MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. DNA Extraction and MICA Genotyping
2.3. Determination of Allele Frequency and Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pociot, F.; Lernmark, Å. Genetic Risk Factors for Type 1 Diabetes. Lancet 2016, 387, 2331–2339. [Google Scholar] [CrossRef]
- Zayed, H. Genetic Epidemiology of Type 1 Diabetes in the 22 Arab Countries. Curr. Diab. Rep. 2016, 16, 37. [Google Scholar] [CrossRef] [PubMed]
- Howson, J.M.M.; Stevens, H.; Smyth, D.J.; Walker, N.M.; Chandler, K.A.; Bingley, P.J.; Todd, J.A. Evidence That HLA Class I and II Associations with Type 1 Diabetes, Autoantibodies to GAD and Autoantibodies to IA-2, Are Distinct. Diabetes 2011, 60, 2635–2644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khdair, S.I.; Jarrar, W.; Jarrar, Y.B.; Bataineh, S.; Al-Khaldi, O. Association of HLA-DRB1 and –DQ Alleles and Haplotypes with Type 1 Diabetes in Jordanians. Endocr. Metab. Immune Disord.-Drug Targets 2020, 20, 895–902. [Google Scholar] [CrossRef] [PubMed]
- Hamzeh, A.R.; Nair, P.; Al Ali, M.T. The Profile of HLA-DRB1 Alleles in Arabs with Type 1 Diabetes; Meta-Analyses. Hla 2016, 87, 25–30. [Google Scholar] [CrossRef]
- Hamzeh, A.R.; Nair, P.; Al-Khaja, N.; Al Ali, M.T. Association of HLA-DQA1 and -DQB1 Alleles with Type I Diabetes in Arabs: A Meta-Analyses. Tissue Antigens 2015, 86, 21–27. [Google Scholar] [CrossRef]
- Erlich, H.; Valdes, A.M.; Noble, J.; Carlson, J.A.; Varney, M.; Concannon, P.; Mychaleckyj, J.C.; Todd, J.A.; Bonella, P.; Fear, A.L.; et al. HLA DR-DQ Haplotypes and Genotypes and Type 1 Diabetes Risk: Analysis of the Type 1 Diabetes Genetics Consortium Families. Diabetes 2008, 57, 1084–1092. [Google Scholar] [CrossRef] [Green Version]
- She, J.-X.; Marron, M.P. Genetic Susceptibility Factors in Type 1 Diabetes: Linkage, Disequilibrium and Functional Analyses. Curr. Opin. Immunol. 1998, 10, 682–689. [Google Scholar] [CrossRef]
- Moghaddam, P.H.; De Knijf, P.; Roep, B.O.; Van der Auwera, B.; Naipal, A.; Gorus, F.; Schuit, F.; Giphart, M.J. Genetic Structure of IDDM1: Two Separate Regions in the Major Histocompatibility Complex Contribute to Susceptibility or Protection. Diabetes 1998, 47, 263–269. [Google Scholar] [CrossRef]
- Blomhoff, A.; Olsson, M.; Johansson, S.; Akselsen, H.E.; Pociot, F.; Nerup, J.; Kockum, I.; Cambon-Thomsen, A.; Thorsby, E.; Undlien, D.E.; et al. Linkage Disequilibrium and Haplotype Blocks in the MHC Vary in an HLA Haplotype Specific Manner Assessed Mainly by DRB1*03 and DRB104* Haplotypes. Genes Immun. 2006, 7, 130–140. [Google Scholar] [CrossRef]
- Zavattari, P.; Lampis, R.; Motzo, C.; Loddo, M.; Mulargia, A.; Whalen, M.; Maioli, M.; Angius, E.; Todd, J.A.; Cucca, F. Conditional Linkage Disequilibrium Analysis of a Complex Disease Superlocus, IDDM1 in the HLA Region, Reveals the Presence of Independent Modifying Gene Effects Influencing the Type 1 Diabetes Risk Encoded by the Major HLA-DBQ1, -DRB1 Disease Loci. Hum. Mol. Genet. 2001, 10, 881–889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Undlien, D.E.; Lie, B.A.; Thorsby, E. HLA Complex Genes in Type 1 Diabetes and other autoimmune diseases. Which Genes Are Involved? Trends Genet. 2001, 17, 93–100. [Google Scholar] [CrossRef]
- Gambelunghe, G.; Ghaderi, M.; Cosentino, A.; Falorni, A.; Brunetti, P.; Falorni, A.; Sanjeevi, C.B. Association of MHC Class I Chain-Related A (MIC-A) Gene Polymorphism with Type I Diabetes. Diabetologia 2000, 43, 507–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, Y.; Lee, H.; Sanjeevi, C.B.; Eisenbarth, G.S. MICA Polymorphism Is Associated with Type 1 Diabetes in the Korean Population. Diabetes Care 2001, 24, 33–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Autreve, J.E.; Koeleman, B.P.C.; Quartier, E.; Aminkeng, F.; Weets, I.; Gorus, F.K.; Van der Auwera, B.J.R. MICA Is Associated with Type 1 Diabetes in the Belgian Population, Independent of HLA-DQ. Hum. Immunol. 2006, 67, 94–101. [Google Scholar] [CrossRef]
