Next Article in Journal
Construction and Comprehensive Analysis of miRNAs and Target mRNAs in Longissimus dorsi Muscle of Queshan Black and Large White Pigs
Previous Article in Journal
Multiple Functions of MiRNAs in Brassica napus L.
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 12
Issue 11
10.3390/life12111813
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study

by
Wassan Jarrar
1,*,
Sawsan I. Khdair
1 and
Feras A. Khudeir
2
1
Department of Pharmacy, Faculty of Pharmacy, Al-Zaytoonah University of Jordan, Amman 11733, Jordan
2
Jordanian Royal Medical Services, Amman 11855, Jordan
*
Author to whom correspondence should be addressed.
Life 2022, 12(11), 1813; https://doi.org/10.3390/life12111813
Submission received: 18 October 2022 / Revised: 2 November 2022 / Accepted: 3 November 2022 / Published: 7 November 2022
(This article belongs to the Section Medical Research)
Versions Notes

Abstract

:
Type 1 diabetes (T1D) is an autoimmune disorder whose etiology includes genetic and environmental factors. The non-classical Major Histocompatibility Complex (MHC) class I chain-related gene A (MICA) gene has been associated with increased susceptibility to T1D as the interaction of MICA to the Natural Killer Group 2D (NK2GD) receptors found on the cell surface of natural killer (NK) cells and T cells is responsible for inducing immune responses. MICA polymorphisms were reported in association with T1D among different ethnic groups. However, data from different populations revealed conflicting results, so the association of MICA polymorphisms with predisposition to T1D remains uncertain. The aim of this sequencing-based study was to identify, for the first time, the possible MICA alleles and/or genotypes that could be associated with T1D susceptibility in the Jordanian population. Polymorphisms in exons 2–4 and the short tandem repeats (STR) in exon 5 of the highly polymorphic MICA gene were analyzed. No evidence for association between T1D and MICA alleles/genotypes was found in this study, except for the MICA*011 allele which was found to be negatively associated with T1D (p = 0.023, OR = 0.125). In conclusion, MICA polymorphisms seem not to be associated with increasing T1D susceptibility in Jordanian patients.

1. Introduction

Type 1 diabetes (T1D) is an autoimmune disease which results from autoreactive immune cells destructing pancreatic β-cells [1]. T1D incidence among the world varies drastically and its prevalence in Arab countries is relatively high [2]. As far as we know, the prevalence and incidence of T1D in Jordan remains underreported. Development of T1D is induced by the complex interaction of several susceptibility genes in addition to environmental factors [1]. Human leukocyte antigen (HLA) genes play a pivotal role in autoimmune diseases [3]. In particular, the major genetical risk for developing T1D is conferred by HLA class II genes as individuals with the DR3-DQ2/DR4-DQ8 haplotypes were shown to have the highest risk of developing T1D in different ethnic populations even in Jordanian T1D patients [1,4,5,6,7]. Yet, numerous studies suggest a possible role of other genes which are included in the HLA region in predisposition to T1D [8,9,10,11,12]. Particularly, the non-classical Major Histocompatibility Complex (MHC) class I chain-related gene A (MICA) has been associated with increasing predisposition to T1D [13,14,15,16,17,18,19]. MICA gene is considered one of the functional HLA class I genes [20]. MICA gene encodes a protein that is basically expressed in endothelial cells, gastrointestinal epithelium, as well as fibroblasts and whose expression is induced under stress conditions [21,22,23]. MICA protein serves as a ligand of Natural Killer Group 2D (NKG2D) receptors, which are found on the surface of natural killer (NK) as well as CD8+ T cells leading to the activation of these cells which are known to play a major role in the pathogenesis of T1D [22,24,25,26,27,28,29]. MICA is composed of six exons and five introns and is considered the most polymorphic non-classical class I gene [21]. Actually, 198 alleles of the human MICA gene have been recognized thus far according to the IMGT/HLA database; June 2022 [30,31]. There are several genetic variations within exons 2–4 of the MICA gene which encode the three extracellular domains of the MICA protein (α1, α2, and α3) which are recognizable by the NKG2D receptor. Accordingly, studies that analyzed the binding sites of MICA and NKG2D receptor suggest that the polymorphic sites located in exons 2–4 might influence the binding of MICA to its receptor [32,33]. In addition, the transmembrane region (TM) of the MICA protein, which is encoded by exon 5 of the MICA gene, was also found to be highly polymorphic. This so-called trinucleotide repeat microsatellite polymorphism (GCT)n consists of eight alleles; A4, A5, A6, A7, A8, A9, A10, and A5.1, and the names of these alleles were designated according to the number of repetitions of GCT nucleotides that these alleles possess [20,21,34,35,36,37,38].
To ascertain the relation of MICA with the predisposition to T1D, association studies were performed to determine T1D-related MICA alleles among different ethnic groups. However, data from different ethnic groups revealed controversial results [13,14,15,16,17,39,40,41,42,43]. To date, MICA alleles and genotypes that play a role in T1D susceptibility in the Jordanian population remain to be determined. Therefore, the aim of this study was to investigate for the first time the association of specific MICA alleles and genotypes with susceptibility to T1D in the Jordanian population taking into consideration both the polymorphisms in exons 2–4 as well as the short tandem repeats (STR) located in exon 5 of the MICA gene.

