma, Y.; Hane, D.; Lazo, G.R.; Dvorak, J.; Anderson, O.D. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinform. 2008, 9, 253. [Google Scholar] [CrossRef] [PubMed]
- Bassam, B.J.; Caetano-Anollés, G. Silver staining of DNA in polyacrylamide gels. Appl. Biochem. Biotechnol. 1993, 42, 181–188. [Google Scholar] [CrossRef]
- Bassam, B.J.; Gresshoff, P.M. Silver staining of DNA in polyacrylamide gels. Nat. Protoc. 2007, 2, 2649–2654. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Amiryousefi, A.; Hyvönen, J.; Poczai, P. iMEC: Online marker efficiency calculator. Appl. Plant Sci. 2018, 6, e1159. [Google Scholar] [CrossRef]
- Perrier, X.; Flori, A.; Bonnot, F. Data analysis methods. In Genetic Diversity of Cultivated Tropical Plants, 1st ed.; Hamon, P., Seguin, M., Perrier, X., Glaszmann, J.C., Eds.; Enfield Science Publishers: Montpellier, France, 2003; pp. 43–76. [Google Scholar]
- Chang, M.; Lee, E.-J.; Kim, J.-Y.; Lee, H.; Choe, S. A new minisatellite VNTR marker, Pscp1, discovered for the identification of opium poppy. Forensic Sci. Int. Genet. 2021, 55, 102581. [Google Scholar] [CrossRef]
- Chang, M.; Kim, J.-Y.; Lee, H.; Lee, E.-J.; Lee, W.-H.; Moon, S.; Choe, S.; Choung, C.M. Development of diagnostic SNP markers and a novel SNP genotyping assay for distinguishing opium poppies. Forensic Sci. Int. 2022, 339, 114416. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, J.; Yang, L.; Niu, J.; Huang, R.; Yuan, F.; Liang, Q. Development of SSR and SNP markers for identifying opium poppy. Int. J. Leg. Med. 2022, 136, 1261–1271. [Google Scholar] [CrossRef] [PubMed]
- Kati, V.; Le Corre, V.; Michel, S.; Jaffrelo, L.; Poncet, C.; Délye, C. Isolation and characterisation of 11 polymorphic microsatellite markers in Papaver rhoeas L. (Corn Poppy), a major annual plant species from cultivated areas. Int. J. Mol. Sci. 2013, 14, 470–479. [Google Scholar] [CrossRef] [PubMed]
- Hadipour, M.; Kazemitabar, S.K.; Yaghini, H.; Dayani, S. Genetic diversity and species differentiation of medicinal plant Persian poppy (Papaver bracteatum L.) using AFLP and ISSR markers. Ecol. Genet. Genom. 2020, 16, 100058. [Google Scholar] [CrossRef]
- Bae, S.-H.; Oh, J.-H.; Lee, J. Identification of interspecific and intraspecific single nucleotide polymorphisms in Papaver spp. Plant Breed. Biotechnol. 2021, 9, 55–64. [Google Scholar] [CrossRef]
- Tittarelli, R.; Gismondi, A.; Di Marco, G.; Mineo, F.; Vernich, F.; Russo, C.; Marsella, L.T.; Canini, A. Forensic application of genetic and toxicological analyses for the identification and characterization of the opium poppy (Papaver somniferum L.). Biology 2022, 11, 672. [Google Scholar] [CrossRef] [PubMed]
- Graham, K.; Houston, R. Evaluation of chloroplast DNA barcoding markers to individualize Papaver somniferum for forensic intelligence purposes. Int. J. Leg. Med. 2022. [Google Scholar] [CrossRef]