- Alizadeh, B.Z.; Eerligh, P.; van der Slik, A.R.; Shastry, A.; Zhernakova, A.; Valdigem, G.; Bruining, J.G.; Sanjeevi, C.B.; Wijmenga, C.; Roep, B.O.; et al. MICA Marks Additional Risk Factors for Type 1 Diabetes on Extended HLA Haplotypes: An Association and Meta-Analysis. Mol. Immunol. 2007, 44, 2806–2812. [Google Scholar] [CrossRef]
- Gambelunghe, G.; Brozzetti, A.; Ghaderi, M.; Candeloro, P.; Tortoioli, C.; Falorni, A. MICA Gene Polymorphism in the Pathogenesis of Type 1 Diabetes. Ann. N. Y. Acad. Sci. 2007, 1110, 92–98. [Google Scholar] [CrossRef]
- Bilbao, J.R.; Martín-Pagola, A.; Calvo, B.; Perez De Nanclares, G.; Gepv-N; Castaño, L. Contribution of MIC-A Polymorphism to Type 1 Diabetes Mellitus in Basques. Ann. N. Y. Acad. Sci. 2002, 958, 321–324. [Google Scholar] [CrossRef]
- Frigoul, A.; Lefranc, M.-P. MICA: Standardized IMGT Allele Nomenclature, Polymorphisms and Diseases. Recent Res. Devel. Hum. Genet. 2005, 3, 95–145. [Google Scholar]
- Bahram, S. MIC Genes: From Genetics to Biology. Adv. Immunol. 2001, 76, 1–60. [Google Scholar] [CrossRef]
- Choy, M.K.; Phipps, M.E. MICA Polymorphism: Biology and Importance in Immunity and Disease. Trends Mol. Med. 2010, 16, 97–106. [Google Scholar] [CrossRef] [PubMed]
- Groh, V.; Bahram, S.; Bauer, S.; Herman, A.; Beauchamp, M.; Spies, T. Cell Stress-Regulated Human Major Histocompatibility Complex Class I Gene Expressed in Gastrointestinal Epithelium. Proc. Natl. Acad. Sci. USA 1996, 93, 12445–12450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bauer, S.; Groh, V.; Wu, J.; Steinle, A.; Phillips, J.H.; Lanier, L.L.; Spies, T. Activation of NK Cells and T Cells by NKG2D, a Receptor for Stress-Inducible MICA. Science 1999, 285, 727–729. [Google Scholar] [CrossRef] [PubMed]
- Collins, R.W.M. Human MHC Class I Chain Related (MIC) Genes: Their Biological Function and Relevance to Disease and Transplantation. Eur. J. Immunogenet. 2004, 44, 105–114. [Google Scholar] [CrossRef]
- Borrego, F.; Kabat, J.; Kim, D.K.; Lieto, L.; Maasho, K.; Peña, J.; Solana, R.; Coligan, J.E. Structure and Function of Major Histocompatibility Complex (MHC) Class I Specific Receptors Expressed on Human Natural Killer (NK) Cells. Mol. Immunol. 2002, 38, 637–660. [Google Scholar] [CrossRef] [Green Version]
- Tsai, S.; Shameli, A.; Santamaria, P. CD8+ T Cells in Type 1 Diabetes. Advances in Immunology. 2008, 100, 79–124. [Google Scholar] [CrossRef]
- Zingoni, A.; Molfetta, R.; Fionda, C.; Soriani, A.; Paolini, R.; Cippitelli, M.; Cerboni, C.; Santoni, A. NKG2D and Its Ligands: “One for All, All for One”. Front. Immunol. 2018, 9, 476. [Google Scholar] [CrossRef]
- Caillat-Zucman, S. How NKG2D Ligands Trigger Autoimmunity? Hum. Immunol. 2006, 67, 204–207. [Google Scholar] [CrossRef]
- Sanjeevi, C.B. Genes Influencing Innate and Acquired Immunity in Type 1 Diabetes and Latent. Ann. N. Y. Acad. Sci. 2006, 80, 67–80. [Google Scholar] [CrossRef]
- Robinson, J.; Waller, M.J.; Parham, P.; Bodmer, J.G.; Marsh, S.G.E. IMGT/HLA Database—A Sequence Database for the Human Major Histocompatibility Complex. Nucleic Acids Res. 2001, 29, 210. [Google Scholar] [CrossRef] [Green Version]
- Anthony Nolan Research Institute. HLA. Available online: http://hla.alleles.org/alleles/classo.html (accessed on 28 September 2022).