2. Materials and Methods

2.1. Study Population

This study included 106 Jordanian participants: 51 healthy unrelated volunteers and 55 T1D patients (Pediatric Endocrinology department of King Abdullah University Hospital). Clinical parameters of the volunteers are listed in Table 1. Regarding gender distribution, both studied groups were not fully matched. However, no previous studies reported gender differences in regard to MICA allele association [13,14,15,16,40]. Inclusion criteria for T1D patients in this study were a clinical onset of the disease before 18 years of age as well as a diagnosis based on the criteria of American Diabetes Association (ADA) guidelines. Moreover, the mean age of disease onset in T1D patients was 10.1 ± 7.4 years. Furthermore, healthy volunteers with a family history of diabetes were not included in this study and all controls were above 20 years old [44]. All participants were of Jordanian descent. Ethical approval (IRB approval number: 46/117/2018) was provided by the institutional review board of King Abdullah University Hospital. An informed consent was signed prior to enrollment, in accordance with the declaration of Helsinki [45].

2.2. DNA Extraction and MICA Genotyping

DNA was isolated from blood as described previously [46]. Typing of exons 2–4 as well as exon 5 of the MICA gene was performed using amplicon sequencing (Miseq Illumina platform). Primers designed to amplify exons 2 to 4 as well as exon 5 of the MICA gene are summarized in Table 2. After amplifying regions of interest in the MICA gene, next-generation sequencing (NGS) was completed by Genochem World SL. (Valencia, Spain). Capillary electrophoresis using the QIAxcel Advanced System (Qiagen, Barcelona, Spain) was performed to evaluate the quality of PCR products and the MiSeq Reagent Kit v2 (500-cycle) was utilized for sequencing.

2.3. Determination of Allele Frequency and Statistical Analysis

Direct counting was used to determine allele frequencies. MICA alleles and genotypes frequencies among T1D and control groups were compared using chi-squared test (χ2). The p value was considered significant when p value ≤ 0.05. Odds ratio (OR) calculation was performed as described previously [47] with a confidence interval (CI) of 95%. We conducted statistical analysis using the SPSS program (IBM analytics, Armonk, NY, USA).

3. Results

Sequencing results of exons 2–4 of the MICA gene revealed the presence of 24 different MICA alleles among the study group (both control and T1D groups) (Table 3). The most prevalent allele in the T1D patients’ group was MICA*009 with a frequency of 23.6%, followed by MICA*008, MICA*002, and MICA*004 with a frequency of 13.6%, 13.6%, and 10.9%, respectively. Nevertheless, the frequencies of most alleles in the T1D patient group were found to be comparable, with no significant differences, to the healthy control group. However, the only allele with a significant difference (p = 0.023, OR = 0.125, CI = 0.015–1.030) in frequency between the control and T1D patient group was MICA*011, with a frequency of 6.9% in controls and a lower allelic frequency in T1D patients’ group (0.9%).
A wide variety of genotypes (55 different genotypes) have been identified among the study groups (Table 4). The genotype with the highest frequency in the T1D patients’ group was MICA*009/*009 (7.3%). Furthermore, MICA*002/*008, MICA*004/*009, MICA*008/*008, and MICA*009/*057 had a frequency of 5.5% in the T1D patients’ group. Whereas the rest of the genotypes (the majority) observed in the T1D patients’ group had a frequency of 3.6% or below, which is probably due to the high genotypic diversity identified in the study group. Nevertheless, although the frequency of the MICA*009/*009 genotype was higher in the T1D patients’ group (7.3%) in comparison to the control group (3.9%), this difference did not reach statistical significance (p = 0.456). No significant differences in frequency among all examined genotypes were detected between the two studied groups.
Analysis of the STR polymorphism alleles (exon 5) of the MICA gene revealed only five different alleles in our Jordanian study group (healthy control and T1D patients); A4, A5, A6, A9, and A5.1 (Table 5), while the remaining alleles which are considered rare alleles were not detected in our study sample [38,48]. Furthermore, A6 allele (45.5%) was the most frequent MICA allele found in the T1D patients’ group, followed by A5.1 (12.7%), A9 (12.7%), A5 (11.8%), and A4 (9.1%). However, results showed no statistically significant differences in the frequency of all five STR alleles between the Jordanian T1D patients’ group and control group.
Fifteen different genotypes of exon 5 of the MICA gene among our study groups (control and T1D groups) were observed (Table 6). Genotypes with the highest frequency among the T1D patients’ group were A6/A6 (25.5%), A5.1/A6 (16.4%), and A6/A9 (10.9%). However, no significant differences in frequency among genotypes between the control and T1D patients’ groups were detected.