- Hong, U.V.T.; Tamiru-Oli, M.; Hurgobin, B.; Okey, C.R.; Abreu, A.R.; Lewsey, M.G. Insight into opium poppy (Papaver spp.) genetic diversity from genotyping-by-sequencing analysis. Sci. Rep. 2022, 12, 111. [Google Scholar] [CrossRef]
- Arenas, M.; Pereira, F.; Oliveira, M.; Pinto, N.; Lopes, A.M.; Gomes, V.; Carracedo, A.; Amorim, A. Forensic genetics and genomics: Much more than just a human affair. PLoS Genet. 2017, 13, e1006960. [Google Scholar] [CrossRef]
- Alonso, A.; Barrio, P.A.; Müller, P.; Köcher, S.; Berger, B.; Martin, P.; Bodner, M.; Willuweit, S.; Parson, W.; Roewer, L.; et al. Current state-of-art of STR sequencing in forensic genetics. Electrophoresis 2018, 392, 655–2668. [Google Scholar] [CrossRef]
- Kowalczyk, M.; Zawadzka, E.; Szewczuk, D.; Gryzińska, M.; Jakubczak, A. Molecular markers used in forensic genetics. Med. Sci. Law 2018, 58, 201–209. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.L.; Skalnick, M.H.; Davies, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Svoboda, P.; Vašek, J.; Vejl, P.; Ovesná, J. Genetic features of Czech blue poppy (Papaver somniferum L.) revealed by DNA polymorphism. Czech J. Food Sci. 2020, 38, 198–202. [Google Scholar] [CrossRef]
- Young, B.; Roman, M.G.; LaRue, B.; Gangitano, D.; Houston, R. Evaluation of 19 short tandem repeat markers for individualization of Papaver somniferum. Sci. Justice 2020, 60, 253–262. [Google Scholar] [CrossRef] [PubMed]
- György, Z.; Alam, S.; Priyanka, P.; Zámboriné Németh, É. Genetic diversity and relationships of opium poppy accessions based on SSR markers. Agriculture 2022, 12, 1343. [Google Scholar] [CrossRef]
- Vašek, J.; Čílová, D.; Melounová, M.; Svoboda, P.; Vejl, P.; Štikarová, R.; Vostrý, L.; Kuchtová, P.; Ovesná, J. New EST-SSR markers for individual genotyping of opium poppy cultivars (Papaver somniferum L.). Plants 2020, 9, 10. [Google Scholar] [CrossRef]
- Vašek, J.; Čílová, D.; Melounová, M.; Svoboda, P.; Zdeňková, K.; Čermáková, E.; Ovesná, J. OpiumPlex is a novel microsatellite system for profiling opium poppy (Papaver somniferum L.). Sci. Rep. 2021, 11, 12799. [Google Scholar] [CrossRef]
- Palumbo, F.; Barcaccia, G. Critical aspects on the use of microsatellite markers for assessing genetic identity of crop plant varieties and authenticity of their food derivates. In Rediscovery of Landraces as a Resources for the Future; Grillo, O., Ed.; IntechOpen Ltd.: London, UK, 2018; pp. 129–160. [Google Scholar]
Locus | Repeat Motif | Primer Sequence (5′-3′) | Polymorphic Alleles (bp) | GenBank® Accession Number |
---|---|---|---|---|
PsTlFbp | (TGA)6 | ACTTCACAATACCCATCCCAG | 194, 197 | XM_026526123.1 |
CTTACACACACAAGCACAGGA | ||||