- Stephens, H.A.F. MICA and MICB Genes: Can the Enigma of Their Polymorphism Be Resolved? Trends Immunol. 2001, 22, 378–385. [Google Scholar] [CrossRef]
- Li, P.; Morris, D.L.; Willcox, B.E.; Steinle, A.; Spies, T.; Strong, R.K. Complex Structure of the Activating Immunoreceptor NKG2D and Its MHC Class I-like Ligand MICA. Nat. Immunol. 2001, 2, 443–451. [Google Scholar] [CrossRef]
- Mizuki, N.; Ota, M.; Kimura, M.; Ohno, S.; Ando, H.; Katsuyama, Y.; Yamazaki, M.; Watanabe, K.; Goto, K.; Nakamura, S.; et al. Triplet Repeat Polymorphism in the Transmembrane Region of the MICA Gene: A Strong Association of Six GCT Repetitions with Behçet Disease. Proc. Natl. Acad. Sci. USA 1997, 94, 1298–1303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ota, M.; Katsuyama, Y.; Mizuki, N.; Ando, H.; Furihata, K.; Ono, S.; Pivetti-Pezzi, P.; Tabbara, K.F.; Palimeris, G.D.; Nikbin, B.; et al. Trinucleotide Repeat Polymorphism within Exon 5 of the MICA Gene (MHC Class I Chain-Related Gene A): Allele Frequency Data in the Nine Population Groups Japanese, Northern Han, Hui, Uygur, Kazakhstan, Iranian, Saudi Arabian, Greek and Italian. Tissue Antigens 1997, 49, 448–454. [Google Scholar] [CrossRef] [PubMed]
- Vitiani, L.R.; Potolicchio, I.; D’Amato, M.; Baricordi, O.R.; Sorrentino, R. MICA Exon 5 Microsatellite Typing by DNA Heteroduplex Analysis: A New Polymorphism in the Transmembrane Region. Tissue Antigens 1998, 51, 309–311. [Google Scholar] [CrossRef]
- Gambelunghe, G.; Brozzetti, A.L.; Ghaderi, M.; Tortoioli, C.; Falorni, A. MICA A8: A New Allele within MHC Class I Chain-Related A Transmembrane Region with Eight GCT Repeats. Hum. Immunol. 2006, 67, 1005–1007. [Google Scholar] [CrossRef]
- Pérez-Rodríguez, M.; Corell, A.; Argüello, J.R.; Cox, S.T.; McWhinnie, A.; Marsh, S.G.E.; Madrigal, J.A. A New MICA Allele with Ten Alanine Residues in the Exon 5 Microsatellite. Tissue Antigens 2000, 55, 162–165. [Google Scholar] [CrossRef]
- Triolo, T.M.; Baschal, E.E.; Armstrong, T.K.; Toews, C.S.; Fain, P.R.; Rewers, M.J.; Yu, L.; Miao, D.; Eisenbarth, G.S.; Gottlieb, P.A.; et al. Homozygosity of the Polymorphism MICA5.1 Identifies Extreme Risk of Progression to Overt Adrenal Insufficiency among 21-Hydroxylase Antibody-Positive Patients with Type 1 Diabetes. J. Clin. Endocrinol. Metab. 2009, 94, 4517–4523. [Google Scholar] [CrossRef] [Green Version]
- Tian, W.; Boggs, D.A.; Uko, G.; Essiet, A.; Inyama, M.; Banjoko, B.; Adewole, T.; Ding, W.Z.; Mohseni, M.; Fritz, R.; et al. MICA, HLA-B Haplotypic Variation in Five Population Groups of Sub-Saharan African Ancestry. Genes Immun. 2003, 4, 500–505. [Google Scholar] [CrossRef] [Green Version]
- Allcock, R.; Cheong, K.; Christiansen, F.; Witt, C. Comment to: Gambelunghe, G., Ghaderi, Cosentino A et al. (2000) Association of MHC Class I Chain-Related A (MIC-A) Gene Polymorphism with Type I Diabetes. Diabetologia 43: 507–514. Diabetologia 2001, 44, 514–520. [Google Scholar]