4. Discussion

Considering MICA as a candidate gene for susceptibility to T1D is noteworthy because of its potential role in triggering autoimmune responses through its interaction with the NK2GD receptor [27,28,29], as well as its high level of polymorphism [21]. Data from studies performed on Italian [13], Korean [14], Belgian [15], Dutch [16], Spanish Basque [18], U.S. [39], African American [40], Nigerian [40], Australian [41], Slovenian [49], Japanese [50], Swedish [51,52], Latvian [53], and Chinese [54] populations examining the relation of MICA alleles and/or genotypes to T1D susceptibility revealed controversial results. However, to our best knowledge, this is the first study to examine the association of MICA polymorphisms with T1D in the Jordanian population. Polymorphisms in exons 2–4 as well as exon 5 (STR polymorphisms) of the MICA gene were analyzed in this study using a highly accurate genotyping method, namely the NGS method.
Data about the role of MICA gene polymorphisms in exons 2–4 in T1D pathogenesis remain sparse among populations. However, our results revealed no association between MICA polymorphisms and T1D susceptibility among Jordanian patients. Only two studies investigated their association with T1D, and our findings were similar to those reported by these studies performed on populations in the UK and Slovenia [42,49]. Nevertheless, the only significant difference between the control and T1D patient groups was for MICA*011 (p = 0.023), with a frequency of 6.9% in controls and a lower allelic frequency in T1D patients’ group (0.9%). On the contrary, most previous studies concentrated on studying the association of STR polymorphisms in exon 5 of the MICA gene with T1D and their findings were debatable. Regarding the STR polymorphisms in exon 5 of the MICA gene in our Jordanian T1D patients, our findings revealed no statistically significant differences in the frequency of all STR alleles between the Jordanian T1D patients’ group and control group. Our results are in accordance with the findings of studies performed in Australia [41], Finland [43], and the UK [42], which also showed no association between STR alleles and predisposition to T1D. On the contrary, studies performed in different populations identified different STR alleles as potential susceptibility factors for T1D development. The Korean and Japanese population identified A4 as a risk and A6 as a protective allele for T1D susceptibility [14,50]. On the other hand, a study performed in the Netherlands identified A5 as a risk allele and A6 as a protective allele for T1D [16]. Furthermore, studies performed in Sweden identified A5 [51] and A5.1 [52] as risk alleles and A6 as a protective allele for T1D [51]. Moreover, studies in the Italian, Belgian, and Latvian populations identified A5 as a risk factor for T1D development [13,15,53]. In addition, studies performed on Belgian as well as Spanish Basque volunteers identified A9 as a protective allele against T1D [15,18] while another study performed on Chinese volunteers identified A9 as a risk allele for T1D development [54]. Nevertheless, these controversial results refer to genetic diversity among different populations. The sample size of this study may be considered as a limitation. However, the number of patients included in this study represents all the T1D patients registered at the pediatric section at that the time of sample collection. We also acknowledge that another limitation of the study is the variation in gender distribution among the studied groups, but no studies regarding MICA allele association mentioned differences between males and females [13,14,15,16,40].

5. Conclusions

None of the MICA alleles and genotypes was observed to be positively associated with susceptibility to T1D in Jordanian patients. Nevertheless, only one negative association with T1D was detected in our population, namely the MICA*011 allele. Our study ascertains that different MICA alleles and genotypes seem to have no role in the pathogenesis of T1D in Jordanian patients. Nevertheless, analysis of additional candidate risk genes needs to be undertaken to clarify the contribution of these genes to the susceptibility to T1D. All in all, identifying possible risk genes might aid in developing an approach for screening these genetic markers associated with T1D in individuals in order to recognize individuals at risk for developing T1D. Nevertheless, early identification of individuals at risk of T1D development might help in prevention or at least delay of T1D disease onset.

Author Contributions

Conceptualization, W.J.; methodology, S.I.K. and F.A.K.; formal analysis, W.J.; data curation, S.I.K.; writing—original draft preparation, W.J. and S.I.K.; writing—review and editing, W.J. and S.I.K.; funding acquisition, W.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Al-Zaytoonah University of Jordan, grant number [26/8/2021–2022].

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Board of King Abdullah University Hospital (approval number: 46/117/2018).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data are available from the corresponding authors upon request.