PsUPLoc113346659ch2 | (TGG)10 | CATGGCCAGTACCGATGTTG | 191, 194 | XM_026590141.1 |
GTAACCATCGGCGTTTAATGC | ||||
PsUPLoc113271859ch4 | (GAA)12 | ACCCAATTGAGAATCCAGAAGA | 223, 226, 232 | XM_026521782.1 |
CCACATCCTTACCTTCACATTCA | ||||
PsUPLoc113286548ch6 | (CTT)10 | AGCCTGTACCTTATCAAACC | 127, 133, 139 | XM_026535133 |
TTTTATGGTTTCCCGGATGA | ||||
PsPDRPRGA3 | (GAT)6 | TTACAACTGCGCTGGGATTC | 170, 190 | XM_026523892 |
ACACCGAAGTACTCATCATCCA | ||||
PsAcATE13lP | (GA)10, (CTT)14 | TCATTGGGAAAGCTTACCA | 181, 183, 190, 200, 208 | XM_026523258 |
TCAAGTTCCATTCGTCTGT | ||||
PsPRUVBS3lX2 | (GAT)8 | AGGGAGAAAGAAGAAGGAGT | 226, 228 | NC_039362.1 |
TCTCCGATTTCTCTCCATCT | ||||
PsOT4l | (GAA)17 | AGTACCACACCAAGAAAACA | 173, 179, 188, 191, 200 | XM_026535173.1 |
TCTAACTTCTTCAATCGGTG | ||||
PsHD2l | (CTT)10 | CCAACTAATGAAAACCCAGG | 168, 171, 174, 176, 177 | XM_026543538.1 |
TCGATACATAAGAAGGCGAT | ||||
PsZFA20AN1SAP5l | (T)9AAA(T)14, (GAA)6 | CTGTCGTCTCTCTCAGTTAA | 227, 228, 231, 232 | XM_026571943.1 |
TCAGATTTGAAATCCCCTCT |
Marker/Locus | Na | Ne | HObs | HExp | I | PIC | MI | D | PI | PIsibs |
---|---|---|---|---|---|---|---|---|---|---|
PsTlFbP | 2 | 1.24 | 0.130 | 0.198 | 0.344 | 0.175 | 0.194 | 0.194 | 0.669 | 0.820 |
PsUPLoc113346659ch2 | 2 | 1.41 | 0.000 | 0.294 | 0.462 | 0.246 | 0.287 | 0.300 | 0.549 | 0.744 |
PsUPLoc113271859ch4 | 3 | 1.92 | 0.000 | 0.491 | 0.777 | 0.399 | 0.480 | 0.502 | 0.351 | 0.598 |
PsPDRPRGA3 | 2 | 1.97 | 0.087 | 0.502 | 0.685 | 0.371 | 0.491 | 0.510 | 0.379 | 0.599 |
PsAcATE13lP | 5 | 2.93 | 0.043 | 0.673 | 1.277 | 0.610 | 0.659 | 0.688 | 0.165 | 0.462 |
PsPRUVBS3lX2 | 2 | 1.60 | 0.000 | 0.385 | 0.562 | 0.305 | 0.510 | 0.534 | 0.461 | 0.678 |
PsOT4l | 5 | 3.32 | 0.043 | 0.714 | 1.346 | 0.649 | 0.698 | 0.729 | 0.140 | 0.436 |
PsUPLoc113286548ch6 | 3 | 2.14 | 0.391 | 0.544 | 0.833 | 0.430 | 0.532 | 0.490 | 0.321 | 0.564 |
PsHD2l | 5 | 1.90 | 0.087 | 0.483 | 0.916 | 0.430 | 0.472 | 0.492 | 0.321 | 0.594 |
PsZFA20AN1SAP5l | 4 | 2.56 | 0.000 | 0.622 | 1.069 | 0.531 | 0.609 | 0.636 | 0.230 | 0.503 |
Mean | 3.3 | 2.10 | 0.078 | 0.491 | 0.827 | 0.415 | 0.493 | 0.508 | nc | nc |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaňuková, Š.; Ondreičková, K.; Mihálik, D.; Kraic, J. New Set of EST-STR Markers for Discrimination of Related Papaver somniferum L. Varieties. Life 2024, 14, 72. https://doi.org/10.3390/life14010072
Kaňuková Š, Ondreičková K, Mihálik D, Kraic J. New Set of EST-STR Markers for Discrimination of Related Papaver somniferum L. Varieties. Life. 2024; 14(1):72. https://doi.org/10.3390/life14010072
Chicago/Turabian StyleKaňuková, Šarlota, Katarína Ondreičková, Daniel Mihálik, and Ján Kraic. 2024. "New Set of EST-STR Markers for Discrimination of Related Papaver somniferum L. Varieties" Life 14, no. 1: 72. https://doi.org/10.3390/life14010072