- Field, S.F.; Nejentsev, S.; Walker, N.M.; Howson, J.M.M.; Godfrey, L.M.; Jolley, J.D.; Hardy, M.P.A.; Todd, J.A. Sequencing-Based Genotyping and Association Analysis of the MICA and MICB Genes in Type 1 Diabetes. Diabetes 2008, 57, 1753–1756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nejentsev, S.; Gombos, Z.; Laine, A.P.; Veijola, R.; Knip, M.; Simell, O.; Vaarala, O.; Åkerblom, H.K.; Ilonen, J. Non-Class II HLA Gene Associated with Type 1 Diabetes Maps to the 240-Kb Region near HLA-B. Diabetes 2000, 49, 2217–2221. [Google Scholar] [CrossRef] [PubMed]
- Patterson, C.C.; Karuranga, S.; Salpea, P.; Saeedi, P.; Dahlquist, G.; Soltesz, G.; Ogle, G.D. Worldwide Estimates of Incidence, Prevalence and Mortality of Type 1 Diabetes in Children and Adolescents: Results from the International Diabetes Federation Diabetes Atlas, 9th Edition. Diabetes Res. Clin. Pract. 2019, 157, 107842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Medical Association. World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research Involving Human Subjects. JAMA 2013, 310, 2191–2194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khamees, M.; Jarrar, Y.; Al-Qirim, T.; Mahmoud, I.S.; Hatmal, M.M.; Alshaer, W.; Lee, S.-J. No Impact of Soluble Epoxide Hydrolase Rs4149243, Rs2234914 and Rs751142 Genetic Variants on the Development of Type II Diabetes and Its Hypertensive Complication among Jordanian Patients. Int. J. Clin. Pract. 2021, 75, e14036. [Google Scholar] [CrossRef]
- Szumilas, M. Explaining Odds Ratios. J. Can. Acad. Child. Adolesc. Psychiatry 2010, 19, 227–229. [Google Scholar]
- Rueda, B.; Pascual, M.; López-Nevot, M.A.; González, E.; Martín, J. A New Allele within the Transmembrane Region of the Human MICA Gene with Seven GCT Repeats. Tissue Antigens 2002, 60, 526–528. [Google Scholar] [CrossRef]
- Bratanic, N.; Smigoc Schweiger, D.; Mendez, A.; Bratina, N.; Battelino, T.; Vidan-Jeras, B. An Influence of HLA-A, B, DR, DQ, and MICA on the Occurrence of Celiac Disease in Patients with Type 1 Diabetes. Tissue Antigens 2010, 76, 208–215. [Google Scholar] [CrossRef]
- Kawabata, Y.; Ikegami, H.; Kawaguchi, Y.; Fujisawa, T.; Hotta, M.; Ueda, H.; Shintani, M.; Nojima, K.; Ono, M.; Nishino, M.; et al. Age-Related Association of MHC Class I Chain-Related Gene A (MICA) with Type 1 (Insulin-Dependent) Diabetes Mellitus. Hum. Immunol. 2000, 61, 624–629. [Google Scholar] [CrossRef]
- Gupta, M.; Nikitina-Zake, L.; Zarghami, M.; Landin-Olsson, M.; Kockum, I.; Lernmark, Å.; Sanjeevi, C.B. Association between the Transmembrane Region Polymorphism of MHC Class I Chain Related Gene-A and Type 1 Diabetes Mellitus in Sweden. Hum. Immunol. 2003, 64, 553–561. [Google Scholar] [CrossRef]
- Zake, L.N.; Ghaderi, M.; Park, Y.S.; Babu, S.; Eisenbarth, G.; Sanjeevi, C.B. MHC Class I Chain-Related Gene Alleles 5 and 5.1 Are Transmitted More Frequently to Type 1 Diabetes Offspring in HBDI Families. Ann. N. Y. Acad. Sci. 2002, 958, 309–311. [Google Scholar] [CrossRef] [PubMed]