Acknowledgments

We thank the volunteers for taking part in this study. We are also grateful to Alaa Hammad for her assistance in statistical analysis. We as well thank Al-Genome Medical Company “Cgenomix” (Jordan) and Genochem World SL. (Spain) for their technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pociot, F.; Lernmark, Å. Genetic Risk Factors for Type 1 Diabetes. Lancet 2016, 387, 2331–2339. [Google Scholar] [CrossRef]
  2. Zayed, H. Genetic Epidemiology of Type 1 Diabetes in the 22 Arab Countries. Curr. Diab. Rep. 2016, 16, 37. [Google Scholar] [CrossRef] [PubMed]
  3. Howson, J.M.M.; Stevens, H.; Smyth, D.J.; Walker, N.M.; Chandler, K.A.; Bingley, P.J.; Todd, J.A. Evidence That HLA Class I and II Associations with Type 1 Diabetes, Autoantibodies to GAD and Autoantibodies to IA-2, Are Distinct. Diabetes 2011, 60, 2635–2644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Khdair, S.I.; Jarrar, W.; Jarrar, Y.B.; Bataineh, S.; Al-Khaldi, O. Association of HLA-DRB1 and –DQ Alleles and Haplotypes with Type 1 Diabetes in Jordanians. Endocr. Metab. Immune Disord.-Drug Targets 2020, 20, 895–902. [Google Scholar] [CrossRef] [PubMed]
  5. Hamzeh, A.R.; Nair, P.; Al Ali, M.T. The Profile of HLA-DRB1 Alleles in Arabs with Type 1 Diabetes; Meta-Analyses. Hla 2016, 87, 25–30. [Google Scholar] [CrossRef]
  6. Hamzeh, A.R.; Nair, P.; Al-Khaja, N.; Al Ali, M.T. Association of HLA-DQA1 and -DQB1 Alleles with Type I Diabetes in Arabs: A Meta-Analyses. Tissue Antigens 2015, 86, 21–27. [Google Scholar] [CrossRef]
  7. Erlich, H.; Valdes, A.M.; Noble, J.; Carlson, J.A.; Varney, M.; Concannon, P.; Mychaleckyj, J.C.; Todd, J.A.; Bonella, P.; Fear, A.L.; et al. HLA DR-DQ Haplotypes and Genotypes and Type 1 Diabetes Risk: Analysis of the Type 1 Diabetes Genetics Consortium Families. Diabetes 2008, 57, 1084–1092. [Google Scholar] [CrossRef] [Green Version]
  8. She, J.-X.; Marron, M.P. Genetic Susceptibility Factors in Type 1 Diabetes: Linkage, Disequilibrium and Functional Analyses. Curr. Opin. Immunol. 1998, 10, 682–689. [Google Scholar] [CrossRef]
  9. Moghaddam, P.H.; De Knijf, P.; Roep, B.O.; Van der Auwera, B.; Naipal, A.; Gorus, F.; Schuit, F.; Giphart, M.J. Genetic Structure of IDDM1: Two Separate Regions in the Major Histocompatibility Complex Contribute to Susceptibility or Protection. Diabetes 1998, 47, 263–269. [Google Scholar] [CrossRef]
  10. Blomhoff, A.; Olsson, M.; Johansson, S.; Akselsen, H.E.; Pociot, F.; Nerup, J.; Kockum, I.; Cambon-Thomsen, A.; Thorsby, E.; Undlien, D.E.; et al. Linkage Disequilibrium and Haplotype Blocks in the MHC Vary in an HLA Haplotype Specific Manner Assessed Mainly by DRB1*03 and DRB104* Haplotypes. Genes Immun. 2006, 7, 130–140. [Google Scholar] [CrossRef]
  11. Zavattari, P.; Lampis, R.; Motzo, C.; Loddo, M.; Mulargia, A.; Whalen, M.; Maioli, M.; Angius, E.; Todd, J.A.; Cucca, F. Conditional Linkage Disequilibrium Analysis of a Complex Disease Superlocus, IDDM1 in the HLA Region, Reveals the Presence of Independent Modifying Gene Effects Influencing the Type 1 Diabetes Risk Encoded by the Major HLA-DBQ1, -DRB1 Disease Loci. Hum. Mol. Genet. 2001, 10, 881–889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Undlien, D.E.; Lie, B.A.; Thorsby, E. HLA Complex Genes in Type 1 Diabetes and other autoimmune diseases. Which Genes Are Involved? Trends Genet. 2001, 17, 93–100. [Google Scholar] [CrossRef]
  13. Gambelunghe, G.; Ghaderi, M.; Cosentino, A.; Falorni, A.; Brunetti, P.; Falorni, A.; Sanjeevi, C.B. Association of MHC Class I Chain-Related A (MIC-A) Gene Polymorphism with Type I Diabetes. Diabetologia 2000, 43, 507–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Park, Y.; Lee, H.; Sanjeevi, C.B.; Eisenbarth, G.S. MICA Polymorphism Is Associated with Type 1 Diabetes in the Korean Population. Diabetes Care 2001, 24, 33–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Van Autreve, J.E.; Koeleman, B.P.C.; Quartier, E.; Aminkeng, F.; Weets, I.; Gorus, F.K.; Van der Auwera, B.J.R. MICA Is Associated with Type 1 Diabetes in the Belgian Population, Independent of HLA-DQ. Hum. Immunol. 2006, 67, 94–101. [Google Scholar] [CrossRef]