- Shtauvere-Brameus, A.; Ghaderi, M.; Rumba, I.; Sanjeevi, C.B. Microsatellite Allele 5 of MHC Class I Chain-Related Gene a Increases the Risk for Insulin-Dependent Diabetes Mellitus in Latvians. Ann. N. Y. Acad. Sci. 2002, 958, 349–352. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Huang, F.Y.; Wang, C.H.; Lo, F.S.; Tsan, K.W.; Hsu, C.H.; Huang, C.Y.; Chang, S.C.; Chang, J.G. Polymorphism in the Transmembrane Region of the MICA Gene and Type 1 Diabetes. J. Pediatr. Endocrinol. Metab. 2000, 13, 489–496. [Google Scholar] [CrossRef] [PubMed]
Parameters | Controls (n = 51) | T1D Patients (n = 55) |
---|---|---|
Age (years) (mean ± SD) | 28.7 ± 6.5 | 20.2 ± 9.4 |
Male n (%) | 32 (62.7%) | 19 (34.5%) |
Female n (%) | 19 (37.3%) | 36 (65.5%) |
Age of disease onset (years) (mean ± SD) | - | 10.1 ± 7.4 |
Primer Name | Forward Primer | Reverse Primer |
---|---|---|
MICA_1 | AAGGTTGGGACAGCAGACC | TTTCCCAGGACATCTTCTGCC |
MICA_2 | GGCAGAAATGCAGGGCAAAG | GCTCTCTGCCCCTAACTTTTCT |
MICA_4 | GCACTCAGCCCACACAGG | GTTTTGGGAGAGGAAGAGCT |
MICA_5 | CCAGGAGCTCCCAGCATTTC | AGATATCGCCGTAGTTCCTGC |
MICA_6 | ACCAAGACACACTATCACGCT | ATCAGGACACGATGTGCCAA |
MICA_9 | CCTGCCAGCCTGGAAGAAC | AAGCCCTGCATGTCACGG |
MICA_10 | TGCCCTTTCTTCTCCAGTGC | GTTCCATGTAGCAGGTGAACC |
MICA_11 | TGCCTGATGGGAATGGAACC | GACTCTGAAGCACCAGCACT |
MICA_exon5 | TGCTGGTGCTTCAGAGTCATT | TTACCATCTCCAGAAACTGCCCG |
Alleles (Exons 2–4) | Control (n = 102) n (%) | T1D (n = 110) n (%) | p Value | OR | 95% CI |
---|---|---|---|---|---|
MICA*001 | 1 (1%) | 0 (0%) | 0.470 | 0.306 | 0.012–7.602 |
MICA*002 | 11 (10.8%) | 15 (13.6%) | 0.527 | 1.306 | 0.570–2.994 |
MICA*004 | 17 (16.7%) | 12 (10.9%) | 0.223 | 0.612 | 0.277–1.354 |
MICA*006 | 2 (2%) | 1 (0.9%) | 0.517 | 0.459 | 0.041–5.137 |
MICA*007 | 2 (2%) | 0 (0%) | 0.273 | 0.182 | 0.009–3.835 |
MICA*008 | 11 (10.8%) | 15 (13.6%) | 0.527 | 1.306 | 0.570–2.994 |
MICA*009 | 15 (14.7%) | 26 (23.6%) | 0.100 | 1.795 | 0.889–3.625 |
MICA*011 | 7 (6.9%) | 1 (0.9%) | 0.023 * | 0.125 | 0.015–1.030 |
MICA*012 | 2 (2%) | 0 (0%) | 0.273 | 0.182 | 0.009–3.835 |
MICA*016 | 8 (7.8%) | 5 (4.5%) | 0.317 | 0.560 | 0.177–1.770 |
MICA*017 | 2 (2%) | 0 (0%) | 0.273 | 0.182 | 0.009–3.835 |
MICA*018 | 7 (6.9%) | 9 (8.2%) | 0.716 | 1.209 | 0.433–3.376 |
MICA*019 | 2 (2%) | 2 (1.8%) | 0.939 | 0.926 | 0.128–6.698 |
MICA*020 | 8 (7.8%) | 9 (8.2%) | 0.928 | 1.047 | 0.388–2.826 |
MICA*023 | 0 (0%) | 1 (0.9%) | 0.529 | 2.808 | 0.113–69.723 |
MICA*024 | 1 (1%) | 2 (1.8%) | 0.606 | 1.870 | 0.167–20.944 |
MICA*027 | 1 (1%) | 3 (2.7%) | 0.350 | 2.832 | 0.290–27.670 |
MICA*030 | 0 (0%) | 1 (0.9%) | 0.529 | 2.808 | 0.113–69.723 |
MICA*038 | 1 (1%) | 0 (0%) | 0.470 | 0.306 | 0.012–7.602 |
MICA*057 | 4 (3.6%) | 4 (3.6%) | 0.913 | 0.925 | 0.225–3.798 |
MICA*072 | 0 (0%) | 1 (0.9%) | 0.529 | 2.808 | 0.113–69.723 |