  16. Alizadeh, B.Z.; Eerligh, P.; van der Slik, A.R.; Shastry, A.; Zhernakova, A.; Valdigem, G.; Bruining, J.G.; Sanjeevi, C.B.; Wijmenga, C.; Roep, B.O.; et al. MICA Marks Additional Risk Factors for Type 1 Diabetes on Extended HLA Haplotypes: An Association and Meta-Analysis. Mol. Immunol. 2007, 44, 2806–2812. [Google Scholar] [CrossRef]
  17. Gambelunghe, G.; Brozzetti, A.; Ghaderi, M.; Candeloro, P.; Tortoioli, C.; Falorni, A. MICA Gene Polymorphism in the Pathogenesis of Type 1 Diabetes. Ann. N. Y. Acad. Sci. 2007, 1110, 92–98. [Google Scholar] [CrossRef]
  18. Bilbao, J.R.; Martín-Pagola, A.; Calvo, B.; Perez De Nanclares, G.; Gepv-N; Castaño, L. Contribution of MIC-A Polymorphism to Type 1 Diabetes Mellitus in Basques. Ann. N. Y. Acad. Sci. 2002, 958, 321–324. [Google Scholar] [CrossRef]
  19. Frigoul, A.; Lefranc, M.-P. MICA: Standardized IMGT Allele Nomenclature, Polymorphisms and Diseases. Recent Res. Devel. Hum. Genet. 2005, 3, 95–145. [Google Scholar]
  20. Bahram, S. MIC Genes: From Genetics to Biology. Adv. Immunol. 2001, 76, 1–60. [Google Scholar] [CrossRef]
  21. Choy, M.K.; Phipps, M.E. MICA Polymorphism: Biology and Importance in Immunity and Disease. Trends Mol. Med. 2010, 16, 97–106. [Google Scholar] [CrossRef] [PubMed]
  22. Groh, V.; Bahram, S.; Bauer, S.; Herman, A.; Beauchamp, M.; Spies, T. Cell Stress-Regulated Human Major Histocompatibility Complex Class I Gene Expressed in Gastrointestinal Epithelium. Proc. Natl. Acad. Sci. USA 1996, 93, 12445–12450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Bauer, S.; Groh, V.; Wu, J.; Steinle, A.; Phillips, J.H.; Lanier, L.L.; Spies, T. Activation of NK Cells and T Cells by NKG2D, a Receptor for Stress-Inducible MICA. Science 1999, 285, 727–729. [Google Scholar] [CrossRef] [PubMed]
  24. Collins, R.W.M. Human MHC Class I Chain Related (MIC) Genes: Their Biological Function and Relevance to Disease and Transplantation. Eur. J. Immunogenet. 2004, 44, 105–114. [Google Scholar] [CrossRef]
  25. Borrego, F.; Kabat, J.; Kim, D.K.; Lieto, L.; Maasho, K.; Peña, J.; Solana, R.; Coligan, J.E. Structure and Function of Major Histocompatibility Complex (MHC) Class I Specific Receptors Expressed on Human Natural Killer (NK) Cells. Mol. Immunol. 2002, 38, 637–660. [Google Scholar] [CrossRef] [Green Version]
  26. Tsai, S.; Shameli, A.; Santamaria, P. CD8+ T Cells in Type 1 Diabetes. Advances in Immunology. 2008, 100, 79–124. [Google Scholar] [CrossRef]
  27. Zingoni, A.; Molfetta, R.; Fionda, C.; Soriani, A.; Paolini, R.; Cippitelli, M.; Cerboni, C.; Santoni, A. NKG2D and Its Ligands: “One for All, All for One”. Front. Immunol. 2018, 9, 476. [Google Scholar] [CrossRef]
  28. Caillat-Zucman, S. How NKG2D Ligands Trigger Autoimmunity? Hum. Immunol. 2006, 67, 204–207. [Google Scholar] [CrossRef]
  29. Sanjeevi, C.B. Genes Influencing Innate and Acquired Immunity in Type 1 Diabetes and Latent. Ann. N. Y. Acad. Sci. 2006, 80, 67–80. [Google Scholar] [CrossRef]
  30. Robinson, J.; Waller, M.J.; Parham, P.; Bodmer, J.G.; Marsh, S.G.E. IMGT/HLA Database—A Sequence Database for the Human Major Histocompatibility Complex. Nucleic Acids Res. 2001, 29, 210. [Google Scholar] [CrossRef] [Green Version]
  31. Anthony Nolan Research Institute. HLA. Available online: http://hla.alleles.org/alleles/classo.html (accessed on 28 September 2022).
  32. Stephens, H.A.F. MICA and MICB Genes: Can the Enigma of Their Polymorphism Be Resolved? Trends Immunol. 2001, 22, 378–385. [Google Scholar] [CrossRef]
  33. Li, P.; Morris, D.L.; Willcox, B.E.; Steinle, A.; Spies, T.; Strong, R.K. Complex Structure of the Activating Immunoreceptor NKG2D and Its MHC Class I-like Ligand MICA. Nat. Immunol. 2001, 2, 443–451. [Google Scholar] [CrossRef]
  34. Mizuki, N.; Ota, M.; Kimura, M.; Ohno, S.; Ando, H.; Katsuyama, Y.; Yamazaki, M.; Watanabe, K.; Goto, K.; Nakamura, S.; et al. Triplet Repeat Polymorphism in the Transmembrane Region of the MICA Gene: A Strong Association of Six GCT Repetitions with Behçet Disease. Proc. Natl. Acad. Sci. USA 1997, 94, 1298–1303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Ota, M.; Katsuyama, Y.; Mizuki, N.; Ando, H.; Furihata, K.; Ono, S.; Pivetti-Pezzi, P.; Tabbara, K.F.; Palimeris, G.D.; Nikbin, B.; et al. Trinucleotide Repeat Polymorphism within Exon 5 of the MICA Gene (MHC Class I Chain-Related Gene A): Allele Frequency Data in the Nine Population Groups Japanese, Northern Han, Hui, Uygur, Kazakhstan, Iranian, Saudi Arabian, Greek and Italian. Tissue Antigens 1997, 49, 448–454. [Google Scholar] [CrossRef] [PubMed]
  36. Vitiani, L.R.; Potolicchio, I.; D’Amato, M.; Baricordi, O.R.; Sorrentino, R. MICA Exon 5 Microsatellite Typing by DNA Heteroduplex Analysis: A New Polymorphism in the Transmembrane Region. Tissue Antigens 1998, 51, 309–311. [Google Scholar] [CrossRef]
  37. Gambelunghe, G.; Brozzetti, A.L.; Ghaderi, M.; Tortoioli, C.; Falorni, A. MICA A8: A New Allele within MHC Class I Chain-Related A Transmembrane Region with Eight GCT Repeats. Hum. Immunol. 2006, 67, 1005–1007. [Google Scholar] [CrossRef]
  38. Pérez-Rodríguez, M.; Corell, A.; Argüello, J.R.; Cox, S.T.; McWhinnie, A.; Marsh, S.G.E.; Madrigal, J.A. A New MICA Allele with Ten Alanine Residues in the Exon 5 Microsatellite. Tissue Antigens 2000, 55, 162–165. [Google Scholar] [CrossRef]
  39. Triolo, T.M.; Baschal, E.E.; Armstrong, T.K.; Toews, C.S.; Fain, P.R.; Rewers, M.J.; Yu, L.; Miao, D.; Eisenbarth, G.S.; Gottlieb, P.A.; et al. Homozygosity of the Polymorphism MICA5.1 Identifies Extreme Risk of Progression to Overt Adrenal Insufficiency among 21-Hydroxylase Antibody-Positive Patients with Type 1 Diabetes. J. Clin. Endocrinol. Metab. 2009, 94, 4517–4523. [Google Scholar] [CrossRef] [Green Version]
  40. Tian, W.; Boggs, D.A.; Uko, G.; Essiet, A.; Inyama, M.; Banjoko, B.; Adewole, T.; Ding, W.Z.; Mohseni, M.; Fritz, R.; et al. MICA, HLA-B Haplotypic Variation in Five Population Groups of Sub-Saharan African Ancestry. Genes Immun. 2003, 4, 500–505. [Google Scholar] [CrossRef] [Green Version]
  41. Allcock, R.; Cheong, K.; Christiansen, F.; Witt, C. Comment to: Gambelunghe, G., Ghaderi, Cosentino A et al. (2000) Association of MHC Class I Chain-Related A (MIC-A) Gene Polymorphism with Type I Diabetes. Diabetologia 43: 507–514. Diabetologia 2001, 44, 514–520. [Google Scholar]
  42. Field, S.F.; Nejentsev, S.; Walker, N.M.; Howson, J.M.M.; Godfrey, L.M.; Jolley, J.D.; Hardy, M.P.A.; Todd, J.A. Sequencing-Based Genotyping and Association Analysis of the MICA and MICB Genes in Type 1 Diabetes. Diabetes 2008, 57, 1753–1756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Nejentsev, S.; Gombos, Z.; Laine, A.P.; Veijola, R.; Knip, M.; Simell, O.; Vaarala, O.; Åkerblom, H.K.; Ilonen, J. Non-Class II HLA Gene Associated with Type 1 Diabetes Maps to the 240-Kb Region near HLA-B. Diabetes 2000, 49, 2217–2221. [Google Scholar] [CrossRef] [PubMed]
  44. Patterson, C.C.; Karuranga, S.; Salpea, P.; Saeedi, P.; Dahlquist, G.; Soltesz, G.; Ogle, G.D. Worldwide Estimates of Incidence, Prevalence and Mortality of Type 1 Diabetes in Children and Adolescents: Results from the International Diabetes Federation Diabetes Atlas, 9th Edition. Diabetes Res. Clin. Pract. 2019, 157, 107842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. World Medical Association. World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research Involving Human Subjects. JAMA 2013, 310, 2191–2194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Khamees, M.; Jarrar, Y.; Al-Qirim, T.; Mahmoud, I.S.; Hatmal, M.M.; Alshaer, W.; Lee, S.-J. No Impact of Soluble Epoxide Hydrolase Rs4149243, Rs2234914 and Rs751142 Genetic Variants on the Development of Type II Diabetes and Its Hypertensive Complication among Jordanian Patients. Int. J. Clin. Pract. 2021, 75, e14036. [Google Scholar] [CrossRef]
  47. Szumilas, M. Explaining Odds Ratios. J. Can. Acad. Child. Adolesc. Psychiatry 2010, 19, 227–229. [Google Scholar]
  48. Rueda, B.; Pascual, M.; López-Nevot, M.A.; González, E.; Martín, J. A New Allele within the Transmembrane Region of the Human MICA Gene with Seven GCT Repeats. Tissue Antigens 2002, 60, 526–528. [Google Scholar] [CrossRef]
  49. Bratanic, N.; Smigoc Schweiger, D.; Mendez, A.; Bratina, N.; Battelino, T.; Vidan-Jeras, B. An Influence of HLA-A, B, DR, DQ, and MICA on the Occurrence of Celiac Disease in Patients with Type 1 Diabetes. Tissue Antigens 2010, 76, 208–215. [Google Scholar] [CrossRef]
  50. Kawabata, Y.; Ikegami, H.; Kawaguchi, Y.; Fujisawa, T.; Hotta, M.; Ueda, H.; Shintani, M.; Nojima, K.; Ono, M.; Nishino, M.; et al. Age-Related Association of MHC Class I Chain-Related Gene A (MICA) with Type 1 (Insulin-Dependent) Diabetes Mellitus. Hum. Immunol. 2000, 61, 624–629. [Google Scholar] [CrossRef]