MICA*075 | 0 (0%) | 1 (0.9%) | 0.529 | 2.808 | 0.113–69.723 |
MICA*080 | 0 (0%) | 1 (0.9%) | 0.529 | 2.808 | 0.113–69.723 |
MICA*086 | 0 (0%) | 1 (0.9%) | 0.529 | 2.808 | 0.113–69.723 |
Genotype (Exons 2–4) | Control (n = 51) n (%) | T1D (n = 55) n (%) | p Value | OR | 95% CI |
---|---|---|---|---|---|
*001/*004 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*002/*002 | 1 (2%) | 1 (1.8%) | 0.957 | 0.926 | 0.056–15.202 |
*002/*004 | 1 (2%) | 2 (3.6%) | 0.603 | 1.887 | 0.166–21.461 |
*002/*006 | 1 (2%) | 1 (1.8%) | 0.957 | 0.926 | 0.056–15.202 |
*002/*008 | 1 (2%) | 3 (5.5%) | 0.346 | 2.885 | 0.290–28.663 |
*002/*009 | 0 (0%) | 2 (3.6%) | 0.314 | 4.813 | 0.226–102.6 |
*002/*011 | 2 (3.9%) | 0 (0%) | 0.270 | 0.178 | 0.008–3.806 |
*002/*017 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*002/*018 | 2 (3.9%) | 1 (1.8%) | 0.514 | 0.454 | 0.040–5.161 |
*002/*020 | 0 (0%) | 2 (3.6%) | 0.314 | 4.813 | 0.226–102.6 |
*002/*057 | 1 (2%) | 1 (1.8%) | 0.957 | 0.926 | 0.056–15.202 |
*002/*086 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*004/*004 | 2 (3.9%) | 2 (3.6%) | 0.939 | 0.925 | 0.125–6.818 |
*004/*006 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*004/*008 | 2 (3.9%) | 1 (1.8%) | 0.514 | 0.454 | 0.040–5.161 |
*004/*009 | 3 (5.9%) | 3 (5.5%) | 0.924 | 0.923 | 0.178–4.795 |
*004/*016 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*004/*020 | 3 (5.9%) | 1 (1.8%) | 0.273 | 0.296 | 0.030–2.944 |
*004/*027 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*007/*007 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*008/*008 | 1 (2%) | 3 (5.5%) | 0.346 | 2.885 | 0.290–28.663 |
*008/*009 | 3 (5.9%) | 2 (3.6%) | 0.586 | 0.604 | 0.097–3.769 |
*008/*011 | 2 (3.9%) | 0 (0%) | 0.270 | 0.178 | 0.008–3.806 |
*008/*016 | 0 (0%) | 2 (3.6%) | 0.314 | 4.813 | 0.226–102.6 |
*008/*018 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*009/*009 | 2 (3.9%) | 4 (7.3%) | 0.456 | 1.922 | 0.337–10.971 |
*009/*011 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*009/*016 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*009/*018 | 1 (2%) | 1 (1.8%) | 0.957 | 0.926 | 0.056–15.202 |
*009/*020 | 2 (3.9%) | 2 (3.6%) | 0.939 | 0.925 | 0.125–6.818 |
*009/*023 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*009/*030 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*009/*057 | 1 (2%) | 3 (5.5%) | 0.346 | 2.885 | 0.290–28.663 |
*009/*072 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*011/*004 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*011/*016 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*011/*018 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*012/*012 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*016/*016 | 1 (2%) | 1 (1.8%) | 0.957 | 0.926 | 0.056–15.202 |
*016/*018 | 1 (2%) | 1 (1.8%) | 0.957 | 0.926 | 0.056–15.202 |
*016/*019 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*016/*027 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*017/*024 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*018/*018 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*018/*019 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*018/*020 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*018/*024 | 0 (0%) | 2 (3.6%) | 0.314 | 4.813 | 0.226–102.6 |
*018/*075 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*019/*020 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*019/*080 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*020/*008 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*020/*020 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*020/*038 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
*027/*027 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
*057/*057 | 1 (2%) | 0 (0%) | 0.468 | 0.303 | 0.012–7.616 |
Alleles (Exon 5) | Control (n = 102) n (%) | T1D (n = 110) n (%) | p Value | OR | 95% CI |
---|---|---|---|---|---|
A4 | 10 (9.8%) | 10 (9.1%) | 0.895 | 0.920 | 0.366–2.311 |
A5 | 8 (7.8%) | 13 (11.8%) | 0.333 | 1.575 | 0.624–3.972 |
A5.1 | 16 (15.7%) | 14 (12.7%) | 0.537 | 0.784 | 0.361–1.700 |
A6 | 50 (49%) | 50 (45.5%) | 0.603 | 0.867 | 0.505–1.487 |
A9 | 16 (15.7%) | 14 (12.7%) | 0.537 | 0.784 | 0.361–1.700 |
Genotype (Exon 5) | Control (n = 51) n (%) | T1D (n = 55) n (%) | p Value | OR | 95% CI |
---|---|---|---|---|---|
A4/A4 | 2 (3.9%) | 1 (1.8%) | 0.514 | 0.454 | 0.040–5.161 |
A4/A5 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
A4/A5.1 | 1 (2%) | 3 (5.5%) | 0.346 | 2.885 | 0.290–28.663 |
A4/A6 | 4 (7.8%) | 2 (3.6%) | 0.349 | 0.443 | 0.078–2.532 |
A4/A9 | 1 (2%) | 2 (3.6%) | 0.603 | 1.887 | 0.166–21.461 |
A5/A5 | 1 (2%) | 2 (3.6%) | 0.603 | 1.877 | 0.166–21.461 |
A5/A5.1 | 2 (3.9%) | 4 (7.3%) | 0.456 | 1.922 | 0.337–10.971 |
A5/A6 | 4 (7.8%) | 4 (7.3%) | 0.912 | 0.922 | 0.218–3.895 |
A5/A9 | 0 (0%) | 1 (1.8%) | 0.526 | 2.835 | 0.113–71.182 |
A5.1/A5.1 | 1 (2%) | 2 (3.6%) | 0.603 | 1.877 | 0.166–21.461 |
A5.1/A6 | 10 (19.6%) | 9 (16.4%) | 0.663 | 0.802 | 0.297–2.168 |
A5.1/A9 | 3 (5.9%) | 3 (5.5%) | 0.924 | 0.923 | 0.178–4.795 |
A6/A6 | 13 (25.5%) | 14 (25.5%) | 0.997 | 0.998 | 0.416–2.393 |
A6/A9 | 6 (11.8%) | 6 (10.9%) | 0.890 | 0.918 | 0.276–3.054 |
A9/A9 | 3 (5.9%) | 1 (1.8%) | 0.273 | 0.296 | 0.030–2.944 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jarrar, W.; Khdair, S.I.; Khudeir, F.A. MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study. Life 2022, 12, 1813. https://doi.org/10.3390/life12111813
Jarrar W, Khdair SI, Khudeir FA. MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study. Life. 2022; 12(11):1813. https://doi.org/10.3390/life12111813
Chicago/Turabian StyleJarrar, Wassan, Sawsan I. Khdair, and Feras A. Khudeir. 2022. "MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study" Life 12, no. 11: 1813. https://doi.org/10.3390/life12111813