  51. Gupta, M.; Nikitina-Zake, L.; Zarghami, M.; Landin-Olsson, M.; Kockum, I.; Lernmark, Å.; Sanjeevi, C.B. Association between the Transmembrane Region Polymorphism of MHC Class I Chain Related Gene-A and Type 1 Diabetes Mellitus in Sweden. Hum. Immunol. 2003, 64, 553–561. [Google Scholar] [CrossRef]
  52. Zake, L.N.; Ghaderi, M.; Park, Y.S.; Babu, S.; Eisenbarth, G.; Sanjeevi, C.B. MHC Class I Chain-Related Gene Alleles 5 and 5.1 Are Transmitted More Frequently to Type 1 Diabetes Offspring in HBDI Families. Ann. N. Y. Acad. Sci. 2002, 958, 309–311. [Google Scholar] [CrossRef] [PubMed]
  53. Shtauvere-Brameus, A.; Ghaderi, M.; Rumba, I.; Sanjeevi, C.B. Microsatellite Allele 5 of MHC Class I Chain-Related Gene a Increases the Risk for Insulin-Dependent Diabetes Mellitus in Latvians. Ann. N. Y. Acad. Sci. 2002, 958, 349–352. [Google Scholar] [CrossRef] [PubMed]
  54. Lee, Y.J.; Huang, F.Y.; Wang, C.H.; Lo, F.S.; Tsan, K.W.; Hsu, C.H.; Huang, C.Y.; Chang, S.C.; Chang, J.G. Polymorphism in the Transmembrane Region of the MICA Gene and Type 1 Diabetes. J. Pediatr. Endocrinol. Metab. 2000, 13, 489–496. [Google Scholar] [CrossRef] [PubMed]
Table
Table 1. Clinical parameters of the volunteers.
Table 1. Clinical parameters of the volunteers.
ParametersControls
(n = 51)		T1D Patients
(n = 55)
Age (years) (mean ± SD)28.7 ± 6.520.2 ± 9.4
Male n (%)32 (62.7%)19 (34.5%)
Female n (%)19 (37.3%)36 (65.5%)
Age of disease onset (years) (mean ± SD)-10.1 ± 7.4
Type 1 diabetes (T1D).
Table
Table 2. Primers utilized for amplifying exons 2–5 of the MICA gene.
Table 2. Primers utilized for amplifying exons 2–5 of the MICA gene.
Primer NameForward PrimerReverse Primer
MICA_1AAGGTTGGGACAGCAGACCTTTCCCAGGACATCTTCTGCC
MICA_2GGCAGAAATGCAGGGCAAAGGCTCTCTGCCCCTAACTTTTCT
MICA_4GCACTCAGCCCACACAGGGTTTTGGGAGAGGAAGAGCT
MICA_5CCAGGAGCTCCCAGCATTTCAGATATCGCCGTAGTTCCTGC
MICA_6ACCAAGACACACTATCACGCTATCAGGACACGATGTGCCAA
MICA_9CCTGCCAGCCTGGAAGAACAAGCCCTGCATGTCACGG
MICA_10TGCCCTTTCTTCTCCAGTGCGTTCCATGTAGCAGGTGAACC
MICA_11TGCCTGATGGGAATGGAACCGACTCTGAAGCACCAGCACT
MICA_exon5TGCTGGTGCTTCAGAGTCATTTTACCATCTCCAGAAACTGCCCG
Major Histocompatibility Complex (MHC) class I chain-related gene A (MICA).
Table
Table 3. Allele frequencies of exons 2–4 of the MICA gene among Jordanian T1D patients versus healthy controls.
Table 3. Allele frequencies of exons 2–4 of the MICA gene among Jordanian T1D patients versus healthy controls.
Alleles
(Exons 2–4)		Control (n = 102)
n (%)		T1D (n = 110)
n (%)		p ValueOR95% CI
MICA*0011 (1%)0 (0%)0.4700.3060.012–7.602
MICA*00211 (10.8%)15 (13.6%)0.5271.3060.570–2.994
MICA*00417 (16.7%)12 (10.9%)0.2230.6120.277–1.354
MICA*0062 (2%)1 (0.9%)0.5170.4590.041–5.137
MICA*0072 (2%)0 (0%)0.2730.1820.009–3.835
MICA*00811 (10.8%)15 (13.6%)0.5271.3060.570–2.994
MICA*00915 (14.7%)26 (23.6%)0.1001.7950.889–3.625
MICA*0117 (6.9%)1 (0.9%)0.023 *0.1250.015–1.030
MICA*0122 (2%)0 (0%)0.2730.1820.009–3.835
MICA*0168 (7.8%)5 (4.5%)0.3170.5600.177–1.770
MICA*0172 (2%)0 (0%)0.2730.1820.009–3.835
MICA*0187 (6.9%)9 (8.2%)0.7161.2090.433–3.376
MICA*0192 (2%)2 (1.8%)0.9390.9260.128–6.698
MICA*0208 (7.8%)9 (8.2%)0.9281.0470.388–2.826
MICA*0230 (0%)1 (0.9%)0.5292.8080.113–69.723
MICA*0241 (1%)2 (1.8%)0.6061.8700.167–20.944
MICA*0271 (1%)3 (2.7%)0.3502.8320.290–27.670
MICA*0300 (0%)1 (0.9%)0.5292.8080.113–69.723
MICA*0381 (1%)0 (0%)0.4700.3060.012–7.602
MICA*0574 (3.6%)4 (3.6%)0.9130.9250.225–3.798
MICA*0720 (0%)1 (0.9%)0.5292.8080.113–69.723
MICA*0750 (0%)1 (0.9%)0.5292.8080.113–69.723
MICA*0800 (0%)1 (0.9%)0.5292.8080.113–69.723
MICA*0860 (0%)1 (0.9%)0.5292.8080.113–69.723
* Significant p-value ≤ 0.05.
Table
Table 4. Genotype frequencies of exons 2–4 of the MICA gene among Jordanian T1D patients versus healthy controls.
Table 4. Genotype frequencies of exons 2–4 of the MICA gene among Jordanian T1D patients versus healthy controls.
Genotype
(Exons 2–4)		Control (n = 51)
n (%)		T1D (n = 55)
n (%)		p ValueOR95% CI
*001/*0041 (2%)0 (0%)0.4680.3030.012–7.616
*002/*0021 (2%)1 (1.8%)0.9570.9260.056–15.202
*002/*0041 (2%)2 (3.6%)0.6031.8870.166–21.461
*002/*0061 (2%)1 (1.8%)0.9570.9260.056–15.202
*002/*0081 (2%)3 (5.5%)0.3462.8850.290–28.663
*002/*0090 (0%)2 (3.6%)0.3144.8130.226–102.6
*002/*0112 (3.9%)0 (0%)0.2700.1780.008–3.806
*002/*0171 (2%)0 (0%)0.4680.3030.012–7.616
*002/*0182 (3.9%)1 (1.8%)0.5140.4540.040–5.161
*002/*0200 (0%)2 (3.6%)0.3144.8130.226–102.6
*002/*0571 (2%)1 (1.8%)0.9570.9260.056–15.202
*002/*0860 (0%)1 (1.8%)0.5262.8350.113–71.182
*004/*0042 (3.9%)2 (3.6%)0.9390.9250.125–6.818
*004/*0061 (2%)0 (0%)0.4680.3030.012–7.616
*004/*0082 (3.9%)1 (1.8%)0.5140.4540.040–5.161
*004/*0093 (5.9%)3 (5.5%)0.9240.9230.178–4.795
*004/*0161 (2%)0 (0%)0.4680.3030.012–7.616
*004/*0203 (5.9%)1 (1.8%)0.2730.2960.030–2.944
*004/*0270 (0%)1 (1.8%)0.5262.8350.113–71.182
*007/*0071 (2%)0 (0%)0.4680.3030.012–7.616
*008/*0081 (2%)3 (5.5%)0.3462.8850.290–28.663
*008/*0093 (5.9%)2 (3.6%)0.5860.6040.097–3.769
*008/*0112 (3.9%)0 (0%)0.2700.1780.008–3.806
*008/*0160 (0%)2 (3.6%)0.3144.8130.226–102.6
*008/*0180 (0%)1 (1.8%)0.5262.8350.113–71.182
*009/*0092 (3.9%)4 (7.3%)0.4561.9220.337–10.971
*009/*0110 (0%)1 (1.8%)0.5262.8350.113–71.182
*009/*0161 (2%)0 (0%)0.4680.3030.012–7.616
*009/*0181 (2%)1 (1.8%)0.9570.9260.056–15.202
*009/*0202 (3.9%)2 (3.6%)0.9390.9250.125–6.818
*009/*0230 (0%)1 (1.8%)0.5262.8350.113–71.182
*009/*0300 (0%)1 (1.8%)0.5262.8350.113–71.182
*009/*0571 (2%)3 (5.5%)0.3462.8850.290–28.663
*009/*0720 (0%)1 (1.8%)0.5262.8350.113–71.182
*011/*0041 (2%)0 (0%)0.4680.3030.012–7.616
*011/*0161 (2%)0 (0%)0.4680.3030.012–7.616
*011/*0181 (2%)0 (0%)0.4680.3030.012–7.616
*012/*0121 (2%)0 (0%)0.4680.3030.012–7.616
*016/*0161 (2%)1 (1.8%)0.9570.9260.056–15.202
*016/*0181 (2%)1 (1.8%)0.9570.9260.056–15.202
*016/*0191 (2%)0 (0%)0.4680.3030.012–7.616
*016/*0271 (2%)0 (0%)0.4680.3030.012–7.616
*017/*0241 (2%)0 (0%)0.4680.3030.012–7.616
*018/*0180 (0%)1 (1.8%)0.5262.8350.113–71.182
*018/*0191 (2%)0 (0%)0.4680.3030.012–7.616
*018/*0201 (2%)0 (0%)0.4680.3030.012–7.616
*018/*0240 (0%)2 (3.6%)0.3144.8130.226–102.6
*018/*0750 (0%)1 (1.8%)0.5262.8350.113–71.182
*019/*0200 (0%)1 (1.8%)0.5262.8350.113–71.182
*019/*0800 (0%)1 (1.8%)0.5262.8350.113–71.182
*020/*0081 (2%)0 (0%)0.4680.3030.012–7.616
*020/*0200 (0%)1 (1.8%)0.5262.8350.113–71.182
*020/*0381 (2%)0 (0%)0.4680.3030.012–7.616
*027/*0270 (0%)1 (1.8%)0.5262.8350.113–71.182
*057/*0571 (2%)0 (0%)0.4680.3030.012–7.616
Table
Table 5. Allele frequencies of exon 5 of the MICA gene among Jordanian T1D patients versus healthy controls.
Table 5. Allele frequencies of exon 5 of the MICA gene among Jordanian T1D patients versus healthy controls.
Alleles
(Exon 5)		Control (n = 102)
n (%)		T1D (n = 110)
n (%)		p ValueOR95% CI
A410 (9.8%)10 (9.1%)0.8950.9200.366–2.311
A58 (7.8%)13 (11.8%)0.3331.5750.624–3.972
A5.116 (15.7%)14 (12.7%)0.5370.7840.361–1.700
A650 (49%)50 (45.5%)0.6030.8670.505–1.487
A916 (15.7%)14 (12.7%)0.5370.7840.361–1.700
Table
Table 6. Genotype frequencies of exon 5 of the MICA gene among Jordanian T1D patients versus healthy controls.
Table 6. Genotype frequencies of exon 5 of the MICA gene among Jordanian T1D patients versus healthy controls.
Genotype
(Exon 5)		Control (n = 51)
n (%)		T1D (n = 55)
n (%)		p ValueOR95% CI
A4/A42 (3.9%)1 (1.8%)0.5140.4540.040–5.161
A4/A50 (0%)1 (1.8%)0.5262.8350.113–71.182
A4/A5.11 (2%)3 (5.5%)0.3462.8850.290–28.663
A4/A64 (7.8%)2 (3.6%)0.3490.4430.078–2.532
A4/A91 (2%)2 (3.6%)0.6031.8870.166–21.461
A5/A51 (2%)2 (3.6%)0.6031.8770.166–21.461
A5/A5.12 (3.9%)4 (7.3%)0.4561.9220.337–10.971
A5/A64 (7.8%)4 (7.3%)0.9120.9220.218–3.895
A5/A90 (0%)1 (1.8%)0.5262.8350.113–71.182
A5.1/A5.11 (2%)2 (3.6%)0.6031.8770.166–21.461
A5.1/A610 (19.6%)9 (16.4%)0.6630.8020.297–2.168
A5.1/A93 (5.9%)3 (5.5%)0.9240.9230.178–4.795
A6/A613 (25.5%)14 (25.5%)0.9970.9980.416–2.393
A6/A96 (11.8%)6 (10.9%)0.8900.9180.276–3.054
A9/A93 (5.9%)1 (1.8%)0.2730.2960.030–2.944
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jarrar, W.; Khdair, S.I.; Khudeir, F.A. MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study. Life 2022, 12, 1813. https://doi.org/10.3390/life12111813

AMA Style

Jarrar W, Khdair SI, Khudeir FA. MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study. Life. 2022; 12(11):1813. https://doi.org/10.3390/life12111813

Chicago/Turabian Style

Jarrar, Wassan, Sawsan I. Khdair, and Feras A. Khudeir. 2022. "MICA Polymorphism and Genetic Predisposition to T1D in Jordanian Patients: A Case-Control Study" Life 12, no. 11: 1813. https://doi.org/10.3390/life12111813

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop