Next Article in Journal
Metabolome Profiling in the Plasma of Dogs with Idiopathic Dilated Cardiomyopathy: A Multiplatform Mass-Spectrometry-Based Approach
Previous Article in Journal
Biotechnological Plastic Degradation and Valorization Using Systems Metabolic Engineering
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 20
10.3390/ijms242015180
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Analysis of the Genes Encoding Q-Type C2H2 Zinc Finger Proteins in Grapevine

by
Mingyu Chu
,
Tiaoye Wang
,
Wenfang Li
,
Yashi Liu
,
Zhiyuan Bian
,
Juan Mao
* and
Baihong Chen
*
College of Horticulture, Gansu Agricultural University, Lanzhou 730070, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(20), 15180; https://doi.org/10.3390/ijms242015180
Submission received: 11 September 2023 / Revised: 8 October 2023 / Accepted: 10 October 2023 / Published: 14 October 2023
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Review Reports Versions Notes

Abstract

:
Q-type C2H2 zinc finger proteins (ZFPs), the largest family of transcription factors, have been extensively studied in plant genomes. However, the genes encoding this transcription factor family have not been explored in grapevine genomes. Therefore, in this study, we conducted a genome-wide identification of ZFP genes in three species of grapevine, namely Vitis vinifera, Vitis riparia, and Vitis amurensis, based on the sequence databases and phylogenetic and their conserved domains. We identified 52, 54, and 55 members of Q-type C2H2 ZFPs in V. vinifera, V. riparia, and V. amurensis, respectively. The physical and chemical properties of VvZFPs, VrZFPs, and VaZFPs were examined. The results showed that these proteins exhibited differences in the physical and chemical properties and that they all were hydrophobic proteins; the instability index showed that the four proteins were stable. The subcellular location of the ZFPs in the grapevine was predicted mainly in the nucleus. The phylogenetic tree analysis of the amino acid sequences of VvZFP, VaZFP, VrZFP, and AtZFP proteins showed that they were closely related and were divided into six subgroups. Chromosome mapping analysis showed that VvZFPs, VrZFPs, and VaZFPs were unevenly distributed on different chromosomes. The clustered gene analysis showed that the motif distribution was similar and the sequence of genes was highly conserved. Exon and intron structure analysis showed that 118 genes of ZFPs were intron deletion types, and the remaining genes had variable numbers of introns, ranging from 2 to 15. Cis-element analysis showed that the promoter of VvZFPs contained multiple cis-elements related to plant hormone response, stress resistance, and growth, among which the stress resistance elements were the predominant elements. Finally, the expression of VvZFP genes was determined using real-time quantitative PCR, which confirmed that the identified genes were involved in response to methyl jasmonate (MeJA), abscisic acid (ABA), salicylic acid (SA), and low-temperature (4 °C) stress. VvZFP10-GFP and VvZFP46-GFP fusion proteins were localized in the nucleus of tobacco cells, and VvZFP10 is the most responsive gene among all VvZFPs with the highest relative expression level to MeJA, ABA, SA and low-temperature (4 °C) stress. The present study provides a theoretical basis for exploring the mechanism of response to exogenous hormones and low-temperature tolerance in grapes and its molecular breeding in the future.

1. Introduction

Zinc finger proteins (ZFPs) constitute a large family of transcription factors that are distributed widely in plants. A common feature of ZFPs is that they can stabilize a very short multi-foldable self-folding finger peptide space configuration through their coordinated Zn ions (Zn2+). Presently, the most widely distributed and well-studied ZFP family genes in eukaryotic genomes are those encoding the C2H2-ZFPs, which are also known as the TFIIIA-type ZFPs. These genes account for nearly 0.7% of the total number of plant genes. C2H2 zinc finger proteins that function as transcript factors (TFs)typically contain an array of two or more tandemly arranged C2H2 motifs; each C2H2 zinc finger protein in such polydactyl-fingered or “polydactyl” proteins can bind to three adjacent nucleotides at target sites, with amino acids at positions 1, 2, 3, and 6 in the alpha helical region of each motif having a crucial role in DNA recognition [1,2]. In addition, C2H2-ZFPs, as transcription factors, generally have a nuclear localization signal region, which is also known as B -box [3].“Q-type” C2H2 ZFPs, with the sequence QALGGH, can combine with the residues in the protein structure; specifically, they can combine with the promoter region of regulation-related genes and thus control the expression of genes in plants and play an important role in the growth, development, and stress response of plants [4,5].
Studies have found that ZFPs are crucial in the growth, development, and response to abiotic stress in cassava [6,7,8]. During flower development of Chinese cabbage, ZFPs participate in the flowering induction process as histone methyltransferase or demethylase and perform transcriptional regulation of characteristic genes of flower organ models by affecting cell proliferation and hormonal regulation [9]. Based on the expression patterns of CsC2H2-ZFPs, a study reported that these ZFPs were responsive to different stresses including drought, salt, cold, and methyl jasmonate (MeJA) treatments [10]. OsZFP179 from rice was functionally characterized as a salt-responsive gene, and its overexpression was shown to enhance salt tolerance in transgenic rice plants [11].
The ZFP family has been implicated in the adaptation or response of plants to abiotic stresses. Some expression analyses have shown that various ZFP genes in Arabidopsis are induced in response to cold and drought stress [12]. Some ZFP genes such as AtZAT12 are also involved in oxidative and abiotic stress signaling [12,13,14], and oxidative stress occurs under various biotic and abiotic stress conditions [15]. A review highlighted that AZF2, STZ, and ZAT12, which are C2H2 zinc finger genes from Arabidopsis, form a regulatory network of cold-responsive genes [16]. A cold-inducible gene, SCOF-1, from soybean, was reported to enhance cold tolerance [17]. Recent transgenic studies have shown that the overexpression of some ZFP genes from Arabidopsis and rice can enhance salt tolerance [15,18,19]. Likewise, overexpression of drought-inducible ZFP genes (ZPT2-3 in Petunia and STZ in Arabidopsis) has been reported to enhance drought tolerance in transgenic plants [20,21]. Most ZFP genes involved in plant response to abiotic stress are transcriptional repressors [18,21,22] and the EAR motif of ZAT7 is critical for the ZFP-mediated improvement of abiotic stress tolerance in transgenic plants [18].
ZFPs have been extensively studied in plants; studies have identified 179 ZFP genes in Arabidopsis [23], 79 in potato [9], 47 in Triticum aestivum [6], 118 in tobacco [24], 120 in cucumber [25], 189 in rice [26], and 109 in poplar [27]; however, this transcription factor family genes in grapevine have not been explored. Therefore, the present study was conducted to identify the genes and explore the structure of the ZFP family in the genome of three species of grapevine, namely Vitis vinifera, Vitis riparia, and Vitis amurensis.
In this study, a genome-wide identification of ZFP genes in the three species of grapevine was performed based on the current sequence databases and subsequent phylogenetic and conserved domains. Subsequently, we explored the evolution of the ZFP genes by analyzing intragroup gene collinearity of the three grapevine genomes and interspecies gene collinearity among V. vinifera and other five plants, namely Malus domestic, Prunus persica, Musa acuminate, Solanum lycopersicum, and Arabidopsis. Furthermore, the mRNA distribution of these VvZFPs in various organs (roots, leaves, flowers, and seeds.) was determined. Our expression analyses showed that the VvZFP subfamily in grapevine is predominantly expressed in these organs. Further, to predict their potential functional mechanisms, quantitative analysis of the expression of VvZFP family genes in response to MeJA, abscisic acid (ABA), salicylic acid (SA), and low-temperature (4 °C) treatments was performed. The present study provides a theoretical basis for further research on the biological functions of ZFP genes in grapevine.

2. Results

2.1. Identification of Q-Type ZFP Gene Family in Grape Genome

The hidden Markov Model was used to identify the ZFP genes in grape genomes. A total of 52 Q-type VvZFPs, 54 Q-type VrZFPs, and 55 Q-type VaZFPs were identified, which were named VvZFP1–VvZFP52, VrZFP1–VrZFP54, and VaZFP1–VaZFP55, respectively, according to their chromosomal positions. The physical and chemical properties of the proteins encoded by VvZFP, VaZFP, and VrZFP genes are summarized in Table 1. Regarding VvZFP genes, the coding sequence (CDS) length was 468–1830 bp, the protein length was 155–609 amino acids, the molecular weight was 17,251.04–65,943.19 Da, pI was 4.79–9.58, and the instability index ranged from 38.51 to 77.98. All 52 VvZFP proteins were predicted to be localized in the nucleus, and their secondary structure comprised mainly the alpha helix, extended strand, beta-turn, and random coil. For VaZFP genes, the CDS length was 474–2583 bp, the protein length was 157–860 amino acids, the molecular weight was 17,102.01–94,567.56 Da, pI was 4.94–10, and the instability index ranged from 38.21 to 79.33. All VaZFP proteins except VaZFP24 were predicted to be localized in the nucleus; VaZFP24 was predicted to be localized in the cell membrane. The protein secondary structure comprised mainly the alpha helix, extended strand, and random coil. Regarding VrZFP genes (Table 1), the CDS ranged from 396 to 1836 bp, the protein length was 131–611 amino acids, the molecular weight was 14,365.07–66,157.24 Da, pI was between 4.78 and 9.3, and the instability index ranged from 37.24 to 80.72. All 53 VrZFP proteins except VrZFP10 were predicted to be localized in the nucleus; VrZFP10 was predicted to be localized in the cell membrane. Their protein secondary structure comprised mainly the alpha helix, extended strand, and random coil.

2.2. Phylogenetic Analysis of ZFP Proteins in Grape Genomes

The identified 52 Q-type VvZFP, 54 Q-type VrZFP, 55 Q-type VaZFP, and 57 Q-type AtZFP proteins were obtained from the Phytozome, VITSGDB, NCBI, and TAIR databases, respectively. Multiple sequence alignment of the 218 ZFP proteins was performed using the software MEGA7.0 [28]. According to the distance of their kinship, the 218 ZFP proteins were divided into eight groups (Figure 1). Group 1 comprised 5 VvZFP, 5 VrZFP, 5 VaZFP, and 11 AtZFP proteins. Group 2 comprised 6 VvZFP, 4 VrZFP, 10 VaZFP, and 4 AtZFP proteins. Group 3 comprised 7 VvZFP, 8 VaZFP, 8 VrZFP, and 9 AtZFP genes. Group 4 comprised 3 VvZFP, 4 VaZFP, 3 VrZFP, and 7 AtZFP proteins. Group 5 comprised 10 VvZFP, 9 VaZFP, 10 VrZFP, and 8 AtZFP proteins. Group 6 comprised 10 VvZFP, 9 VaZFP, 10 VrZFP, and 8 AtZFP genes. Group 7 comprised 6 VvZFP, 6 VaZFP, 8 VrZFP, and 6 AtZFP proteins. Group 8 comprised 12 VvZFP, 11 VaZFP, 11 VrZFP, and 9 AtZFP proteins.

2.3. Gene Structure and Conserved Motif Analysis of the ZFP

Using MEME, a total of 15 conserved motifs of the ZFP amino acid sequences were analyzed. The phylogenetic tree members on the same branch exhibited slight differences and those on different branches exhibited great differences in terms of the type, quantity, and position of the motifs (Figure 2A,B). The whole genome was divided into eight subgroups based on the phylogenetic relationship. Among the 15 motifs, the sequence of motif 1 was “YECNFCNREFPSSQALGGHQNAHKKER ARAKRSQ”, which is Zinc finger #1; the sequence of motif 2 was “KTHECSICSKEFSSGQALGGHMRC HRERE”, which is Zinc finger #2; the sequence of motif 3 was “EDEEEEEDLANCLIMLSRGGG [29]”, which is L-box motif; the sequence of motif 5 was “CSTCKKVFPSGQALGGHRRSH”, which is finger #3; the sequence of motif 6 was “DLDLNLRL”, which is an EAR motif; and the sequence of motif 13 was “EVWTKRKRSKRIRLD”, which is B-box. All members of Group 1 comprised mainly motifs 1, 2, 3, and 6. Among them, some members of Group 1 (VvZFP41, VvZFP23, VvZFP35, VaZFP39, VaZFP13, VaZFP28, VrZFP40, VrZFP19, and VrZFP35) contained an additional motif, that is, motif 13. Group 2 contained the largest number and variety of motifs, namely motifs 1, 2, 4, 5, 6, 8, 9, 12, and 14 (VvZFP21, VvZFP20, VvZFP18, VaZFP16, VaZFP18, VaZFP19, VaZFP14, VrZFP21 contained two additional motifs, that is, motifs 11 and 15; VvZFP19, VvZFP20, VvZFP22, VaZFP18, VaZFP17, VaZFP20, VrZFP20, and VrZFP25 comprised an additional motif, that is, motif 10; VvZFP51, VaZFP50, and VrZFP54 contained motifs 1, 2, 4, 5, 8, 12, and 14, as well as motifs 3 and 13. VaZFP25 contained motifs 1, 6, and 7; and VaZFP35 contained only motifs 1, 3, and 6). Group 3 comprised 6 motifs, namely motifs 1, 2, 3, 5, 6, and 13 (VvZFP7, VvZFP8, and VvZFP11 contained motifs 2, 3, 6, 12, and 13; VvZFP48 comprised motifs 2, 3, 6, and 13; and VvZFP52, VaZFP4, and VrZFP10 comprised motifs 2, 3, 5, 6, and 13, as well as motifs 14 and 15). Group 4 comprised 5 motifs, namely motifs 1, 2, 3, 6, and 13 (VaZFP12 contained motifs 1, 6, and 8; and VaZFP48 contained motifs 1, 6, 7, and 10). Group 5 comprised two motifs, namely motifs 1 and 6 (VvZFP13 and VrZFP17 contained an additional motif, that is, motif 8; VvZFP6, VvZFP40, VaZFP5, VaZFP38, VrZFP9, and VvZFP41 contained motifs 1, 6, and 15; and VvZFP17, VvZFP34, VaZFP21, VaZFP29, VaZFP52, VrZFP22, and VrZFP34 contained not only two additional that is, motifs 13 and 15). Group 6 (VvZFP2, VaZFP2, VrZFP2, and VrZFP3) comprised only one motif, that is, motif 1. Group 7 comprised mainly motifs 1 and 6 (VvZFP44, VaZFP42, VaZFP53, VrZFP44, and VrZFP50 comprised only motif 1; VvZFP5, VrZFP7, and VrZFP8 comprised an additional motif 13).
Group 8 comprised mainly motifs 1, 6, and 7 (VvZFP29, VvZFP42, VaZFP26, VaZFP36, VrZFP26, VrZFP39 contained not only motifs 1, 6, and 7 but also motif 4; VvZFP37, VaZFP34, and VrZFP37 contained motifs 10 and 15, in addition to motifs 1, 6, and 7; VvZFP31, VaZFP32, and VrZFP29 contained an additional motif 14; VaZFP41 contained only motif 1; and VvZFP38 and VrZFP38 contained only motifs 1 and 6).
To further understand the diversity of gene structure, the composition of introns and exons of genes was analyzed. As shown in Figure 2C, among the 161 members of VaZFP, VvZFP, and VrZFP, 118 genes were intron deletion types, only contained one exon, accounting for 74.5% of all members, 131 genes lacked upstream and downstream structures, 24 genes contained two exons. The number of exons in the remaining members (19 genes) ranged from 3 to 15, and the genes with the highest number of exons were VaZFP35 and VaZFP24, with 15 exons. VaZFP 48 contains 12 exons, VaZFP6 contains eight exons, VaZFP24 and VvZFP48 genes contain seven exons, VvZFP2 and VaZFP2 contain six exons, VrZFP2 and VrZFP3 contain five exons. Relatively speaking, genes with a higher number of exons are dominated by VaZFP. This may be related to the differentiation of gene function. Because the number and distribution of exons may affect the function and expression regulation of genes.

2.4. Analysis of Cis-Acting Elements of VvZFP, VrZFP, and VaZFP Genes

Analysis of the upstream 2000-bp cis-acting elements of the VvZFP, VrZFP, and VaZFP genes showed that nine types of hormone- and stress-related cis-acting regulatory elements were present in the promoters of ZFP genes in grape genomes (Figure 3 and Table S2). Stress-related cis-acting elements (n = 3) included TC-rich repeats (defense and stress), MBS (drought), and low temperature-response (LTR) elements, whereas hormone-related cis-acting elements (n = 6) included TGA element/AuxRR core (auxin), O2 site (zein metabolism), TCA element/SARE (salicylic acid), ABRE (abscisic acid-response element), GARE-motif/P-box/TATC-box (gibberellic acid-response element), and CGTCA/TGACG motif (MeJA-response element). In addition, seven growth and development-related elements were identified including ARE (anaerobic induction), circadian control, RY-element (seed-specific regulation), CAT-box (meristem-specific expression), WUN-motif (wound-responsive element), MBSI (MYB binding site involved in the regulation of flavonoid biosynthesis genes), and AT-rich sequence.
Overall, 94% of the ZFP family members were found to contain TATA-box and CAAT-box core elements; 84.6% of the family members contained hormone response-related elements. Of these 84.6%, 55.7% were found to contain ABA-responsive elements (ABRE), 15.3% contained the AuxRR-core (auxin-responsive element), 7.7% contained the GARE-motif (gibberellin-responsive element), and 44.2% contained the TCA-element and salicylic acid-response element. Furthermore, 69.2% of the family members contained stress-response elements; of these, 17.3% contained the LTR element, 44.2% contained the MBS drought-response element, and 30.8% contained the TC-rich, defense- and stress-response elements.

2.5. Chromosomal Localization of ZFP Genes in the Grape Genome

To investigative the genomic distribution of ZFP genes on the chromosomes, the physical positions of all ZFP genes from V. vinifera, V. riparia, and V. amurensis were determined using the position data of ZFP genes obtained from the Ensembl, VITSGDB [30], and NCBI databases.
In V. vinifera, 52 ZFP genes were unevenly distributed on 18 chromosomes; VvZFP genes were located on Chr1–Chr9, Chr11, Chr13–Chr19, and ChrUn, with the least number (1) of genes located on Chr2, Chr4, Chr9, Chr11, Chr16, Chr17, Chr19, and ChrUn, and the highest number of genes (9) located on Chr6 (Figure 4A). In V. amurensis, 55 ZFP genes were unevenly distributed on 17 chromosomes, that is, Chr1–Chr9, Chr11, and Chr13-Chr19. VaZFP51 and VaZFP52 were located in scafold_187; VaZFP53, VaZFP54, and VaZFP55 were located in scafold_503, scafold_1201, and scafold_1769, respectively. Chr4, Chr9, Chr11, Chr16, and Chr19 contained the minimum number of VaZFP genes (1), whereas Chr6 contained the highest number of VaZFP genes (10) (Figure 4B). In V. riparia, 54 ZFP genes were unevenly distributed on 17 chromosomes, that is, Chr1-Chr9, Chr11, and Chr13- Chr19 chromosomes. The minimum number of VrZFP genes (1) were located on Chr4, Chr9, Chr11, and Chr16, whereas the highest number of VrZFP genes (8) were located on Chr13 (Figure 4C).

2.6. Analysis of Duplication, Ka/Ks, and Codon Usage Bias of ZFP Genes in Grape Genome

To further investigate the expansion pattern of ZFP genes in V. vinifera, V. riparia, and V. amurensis, the synteny analysis was carried out (Figure 5A–C). Intragenomic collinearity of V. vinifera was employed dada of the Plant Ensemble database. The intragroup collinearity analysis of VvZFP genes revealed 19 pairs of collinear genes (Figure 5A). These genes were located on chromosomes Chr1, Chr3, Chr4, Chr5, Chr6, Chr7, Chr8, Chr 9, Chr13, Chr14 and Chr18. Particularly, three genes on chromosome Chr6 were collineated with three genes on chromosome Chr8, respectively. Additionally, there are two genes on Chromosomes Chr3 that exhibited collinearity with the genes on chromosomes Chr7 and Chr18, respectively, namely VvZFP8/VvZFP28/VvZFP50 and VvZFP9/VvZFP27/VvZFP49. Interestingly, three pairs of genes (VvZFP15/VvZFP39, VvZFP17/VvZFP34 and VvZFP23/VvZFP35) showed a similarity of over 50% between their amino acid sequence. Furthermore, these two pairs of genes exhibited gene structure and conserved motifs.
The intragroup collinearity analysis of VrZFP genes revealed 18 pairs of collinear genes (Figure 5B), which were located on chromosomes Chr1, Chr2, Chr3, Chr6, Chr7, Chr8, Chr13, Chr14, Chr15, Chr16, Chr17, and Chr18. In addition, the two genes adjacent to each other on chromosome Chr3 were found to be collinear with the two genes adjacent to each other on chromosomes Chr7 and Chr18, respectively. These gene pairs were VrZFP12/VrZFP27/VrZFP53 and VrZFP13/VrZFP28/VrZFP52. Four genes on chromosome Chr6 have observed the collinearity relationship with three genes on chromosome Chr8 and one gene on chromosome Chr13. Furthermore, the homogeneous analysis demonstrated that 16 pairs of collinear genes had high sequence homology (over 50%), and six pairs exceeding 60%. The intragroup collinearity analysis of VaZFP genes revealed nine pairs of collinear genes (Figure 5C), which were located on chromosomes Chr5, Chr6, Chr8, Chr11, Chr15 and Chr18, and four genes linked with other genes did not belong to the ZFP family. Among the collinear genes in V. amurensis, only one pair of genes had a sequence similarity higher than 50% (60.59%). These results indicated that segment duplication events have occurred during evolution in VvZFP, VrZFP and VaZFP. The expansion of the ZFP gene family may have occurred through duplication events, with segmental duplication playing a crucial role in the abundance of this gene family in the grapevine. Moreover, some segmental duplicated genes with high sequence homology shared a similar gene structure and conserved motifs. It is speculated that these genes may have a common ancestral gene and similar biological functions.
Codon bias analysis is useful in studying the evolution and environmental adaptability of species. The effective number of codons (Nc) and CAI of the VvZFP, VaZFP, and VrZFP genes were analyzed (Table S3). In V. vinifera, the Nc value ranged from 44.69 (VvZFP1) to 61 (VvZFP3 and VvZFP25), whereas the CAI value ranged from 0.146 (VvZFP8) to 0.276 (VvZFP49). In V. amurensis, the Nc value ranged from 45.84 (VaZFP46) to 61 (VaZFP10), and the CAI value ranged from 0.147 (VaZFP2) to 0.28 (VaZFP49). In V. riparia, the Nc value ranged from 44.6 (VrZFP1) to 61 (VrZFP4), and the CAI value ranged from 0.144 (VrZFP12) to 0.282 (VrZFP52). The relative synonymous codon usage (RSCU) values were employed to visually assess condon usage bias. Here, we analyzed the RSCU values of the VvZFP, VrZFP, and VaZFP proteins, as Figures S1–S3 show that the number of ZFP proteins in V. amurensis preferentially using codons with RSCU values >1 were higher than that of ZFP proteins in V. vinifera and ZFP proteins in V. riparia. In addition, the results of the correlation between codon usage parameters revealed that T3s were positively correlated with C3s, G3s, GC3s, CBI, and FOPs, whereas C3s were negatively correlated with CBI, FOPs, GC, and GC3s in V. vinifera, V. riparia, and V. amurensis (Figure 5D–F). Moreover, there is no difference in codon usage parameters among these three grapes.
The evolutionary selection pressure can be estimated based on the ratio Ka/Ks. Therefore, we calculated this value to further understand the evolutionary relationship among
VvZFP, VaZFP, and VrZFP genes (Figure 5G–I, Table S4). In V. vinifera, the Ka/Ks values of 639 gene pairs were calculated; 293 pairs exhibited the Ka/Ks of >1, two gene pairs (VvZFP33/VvZFP1 and VvZFP49/VvZFP4) exhibited the Ka/Ks = 1, and 344 gene pairs exhibited the Ka/Ks of <1 (Figure 5G, Table S4). In V. riparia, the Ka/Ks values of 779 gene pairs were calculated; 350 gene pairs exhibited the Ka/Ks > 1, seven gene pairs (VaZFP44/VaZFP36, VaZFP37/VaZFP7, VaZFP36/VaZFP8, VaZFP32/VaZFP40, VaZFP33/VaZFP11, VaZFP31/VaZFP40, and VaZFP7/VaZFP10) was equal to 1, and that of 234 gene pairs were less than 1. These results showed that during evolution, the ZFP gene families might have been subjected to purification selection in V. vinifera but to positive selection in V. amurensis and V. riparia.
To further understand the evolutionary relationship and gene function among the different species, we analyzed the interspecies collinearity between the VvZFPs and their counterparts in other five species, namely Arabidopsis thaliana, Malus domestica, Prunus persica, Musa acuminata, Solanum lycopersicum (Figure 6 and Table S5), which revealed 326 pairs of orthologous genegenes, including 56 pairs of Arabidopsis genes, 64 pairs of peach genes, 106 pairs of apple genes, 40 pairs of banana genes, and 60 pairs of tomato genes. The homology relationship of VvZFPs with the apple genes was the strongest, followed by peach genes, whereas the relationship between VvZFPs and banana genes was the weakest, probably reflecting the evolutionary relationship and genetic specificity among species.

2.7. Analysis of VvZFP Gene Expression

The expression levels of VvZFPs in different tissues indicated similarities between their expression pattern in the same subgroup (Figure 7 and Table S6). In Group 1, VvZFP15 was downregulated in the burst initial stage of buds and seeds of post fruit set, but upregulated in other tissues; VvZFP41 was upregulated in the flowers, pollens, and stamens. In Group 2, VvZFP51 was upregulated in the seeds of post fruit set. In Group 3, VvZFP45 was upregulated in the flowers, pollens, and stamens. In Group 4, VvZFP49 was downregulated in buds at the burst initial stage and seeds at post fruit set stage but upregulated in other tissues. In Group 5, VvZFP14 was upregulated only in the tendrils. In Group 6, VvZFP2 was upregulated in young flowers and bud burst initial stage but downregulated in other tissues. In Group 7, VvZFP5 was upregulated in the roots, stems, skin, flesh, rachis, pericarp, and seeds. In Group 8, VvZFP4 was upregulated in the roots, stems, skin, flesh, flowers, petals, pollens, rachis, tendrils, carpels, buds, leaves, and seeds. Moreover, in this group, VvZFP38 was upregulated in buds at bud burst initial stage, bud burst later stage, young leaves, and seeds but downregulated in other tissues.

2.8. qRT-PCR Analysis of the VvZFP

To elucidate the response of the VvZFP family in grapevine under extra hormone and stress, quantitative real-time PCR (qRT-PCR) was performed to characterize the expression pattern of all VvZFPs under MeJA, ABA, SA and 4 °C.

2.8.1. Expression of VvZFP Genes under MeJA Treatment

After treatment with 100 μmol·L−1 MeJA, the genes that showed significant upregulation were VvZFP5, VvZFP12, VvZFP13, VvZFP14, VvZFP16, VvZFP17, VvZFP19, VvZFP 22, VvZFP23, VvZFP25, VvZFP29, VvZFP30, VvZFP32, VvZFP34, and VvZFP43 (p < 0.05). At 3 h after MeJA treatment, the significantly upregulated genes were VvZFP1-VvZFP6, VvZFP8, VvZFP9, VvZFP11-VvZFP23, VvZFP25-VvZFP30, VvZFP30, VvZFP35, VvZFP37, VvZFP39, VvZFP44-VvZFP46, VvZFP48, VvZFP49, and VvZFP52. Among them, VvZFP52 exhibited the highest relative expression level of 58.94 (Figure 8), 15 genes reached their expression peaks at 3 h, and the expression of VvZFP3, VvZFP8, VvZFP9 and VvZFP48 then dramatically decreased after 3 h, while others genes gradually decreased over time. Under MeJA treatment, the genes whose expression was significantly increased at 6 h were VvZFP1-VvZFP5, VvZFP10-VvZFP31, VvZFP35, VvZFP37, VvZFP39, VvZFP40, VvZFP43-VvZFP46, VvZFP49, and VvZFP50-VvZFP52 (p < 0.01), among these 38 genes, VvZFP10 exhibited the highest relative expression level of 6824.21. In addition, 21 genes have shown the expression peak at 6 h. For 12 h, the genes whose expression was increased significantly included VvZFP3, VvZFP5, VvZFP6, VvZFP9, VvZFP11-VvZFP17, VvZFP22-VvZFP25, VvZFP29-VvZFP32, VvZFP35, VvZFP38, and VvZFP41-VvZFP43, of which VvZFP38 had the highest relative expression level of 372.04; furthermore, the expression levels of six genes (VvZFP6, VvZFP30, VvZFP31, VvZFP32, VvZFP38, and VvZFP42) reached their peaks. The significantly upregulated genes at 24 h were VvZFP5, VvZFP6, VvZFP7, VvZFP12, VvZFP13, VvZFP14, VvZFP16, VvZFP22-VvZFP26, VvZFP29-VvZFP34, VvZFP36, VvZFP37, VvZFP40, VvZFP41, VvZFP43, VvZFP47-VvZFP50 and VvZFP52, of which VvZFP43 had the highest relative expression level of 80.79, and the expression level of nine genes peaked at this treatment point. Thus, the majority of VvZFPs were induced to express by MejA but displayed with variant expression patterns.

2.8.2. Expression of VvZFP Genes under ABA Treatment

After treatment with 100 mmol·L−1 ABA, a total of 7 VvZFPs were upregulated significantly at all time points (p < 0.05); no genes were completely downregulated at any time (Figure 9). For 3 h, the 35 genes with increased expression levels included VvZFP1-VvZFP5, VvZFP8, VvZFP9, VvZFP11, VvZFP12, VvZFP14-VvZFP18, VvZFP20-VvZFP23, VvZFP25-VvZFP28, VvZFP33, VvZFP35, VvZFP37, VvZFP39, VvZFP43, VvZFP44, VvZFP48, VvZFP49, and VvZFP52 (p < 0.01), among which 15 genes peaked at this time point, and VvZFP52 had the highest relative expression level of 224.92 (Figure 9). After treatment with 100 mmol·L−1 ABA for 6 h, the genes that were remarkably upregulated included VvZFP1-VvZFP5, VvZFP8, VvZFP10-VvZFP28, VvZFP30, VvZFP35, VvZFP37-VvZFP40, VvZFP43-VvZFP47, VvZFP49, and VvZFP50-VvZFP52 (p < 0.01), with VvZFP10 having the highest relative expression level of 6044.60, followed by VvZFP46 and VvZFP51 having the relative expression levels of 374.38 and 599.88, respectively; and there were 23 genes exhibiting peak expression at 6 h. After treatment with 100 mmol·L−1 ABA for 12 h, the genes with significantly increased expression levels were VvZFP5, VvZFP6, VvZFP13, VvZFP23, VvZFP24, VvZFP29-VvZFP31, VvZFP36, VvZFP38, VvZFP41, and VvZFP43 (p < 0.01), among which VvZFP13 and VvZFP31 had the highest relative expression levels of 28.55 and 31.78, respectively; the expression level of VvZFP6, VvZFP29, VvZFP30, VvZFP31, and VvZFP38 reached the peak at this time point. After treatment with 100 mmol·L−1 ABA for 24 h, the genes that were upregulated significantly included VvZFP3, VvZFP6, VvZFP7, VvZFP11, VvZFP22-VvZFP25, VvZFP31-VvZFP34, VvZFP37, VvZFP40-VvZFP42, VvZFP47, VvZFP49, and VvZFP50 (p < 0.01), among which 8 genes reached their expression peaks, with VvZFP32 exhibiting the highest relative expression level of 29.02. Thus, all members of the VvZFP family can be stimulated by ABA, yet they present diverse expression profiles; even when patterns appeared similarly, the expression levels varied.

2.8.3. Expression of VvZFP Genes under SA Treatment

After treatment with 200 μmol·L−1 SA, the results of qRT-PCR revealed the expression of 8 VvZFPs was upregulated consistently across all time points (p < 0.05), only VvZFP49 manifested a significant downregulation throughout the experiment (p < 0.05) (Figure 10). For 3 h, the remarkably upregulated genes were VvZFP1-VvZFP6, VvZFP8, VvZFP9, VvZFP11, VvZFP12, VvZFP14-VvZFP17, VvZFP20-VvZFP23, VvZFP25-VvZFP28, VvZFP30, VvZFP33-VvZFP35, VvZFP37, VvZFP39, VvZFP44, VvZFP45, VvZFP48, and VvZFP51 (p < 0.01), of which 12 genes reached the peak of expression levels; furthermore, VvZFP11 and VvZFP39 had the highest relative expression levels of 76.89 and 80.53, respectively (Figure 10). With 200 μmol·L−1 SA treatment for 6 h, the upregulated genes were VvZFP2, VvZFP4, VvZFP5, VvZFP10-VvZFP28, VvZFP30, VvZFP33-VvZFP35, VvZFP37, VvZFP39, VvZFP40, VvZFP42, and VvZFP44-VvZFP47 (p < 0.01), of which 23 genes reached the peak of expression, and VvZFP10 had the highest relative expression level of 1870.33, followed by VvZFP13, VvZFP46, and VvZFP47, with the relative expression levels of 201.19, 143.23, and 234.68, respectively. With 200 μmol·L−1 SA treatment for 12 h, significantly upregulated expression genes were VvZFP13, VvZFP19, VvZFP24, VvZFP25, VvZFP29-VvZFP31, VvZFP37, VvZFP38, VvZFP42, and VvZFP43 (p < 0.01), among which VvZFP13 exhibited the highest relative expression level of 431.72, and VvZFP6, VvZFP30-VvZFP32, VvZFP38, and VvZFP42 achieved their expression peaks. With 200 μmol·L−1 SA treatment for 24 h, the remarkably upregulated genes were VvZFP1-VvZFP7, VvZFP16-VvZFP20, VvZFP22, VvZFP24-VvZFP26, VvZFP28, VvZFP29, VvZFP31, VvZFP37, VvZFP42, VvZFP43, VvZFP45, VvZFP48, and VvZFP50-VvZFP52, among which VvZFP24 exhibited the highest relative expression level of 21.47. These analyses indicated the expression of VvZFPs were induced by SA treatment, but with the differences in response speed and expression level.

2.8.4. Expression of VvZFP Genes under 4 °C Treatment

Under the treatment of 4 °C, 6 of 52 VvZFPs were observed to be significantly upregulated across all time points (p < 0.05). In contrast, VvZFP42 exhibited consistent downregulation throughout, while the expression level of VvZFP29 had no changes during the treatment of 4 °C. The genes upregulated significantly after 4 °C treatment were VvZFP1-VvZFP5, VvZFP7-VvZFP9, VvZFP11-VvZFP28, VvZFP30, VvZFP33, VvZFP35, VvZFP37, VvZFP39, VvZFP43, VvZFP44, VvZFP45, VvZFP47-VvZFP49, and VvZFP52 (p < 0.01), of which VvZFP27 and VvZFP52 showed the highest relative expression levels of 51.77 and 64.0, respectively (Figure 11), and 13 genes of them reached the expression peak. After 6 h of treatment at 4 °C, the remarkably upregulated genes were VvZFP1-VvZFP5, VvZFP8-VvZFP28, VvZFP35-VvZFP37, VvZFP39, VvZFP40, VvZFP44-VvZFP47, VvZFP49, VvZFP50-VvZFP52 (p < 0.01), of which VvZFP10 had the highest relative expression level of 5420.95, furthermore the expression levels of 29 upregulated genes peaked at 6 h. After 12 h of treatment at 4 °C, the genes with increased expression were VvZFP5, VvZFP6, VvZFP7, VvZFP14, VvZFP22-VvZFP24, VvZFP26, VvZFP33, VvZFP34, VvZFP38, VvZFP41, and VvZFP47 (p < 0.01), of which VvZFP6, VvZFP7, VvZFP24, VvZFP31, VvZFP34, VvZFP38, and VvZFP41 reached the peak expression, with VvZFP7 exhibiting the highest relative expression level of 789.01. After 24 h of treatment at 4 °C, the genes that were upregulated significantly included VvZFP5, VvZFP6, VvZFP22-VvZFP24, VvZFP29, VvZFP33, VvZFP34.
VvZFP41, VvZFP47, VvZFP50, and VvZFP51 (p < 0.01), of which VvZFP51 exhibited the highest relative expression level of 8.27. These results showed majority of genes of VvZFPs respond to cold stress (4 °C), but the expression patterns were different.

2.9. Subcellular Localization of VvZFP10 and VvZFP46 Proteins

To determine the subcellular localization of the VvZFP10 and VvZFP46 proteins, Agrobacterium containing the recombinant plasmids pCAMBIA2300-VvZFP10-GFP and pCAMBIA2300-VvZFP46-GFP was injected into tobacco leaves for transient expression, with pCAMBIA2300-GFP as control. As depicted in Figure 12, VvZFP10 and VvZFP46 were localized in the nucleus of tobacco cells. Accordingly, we inferred that VvZFP10 and VvZFP46 are located in the nucleus.

3. Discussion

3.1. Identification of Q-Type C2H2 ZFPs in Grapes

The Q-type ZFPs contain a domain consisting of approximately 25 amino acids and two conserved Cys and His residues, with a consensus sequence of CX2–4CX3FX3QALGGHX3–5H [29]. In total, 52 Q-type C2H2 VvZFPs, 54 C2H2 Q-type VrZFPs, and 55 Q-type C2H2 VaZFPs were identified in the genomes of V. vinifera PN40024, V. riparia, V. amurensis, respectively, and these genes have also been identified in other plants [23,33,34]. Analysis of the physicochemical properties of VvZFPs, VrZFPs, and VaZFPs revealed similarity between these genes; for example, the CDS lengths of VvZFPs, VaZFPs and VrZFPs were found to be in the range 468–1830 bp, 474–2583 bp, and 396–1836 bp, respectively, and their pI was found to be in the range 4.79–9.58, 4.94–10, and 4.78–9.3, respectively. VvZFP, VrZFP, and VaZFP proteins were predicted to be localized in the nucleus, except for VaZFP24 and VrZFP10, which were predicted to be localized in the cell membrane. To explore the subcellular localization of the VvZFP10 and VvZFP46 proteins, they were introduced into Nicotiana benthamiana leaves, which indicated that VvZFP10 and VvZFP46 were localized in the nucleus (Figure 12).
In this study, VvZFP, VrZFP, and VaZFP proteins were found to contain at least one C2H2 domain with a QALGGH motif, and Q-type VvZFP (VrZFP and VaZFP) proteins were found to have more than two zinc finger domains; these characteristics also have been reported in ZFPs in Arabidopsis and rice genomes [23,26]. A thorough examination of various Q-type C2H2 ZFP subfamily members possessing at least one QALGGH-containing C2H2 domain in Arabidopsis [23] revealed 57 members, which is higher than the number of VvZFP, VrZFP, and VaZFP members identified in this study. Most previously characterized ZFPs in plants reported to date are transcriptional repressors [18,35,36,37,38]. Interestingly, we found that the potential EAR motifs, which are associated with the ethylene-responsive element binding factor, are the predominant transcriptional repression motifs in plants, and “DLNxxP” is the most common type [39]. In this study, motif 6 contained “LDLNLRL”. Overall, 44 VvZFPs containing the EAR motif “LDLNLRL” were present at the C-terminus, whereas only 4 VvZFPs (VvZFP29, VvZFP30, VvZFP32 and VvZFP42) containing EAR motifs were present at the N-terminus (Figure 2), and 4 VvZFPs (VvZFP2, VvZFP22, VvZFP44, and VvZFP51) did not contain the EAR motif.
Based on the VvZFP, VaZFP, VrZFP gene structure and motif distribution, ZFP genes were divided into 8 groups according to phylogenetic analysis. Group 1 contained mainly two “QALGGH” motifs and one EAR motif. Group 2 contained the largest number and variety of motifs, mainly three “QALGGH” motifs and one EAR motif. Group 3 mainly contained three “QALGGH” motifs, one L-box motif, one B-box motif, and one EAR motif. Group 4 mainly contained two “QALGGH” motifs, one L-box motif, one B-box motif, and one EAR motif. Group 5 mainly contained one “QALGGH” motif and one EAR motif. Group 6 contained mainly one “QALGGH” motif. Group 7 contained mainly one “QALGGH” motif and one EAR motif. Group 8 mainly contained one “QALGGH” motif and one EAR motif. B-box and L-box were found to be located in the N-terminal region of some 2-fingered proteins, consistent with the results of a previous study [6]. B-box and L-box are conserved in some 2-fingered Q-type ZFP proteins, as reported by Sakamoto et al. [40]. Amino acid sequences in the zinc finger domain of these three (VvZFP, VaZFP, VrZFP) 1-fingered ZFP proteins are 100% identical. Thus, they compete for the same DNA-binding site and potentially regulate target gene expression by changing their expression under different physiological and environmental conditions. Two clade VI TaZFP proteins also share high sequence homology in zinc finger domains, as well as conserved EAR, B-box, and L-box motifs, with previously characterized ZFPs from other species that were reported to be upregulated under abiotic stress, namely Arabidopsis AZF2 and AtZat10 [15,40], Petunia ZPT2-3 [20], and soybean SCOF-1 [17]. As observed in this study, VvZFP10 exhibited a distinct response pattern to MeJA, ABA, SA, and 4 °C low temperatures stress compared with VvZFP6 and VvZFP7 (Figure 8, Figure 9, Figure 10 and Figure 11).

3.2. Chromosomal Localization, Gene Duplication, Ka/Ks, and Codon Usage Bias Analyses

This study identified 52 VvZFP genes unevenly distributed on 18 chromosomes, 55 VaZFP genes unevenly distributed on 17 chromosomes, and 54 VrZFP genes unevenly distributed on 17 chromosomes. Among these, VvZFP and VaZFP showed seven gene tandem duplications on chromosome 6, and VrZFP showed six gene tandem duplications on chromosome Chr1, suggesting that the ZFP genes among the three grapevine varieties share similar evolutionary characteristics and some selective variability (Figure 4A–C). In addition to tandem duplication, 19 segmental duplication events of VvZFP, 18 segmental duplication events of VrZFP, and nine segmental duplication events of VaZFP were observed using MCScanX methods (Figure 5A–C). The results of this study are consistent with those of a previous study [9]. It has been documented that gene duplication increases diversification relative to single gene-copy progenitors, leading to alterations in the genetic system and phenotype that are essential for evolutionary adaptation [41]. For example, the C-repeat binding factor (CBF) gene family based on gene duplication events expanded to six members in Arabidopsis; functional investigation of CBF1, 2, and 3, belonging to tandemly repeated genes, indicated that they were induced rapidly under low temperature [42], whereas CBF4 is induced in response to drought stress, which can be attributed to the diversification of promoter regulatory elements [43]. In the present study, we found similar or differential expression patterns between tandem repeat gene pairs, for example, the VvZFP12 and VvZFP24 gene pairs exhibited similar expression patterns under MeJA, ABA, SA, and 4 °C low-temperature stress (VvZFP12 was upregulated between 3 and 6 h of treatment, and VvZFP24 was upregulated between 12 and 24 h of treatment), whereas the VvZFP49 and VvZFP27 gene pairs exhibited differential expression patterns (VvZFP49 and VvZFP27 were upregulated at 3 h and 6 h when subjected to MeJA, ABA, and 4 °C cold stress treatments; under SA treatment, VvZFP49 was downregulated at 3 and 6 h, while VvZFP27 was upregulated). These results clearly indicate that evolutionary changes in the genome promote genetic diversity, flexibility, and adaptability and cause alterations in gene expression.
The rate of nonsynonymous (Ka) and synonymous (Ks) substitutions is the basis for evaluating the positive selection pressure of duplication events. Ka/Ks = 1 indicates neutral selection, Ka/Ks < 1 denotes purification selection, and Ka/Ks > 1 signifies positive selection [9]. In V. vinifera, 293 gene pairs exhibited Ka/Ks > 1, two gene pairs had Ka/Ks = 1, and 344 gene pairs had Ka/Ks < 1. In V. riparia, 350 gene pairs had Ka/Ks > 1, three gene pairs exhibited Ka/Ks = 1, and 189 gene pairs exhibited Ka/Ks < 1. In V. amurensis, 418 gene pairs had Ka/Ks > 1, seven gene pairs had Ka/Ks = 1, and 234 gene pairs had Ka/Ks < 1. These results showed that during evolution, the Q-type C2H2 ZFPs were dominated by purification selection in V. vinifera but by positive selection in V. amurensis and V. riparia [9]. RSCU is defined as the ratio of the observed frequency to the expected frequency of codons when all the synonymous codons for those amino acids are used equally [44]. RSCU > 1 indicates that the corresponding codon is used more frequently than expected, whereas RSCU < 1 indicates that the codon is used less frequently than expected [45]. RSCU of the VvZFPs, VrZFPs, and VaZFPs was determined by averaging the corresponding RSCU values of amino acids (Figures S1–S3). VvZFP, VrZFP, and VaZFP family members exhibit the preferential bias for A, U, and C at the third codon position, for example, Phe prefers codon UUC; Gln prefers CAA; Cys prefers UGC; Ser prefers UCU, UCC, and UCA; and Gly prefers GGU and GGA.

3.3. Responses to MeJA, ABA, SA, and Low-Temperature (4 °C) Treatments

Q-type C2H2 ZFPs have been reported to play a role in plant response to abiotic stresses [46,47]. Q-type ZFPs, TaZFP1B, and TaZFP2D are associated with aluminum tolerance and upregulated by H2O2 treatment in root tips [48]. Seven TaZFP genes upregulated under drought stress showed significant upregulation after ABA treatment [6]. The mRNA levels of eight genes, which were induced in response to drought in the leaves, remained stable throughout the 26 h ABA treatment [6]. Recently, the gene STZ/ZAT10 of A. thaliana was reported to be involved in the jasmonic signaling pathway [49]. MeJA treatment for 30 min had a slight effect on PtaZFP2 mRNA accumulation [50]. To verify whether the Q-type C2H2 ZFPs respond to exogenous hormones, in this study, we designed experiments and validated the results by determining the relative gene expression. Following the treatment with 100 μmol·L−1 MeJA for 3 h, 6 h, 12 h, and 24 h, VvZFP52, VvZFP10, VvZFP38, and VvZFP43 exhibited the highest relative expression levels of 58.94, 6824.21, 372.04, and 80.79, respectively, and reached their expression peaks at different time points. After treatment with 100 mmol·L−1 ABA for 3 h, VvZFP52 had the highest relative expression level of 224.92; Under ABA treatment for 6 h, VvZFP10 had the highest relative expression level of 6044.60, followed by VvZFP46 and VvZFP51, with the expression levels of 374.38 and 599.88, respectively. Under ABA treatment for 12 h, VvZFP31 had the highest relative expression levels of 31.78, respectively, whereas for 24 h, VvZFP32 exhibited the highest relative expression level of 29.02. Similarly, under 200 μmol·L−1 SA treatment for 3 h, VvZFP11 and VvZFP39 had the highest relative expression levels of 76.89 and 80.53, respectively; under 6 h SA treatment, VvZFP10 had the highest relative expression level of 1870.33, followed by VvZFP13, VvZFP46, VvZFP47, with relative expression levels of 201.19, 143.23, and 234.68, respectively; under 12 h SA treatment, VvZFP13 had the highest relative expression level of 431.72; and under SA treatment for 24 h, VvZFP24 exhibited the highest relative expression level of 21.47. These experimental results showed that Q-type C2H2 ZFPs in grapevine are differentially expressed at different hormone treatment stages and time points, suggesting that these genes exhibit different expression patterns in response to exogenous hormone treatments.
It has been demonstrated that TaZFP may have an important role in abiotic stress responses in wheat, as observed in other plants [46,47,51]. A study characterized the role of PtaZFP in poplar by analyzing the expression of two-fingered C2H2 ZFPs in different organs (leaf laminae, stems, and roots) and in response to cold stress (4 °C) [50]. SlCZFP1 was reported to promote cold tolerance in Solanum lycopersicum [52]. We experimentally verified whether the Q-type C2H2 ZFPs respond to 4 °C low-temperature stress and validated the results by determining the relative expression of the genes. Under 4 °C low-temperature stress for 3 h, VvZFP27 and VvZFP52 exhibited the highest relative expression levels of 51.77 and 64.0, respectively; after treatment for 6 h, VvZFP10 had the highest relative expression level of 5420.95; after treatment for 12 h, VvZFP7 had the highest relative expression level of 789.01; and after treatment for 24 h, VvZFP51 had the highest relative expression level of 8.27. These results suggest that the cis-acting elements of both VvZFP7 and VvZFP10 contain LTR elements. Our experimental results further indicated that Q-type C2H2 ZFPs in grapes are differentially expressed under low-temperature (4 °C) stress at different time points, suggesting that these genes exhibit differential expression patterns in response to low-temperature (4 °C) stress.

4. Materials and Methods

4.1. Identification of the VvZFP, VrZFP, and VaZFP Genes

The genome sequence information and gene annotation file (general feature format, GFF) of ‘Pinot noir’ (Vitis vinifera L.) were downloaded from Ensembl plants database (https://plants.ensembl.org/index.html, accessed on 18 April 2022). Whole genome information of ‘Shanputao’ (V. amurensis) was downloaded from the VITSGDB database (http://vitisgdb.ynau.edu.cn/downloads.html, accessed on 5 May 2021) [30], and the genome information of V. riparia was obtained from the NCBI database [53]. Fifty-seven ZFP amino acid sequences of Arabidopsis thaliana were obtained from the TAIR database (https://www.rabidopsis.org/, accessed on 23 August 2022).
To ensure the credibility of the results, two strategies were employed while identifying the ZFP gene family members of the grapevine. First, based on the hidden Markov model of the ZFP protein domain (PF00096), which was downloaded from the Pfam database (http://pfam.xfam.org/, accessed on 6 March 2021) as a query, the protein sequence data of the grapevine were searched using “hmmsearch” of HMMER 3.1 software. Second, a local BLAST database was generated using the whole genome protein sequences of grapevine, and 57 ZFP protein sequences of Arabidopsis were used as seed sequences to perform the local BLAST search with an E-value ≤ 1 × 10−5 [54]. The results obtained using the two methods were combined to remove redundant sequences. For conserved domain validation, the candidate ZFP protein sequences were submitted to the conserved domain database (CDD, https://www.ncbi.nlm.nih.gov/Structure/cdd/cdds.html, accessed on 12 June 2022) on the NCBI website and SMART (http://Smart.embl-Heidelberg.de/, accessed on 20 June 2022). Finally, manual screening was further performed to identify ZFP family members, and the proteins lacking specific structural domains of ZFP were removed.

4.2. Physicochemical Property and Subcellular Localization

The Compute pI/Mw tool on the online website Expasy (https://web.expasy.org/compute_pi/, accessed on 8 August 2022) was used to predict the isoelectric points (pI) and molecular weights of the VvZFP, VrZFP, VaZFP family members, and their subcellular localization was predicted using WoLF PSORT (https://www.expasy.org/compute_pi/ wolfpsort.hgc.jp/, accessed on 1 September 2022).

4.3. Analysis of Phylogenetic Clustering, Cis-Elements, and Protein Conserved Motifs

Multiple alignment of the protein sequences of V. vinifera, V. riparia, V. amurensis, and Arabidopsis was performed using ClustalW in MEGA7.0 [28], and a phylogenetic tree was constructed using the neighbor-joining (NJ) method. The method was executed using the following parameters: Jones–Talor–Thornton model, complete deletion, and 1000 repetitions.
To search for plant promoter cis-acting elements, the 2000-bp genome sequence upstream of the initiation codon of each VvZFP, VrZFP, and VaZFP gene was extracted from the grape whole genome database. The online database PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 10 September 2022) was used to predict cis-acting elements, and the data were visualized using Box Plot tools in Hiplot Pro (https://hiplot.com.cn/, accessed on 2 November 2022), which is a comprehensive web service for biomedical data analysis and visualization.
The online software Multiple Em for Motif Elicitation (MEME Suite 5.5.4) was used to identify the conserved motifs (motifs) in VvZFP, VrZFP, and VaZFP proteins; the maximum value of motifs was set to 15, whereas those of other parameters were set as default [55]. Finally, TBtools 1.118.0.0 software was used to visualize the conserved motifs of these genes [56].

4.4. Chromosomal Location Analysis of the VvZFP, VrZFP, VaZFP Genes

The Gene Location Visualize tool in TBtools 1.118.0.0 software was employed to generate chromosome-based localization plots for the genes [56], with grape genome data files and gene ID information as materials.

4.5. Codon Usage Bias Analysis

Codon usage bias refers to the uneven utilization of synonymous codons to encode for an amino acid. The characteristics of codon usage were examined by using coding sequences of the ZFP genes as the subject [57,58]. This analysis encompassed various aspects, such as the evaluation of RSCU, determination of the codon adaptation index (CAI) and codon bias index (CBI), assessment of the frequency of optimal codons (FOPs), and examination of GC3s and GCs. All analyses were performed using the web-based program CodonW 1.4.2. A heat map of RSCU values was drawn using TBtools 1.118.0.0 [36], draw parameters were set to the cluster method (Complete) and dist method (Euclidean). Furthermore, correlation analyses were conducted to explore the relationships between codon usage bias and parameters including T3s, C3s, A3s, G3s, GC, GC3s, CBI, FOPs, Nc, L_sym, L_aa, Gravy and Aromo.

4.6. Synteny and Evolution Selection Pressure Analyses

To analyze the synteny among different ZFP genes, we obtained the CDS.fasta files and transcripts.gff (or gff3) files for apple (Malus domestic), peach (Prunus persica), and Arabidopsis from the TIAR database. Using TBtools synteny, we identified the ZFP gene pairs and obtained the resulting diagram [56,59]. For duplicate gene pairs or triplicate gene groups (between any two genes within a triplicate gene group), we calculated the nonsynonymous substitution rate/synonymous substitution rate (Ka/Ks) values using the DnaSP 6.0, application developed by University of Barcelona.

4.7. Organization and qRT-PCR Expression Analyses of VvZFP Family Genes

Grapevine tissue-specific expression data were obtained using gene microarray data of the gene expression omnibus (GEO) database on the NCBI website (NCBI accession number: GSE36128), which comprises data from 54 tissue samples of grapevine at different developmental stages, including those of roots, stems, leaves, tendrils, floral organs, pulp, pericarp, and seeds [31]. All VvZFP gene expression data were extracted according to their homologous gene ID number; finally, data on the expression of 41 VvZFP genes were obtained. The FPKM value was normalized to Log2 (FPKM+1) for data processing, and a heat map of gene expression was drawn using TBtools 1.118.0.0 [56], draw parameters were set to cluster method (Complete) and dist method (Euclidean).
Grapevine suspension cells from ‘Pinot Noir’ were cultured in Gamborg B5 [60] liquid medium (consisting of 20 g·L−1 sucrose, 0.1 mg·L−1 naphthalene acetic acid, and 0.2 mg·L−1 kinetin; pH 6.0) in the Cell Culture Laboratory of Gansu Agricultural University. The grapevine suspension cells were collected through funnel filtration after seven days of culture, and 4 g of the cells were weighed and added to 20 mL of B5 liquid medium supplemented with abscisic acid (ABA) (100 mmol·L−1), MeJA (100 µmol·L−1), and SA (200 µmol·L−1). The mixture was also subjected to low-temperature (4 °C) treatment. ABA, MeJA, SA, and low-temperature treatments were given for 3, 6, 12, and 24 h by incubating the suspension cells on a shaker at 110 r/min and 25 °C in the dark. Each treatment was performed in three biological replicates. Untreated suspension cells at each time point were used as the control, and cell samples in each group were collected according to the treatment time and stored at −80 °C.
The total RNA of the preserved grapevine cells was extracted using the TRIzol Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions. cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). The SYBR® Premix Ex Taq ™ II (TaKaRa, Dalian, China) was used for quantitative PCR (qPCR) amplification. The primers of 52 VvZFP genes were designed and synthesized using online software by Shanghai Sangon Biotechnology Co. Ltd. (Table S1). The expression levels of VvZFP were normalized with elongation factor-1α (EF-1α, VIT_206S0004g03240) through real-time PCR by using the Light Cycler® 96 real-time PCR system (Roche, Basel, Switzerland). qRT-PCR was performed in the following steps: denaturation at 95 °C for 30 s; amplification in a two-step procedure: denaturation for 15 s, and 40 cycles of annealing and extension for 60 s at 60 °C. The relative expression of the genes was calculated using 2−∆∆Ct method [38]. Statistical analysis was performed using SPSS version 26.0, pairwise comparison using the LSD method. The plot of gene expression was generated using R software (v.4.2.2) package “ggpubr” (v0.4.0) [61] and “ggplot2” (v3.4.2) [62] through Hiplot Pro (https://hiplot.com.cn/, accessed on 3 April 2023), a comprehensive web service for biomedical data analysis and visualization.

4.8. Cloning and Subcellular Localization Analysis of VvZFP10 and VvZFP46

Primer sequences for cloning VvZFP10 were as follows: ZFP10-F: 5′-AGAACACGG GGGACGAGCTCATGGAACAACTAAGGAAGGAGCCAT-3′ and ZFP10-R 5′-ACATG GTGTCGACTCTAGAGAGCTTGAGAG ACAAGTCAAGTTTC-3′; primers for VvZFP46 were: ZFP46-F: 5′-AGAACACGGGGGACGAGCTCATGGAGAAGCACAAGTGCAAG CTG-3′ and ZFP46-R 5′-ACCATGGTGTCGACTCTGATCGTCTGATGGGGTTCACGAA C-3′. The amplification reaction included a denaturation step at 98 °C for 3 min, followed by 35 cycles of annealing for 10 s at 98 °C and for 30 s at 68 °C, and final extension at 72 °C for 5 min. PCR products were recovered using TaKaRa Gel Recovery Kit (TaKaRa, Dalian, China) and ligated into a PCAMBIA2300-GFP vector. Finally, the vector was transformed into Escherichia coli DH5α, and sequencing was performed after amplification by Shanghai Sangon Biotechnology Co. Ltd.
To determine the subcellular localization of VvZFP10 and VvZFP46, the successfully sequenced plasmids of the above-mentioned vector for pCAMBIA2300-VvZFP10-GFP and pCAMBIA2300-VvZFP46-GFP were transferred into Agrobacterium tumefaciens GV1303. Then, the bacterial suspension was injected into the abaxial surface of Nicotiana benthamiana leaves, which were incubated in the dark for 24 h and then transferred to an incubator for 2 days. The fluorescence signal was observed using laser confocal microscopy.

5. Conclusions

In this study, a total of 52 Q-type VvZFPs, 54 Q-type VrZFPs, and 55 Q-type VaZFPs were identified in the three grapevine genomes, respectively, and found that there was a difference in the physical and chemical properties, chromosome localization, gene structure, conserved motif and cis-acting elements of promoter among VvZFPs, VrZFPs and VaZFPs. Additionally, the collinearity analysis revealed 19 VvZFP gene pairs, 18 VrZFP gene pairs, and 9 VaZFP gene pairs. Further, we performed the interspecies collinearity analysis between the ZFPs of grape and the other five species, which revealed 326 pairs of collinear genes. These pairs of homologous genes are functionally similar, and the expansion of ZFP in grapevine was dominated by segment duplication and tandem duplication events. Finally, the expression patterns of VvZFPs under MeJA, ABA, SA and 4 °C revealed that Q-type C2H2 ZFP-encoding genes in grapevine involved in response to exogenous hormones and low-temperature tolerance, which lays the foundation for further study of grapevine ZFP gene function and the development of resistant germplasm resources in the future.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms242015180/s1.

Author Contributions

Conceptualization, M.C. and B.C.; methodology, M.C., W.L.; software, Z.B. and T.W.; validation, M.C., T.W. and Y.L.; formal analysis, M.C. and Y.L.; writing—original draft preparation, M.C.; writing—review and editing, J.M. and B.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work has been supported by Scientific research start-up funds for openly-recruited doctors (2017RCZX-45), the Special funds for discipline construction of Gansu Agricultural University (GAU-XKJS-2018-229), the National Natural Science Foundation of China (32060671), Young scientific and technological talents project of Gansu Province (GXH20210611-01), and Gansu Province Science and Technology Foundation for Youth (20JR5RA020).

Institutional Review Board Statement

No applicable.

Informed Consent Statement

No applicable.

Data Availability Statement

Data will be made available on request.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

ZFP: zinc finger protein; ABA: abscisic acid; SA: salicylic acid; MeJA: methyl jasmonate; NJ: Neighbor-joining method; pI: theoretical isoelectric point; Ks: synonymous substitution; Ka: non-synonymous substitution; T3s, C3s, A3s, G3s: the T, C, A, and G content of the third position of the synonymous codon, respectively; CAI: the codon adaptation index; CBI: the codon bias index; FOP: the frequency of optimal codons; GC3s: the amount of the third codon (G + C); GC: GC count of genes. GC3s: the amount of the third codon; Nc: number of codons; L_sym: number of symmetry codon; L_aa: number of synonymous and non-synonymous codons; Gravy: Hydrophobicity of protein; Aromo: aromaticity of protein; qRT-PCR: quantitative real-time PCR; ABREs: ABA response elements; DRE: drought response element; low temperature-response elements (LTR); ARE: anaerobic induction; CBF: C-repeat Binding Factor.

References

  1. Pavletich, N.; Pabo, C. Zinc finger-DNA recognition: Crystal structure of a Zif268-DNA complex at 2.1 A. Science 1991, 252, 809. [Google Scholar] [CrossRef] [PubMed]
  2. Kim, C.A.; Berg, J.M. A 2.2 resolution crystal structure of a designed zinc finger protein bound to DNA. Nat. Struct. Bol. 1996, 3, 940–945. [Google Scholar] [CrossRef] [PubMed]
  3. Kim, S.H.; Hong, J.K.; Lee, S.C.; Sohn, K.H.; Jung, H.W.; Hwang, B.K. CAZFP1, Cys2/His2-type zinc-finger transcription factor gene functions as a pathogen-induced early-defense gene in Capsicum annuum. Plant Mol. Biol. 2004, 55, 883–904. [Google Scholar] [CrossRef] [PubMed]
  4. Takatsuji, H.; Mori, M.; Benfey, P.N.; Ren, L.; Chua, N.H. Characterization of a zinc finger DNA-binding protein expressed specifically in Petunia petals and seedlings. EMBO J. 1992, 11, 241–249. [Google Scholar] [CrossRef] [PubMed]
  5. Kubo, K.-I.; Sakamoto, A.; Kobayashi, A.; Rybka, Z.; Kanno, Y.; Nakagawa, H.; Nishino, T.; Takatsuji, H. Cys2/His2 zinc-finger protein family of petunia: Evolution and general mechanism of target-sequence recognition. Nucleic Acids Res. 1998, 26, 608–615. [Google Scholar] [CrossRef]
  6. Kam, J.; Gresshoff, P.M.; Shorter, R.; Xue, G.-P. The Q-type C2H2 zinc finger subfamily of transcription factors in Triticum aestivum is predominantly expressed in roots and enriched with members containing an EAR repressor motif and responsive to drought stress. Plant Mol. Biol. 2008, 67, 05–322. [Google Scholar] [CrossRef]
  7. Kim, S.H.; Ahn, Y.O.; Ahn, M.-J.; Jeong, J.C.; Lee, H.-S.; Kwak, S.-S. Cloning and characterization of an Orange gene that increases carotenoid accumulation and salt stress tolerance in transgenic sweetpotato cultures. Plant Physiol. Biochem. 2013, 70, 445–454. [Google Scholar] [CrossRef] [PubMed]
  8. Wang, F.; Tong, W.; Zhu, H.; Kong, W.; Peng, R.; Liu, Q.; Yao, Q. A novel Cys(2)/His(2) zinc finger protein gene from sweetpotato, IbZFP1, is involved in salt and drought tolerance in transgenic Arabidopsis. Planta 2016, 243, 783–797. [Google Scholar] [CrossRef]
  9. Liu, Z.; Coulter, J.A.; Li, Y.; Zhang, X.; Meng, J.; Zhang, J.; Liu, Y. Genome-wide identification and analysis of the Q-type C2H2 gene family in potato (Solanum tuberosum L.). Int. J. Biol. Macromol. 2020, 153, 327–340. [Google Scholar] [CrossRef]
  10. Zhang, S.; Liu, J.; Zhong, G.; Wang, B. Genome-Wide Identification and Expression Patterns of the C2H2-Zinc Finger Gene Family Related to Stress Responses and Catechins Accumulation in Camellia sinensis [L.] O. Kuntze. Int. J. Mol. Sci. 2021, 22, 4197. [Google Scholar] [CrossRef]
  11. Sun, S.; Wang, B.; Jiang, Q.; Li, Z.; Jia, S.; Wang, Y.; Guo, H. Genome-wide analysis of BpDof genes and the tolerance to drought stress in birch (Betula platyphylla). PeerJ 2021, 9, 11938. [Google Scholar] [CrossRef] [PubMed]
  12. Vogel, V. Mechanotransduction Involving Multimodular Proteins: Converting Force into Biochemical Signals. Annu. Rev. Biophys. Biomol. Struct. 2006, 35, 459–488. [Google Scholar] [CrossRef]
  13. Rizhsky, L.; Davletova, S.; Liang, H.; Mittler, R. The Zinc Finger Protein Zat12 Is Required for Cytosolic Ascorbate Peroxidase 1 Expression during Oxidative Stress in Arabidopsis. J. Biol. Chem. 2004, 279, 11736–11743. [Google Scholar] [CrossRef] [PubMed]
  14. Davletova, S.; Schlauch, K.; Coutu, J.; Mittler, R. The zinc-finger protein Zat12 plays a central role in reactive oxygen and abiotic stress signaling in Arabidopsis. Plant Physiol. 2005, 139, 847–856. [Google Scholar] [CrossRef]
  15. Mittler, R.; Kim, Y.; Song, L.; Coutu, J.; Coutu, A.; Ciftci-Yilmaz, S.; Lee, H.; Stevenson, B.; Zhu, J.-K. Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Lett. 2006, 580, 6537–6542. [Google Scholar] [CrossRef]
  16. Chinnusamy, V.; Zhu, J.; Zhu, J.K. Gene regulation during cold acclimation in plants. Physiol. Plant. 2010, 126, 52–61. [Google Scholar] [CrossRef]
  17. Kim, J.C.; Lee, S.H.; Cheong, Y.H.; Yoo, C.-M.; Lee, S.I.; Chun, H.J.; Yun, D.-J.; Hong, J.C.; Lee, S.Y.; Lim, C.O.; et al. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants. Plant J. 2001, 25, 247–259. [Google Scholar] [CrossRef]
  18. Ciftci-Yilmaz, S.; Morsy, M.R.; Song, L.; Coutu, A.; Krizek, B.A.; Lewis, M.W.; Warren, D.; Cushman, J.; Connolly, E.L.; Mittler, R. The EAR-motif of the Cys2/His2-type Zinc Finger Protein Zat7 Plays a Key Role in the Defense Response of Arabidopsis to Salinity Stress. J. Biol. Chem. 2007, 282, 9260–9268. [Google Scholar] [CrossRef] [PubMed]
  19. Huang, J.; Yang, X.; Wang, M.-M.; Tang, H.-J.; Ding, L.-Y.; Shen, Y.; Zhang, H.-S. A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif plays a role in salt tolerance. Biochim. Biophys. Acta 2007, 1769, 220–227. [Google Scholar] [CrossRef]
  20. Sugano, S.; Kaminaka, H.; Rybka, Z.; Catala, R.; Salinas, J.; Matsui, K.; Ohme-Takagi, M.; Takatsuji, H. Stress-responsive zinc finger geneZPT2-3plays a role in drought tolerance in petunia. Plant J. 2003, 36, 830–841. [Google Scholar] [CrossRef]
  21. Sakamoto, H.; Maruyama, K.; Sakuma, Y.; Meshi, T.; Iwabuchi, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant Physiol. 2004, 136, 2734–2746. [Google Scholar] [CrossRef] [PubMed]
  22. Chinnusamy, V.; Schumaker, K.; Zhu, J.-K. Molecular genetic perspectives on cross-talk and specificity in abiotic stress signalling in plants. J. Exp. Bot. 2004, 55, 225–236. [Google Scholar] [CrossRef] [PubMed]
  23. Englbrecht, C.C.; Schoof, H.; Böhm, S. Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC Genom. 2004, 5, 39. [Google Scholar] [CrossRef] [PubMed]
  24. Minglei, Y.; Jiangtao, C.; Dawei, W.; Junhua, H.; Hua, W.; Daping, G.; Liu, G. Genome-wide identification and expression profiling of the C2H2 type zinc finger protein transcription factor family in tobacco. Hereditas 2016, 38, 337–349. [Google Scholar] [CrossRef]
  25. Zhang, S. Genome-wide Identification and Characterization of Zinc Finger Proteins in Cucumber. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2017. [Google Scholar]
  26. Agarwal, P.; Arora, R.; Ray, S.; Singh, A.K.; Singh, V.P.; Takatsuji, H.; Kapoor, S.; Tyagi, A.K. Genome-wide identification of C2H2 zinc-finger gene family in rice and their phylogeny and expression analysis. Plant Mol. Biol. 2007, 65, 467–485. [Google Scholar] [CrossRef] [PubMed]
  27. Liu, Q.; Wang, Z.; Xu, X.; Zhang, H.; Li, C. Genome-Wide Analysis of C2H2 Zinc-Finger Family Transcription Factors and Their Responses to Abiotic Stresses in Poplar (Populus trichocarpa). PLoS ONE 2015, 10, e0134753. [Google Scholar] [CrossRef]
  28. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  29. Pabo, C.O.; Peisach, E.; Grant, R.A. Design and selection of novel Cys2His2 zinc finger proteins. Annu. Rev. Biochem. 2001, 70, 313–340. [Google Scholar] [CrossRef] [PubMed]
  30. Wang, Y.; Xin, H.; Fan, P.; Zhang, J.; Liu, Y.; Dong, Y.; Wang, Z.; Yang, Y.; Zhang, Q.; Ming, R. The genome of Shanputao (Vitis amurensis) provides a new insight into cold tolerance of grapevine. Plant J. 2021, 105, 1495–1506. [Google Scholar] [CrossRef]
  31. Fasoli, M.; Dal Santo, S.; Zenoni, S.; Tornielli, G.B.; Farina, L.; Zamboni, A.; Porceddu, A.; Venturini, L.; Bicego, M.; Murino, V. The Grapevine Expression Atlas Reveals a Deep Transcriptome Shift Driving the Entire Plant into a Maturation Program. Plant Cell Online 2012, 24, 3489–3505. [Google Scholar] [CrossRef]
  32. Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real-time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef] [PubMed]
  33. Sakamoto, A.; Minami, M.; Huh, G.H.; Iwabuchi, M. The putative zinc-finger protein WZF1 interacts with a cis-acting element of wheat histone genes. Eur. J. Biochem. 1993, 217, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
  34. Lawrence, S.D.; Novak, N.G. The remarkable plethora of infestation-responsive Q-type C2H2 transcription factors in potato. BMC Res. Notes 2018, 11, 398. [Google Scholar] [CrossRef] [PubMed]
  35. Ohta, M.; Matsui, K.; Hiratsu, K.; Shinshi, H.; Ohme-Takagi, M. Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 2001, 13, 1959–1968. [Google Scholar] [CrossRef] [PubMed]
  36. Hiratsu, K.; Ohta, M.; Matsui, K.; Ohme-Takagi, M. The SUPERMAN protein is an active repressor whose carboxy-terminal repression domain is required for the development of normal flowers. FEBS Lett. 2002, 514, 351–354. [Google Scholar] [CrossRef] [PubMed]
  37. Sekimata, M. Sequence-specific transcriptional repression by an MBD2-interacting zinc finger protein MIZF. Nucleic Acids Res. 2004, 32, 590–597. [Google Scholar] [CrossRef] [PubMed]
  38. Uehara, Y.; Takahashi, Y.; Berberich, T.; Miyazaki, A.; Takahashi, H.; Matsui, K.; Ohme-Takagi, M.; Saitoh, H.; Terauchi, R.; Kusano, T. Tobacco ZFT1, a Transcriptional Repressor with a Cys2/His2 Type Zinc Finger Motif that Functions in Spermine-Signaling Pathway. Plant Mol. Biol. 2005, 59, 435–448. [Google Scholar] [CrossRef] [PubMed]
  39. Sateesh, K.; Kevin, R. EAR motif-mediated transcriptional repression in plants: An underlying mechanism for epigenetic regulation of gene expression. Epigenetics 2011, 6, 141–146. [Google Scholar] [CrossRef]
  40. Sakamoto, H.; Araki, T.; Meshi, T.; Iwabuchi, M. Expression of a subset of the Arabidopsis Cys(2)/His(2)-type zinc-finger protein gene family under water stress. Genes 2000, 248, 23–32. [Google Scholar] [CrossRef]
  41. Otto, S.P.; Whitton, J. Polyploid incidence and evolution. Annu. Rev. Genet. 2000, 34, 401–437. [Google Scholar] [CrossRef] [PubMed]
  42. Gilmour, S.J.; Zarka, D.G.; Stockinger, E.J.; Salazar, M.P.; Houghton, J.M.; Thomashow, M.F. Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J. 1998, 16, 433–442. [Google Scholar] [CrossRef] [PubMed]
  43. Haake, V.; Cook, D.; Riechmann, J.L.; Pineda, O.; Thomashow, M.F.; Zhang, J.Z. Transcription Factor CBF4 Is a Regulator of Drought Adaptation in Arabidopsis. Plant Physiol. 2002, 130, 639–648. [Google Scholar] [CrossRef]
  44. Sharp, P.M.; Li, W.H. The codon Adaptation Index—A measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 1987, 15, 1281–1295. [Google Scholar] [CrossRef] [PubMed]
  45. Sau, K.; Sau, S.; Mandal, S.C.; Ghosh, T.C. Factors Influencing the Synonymous Codon and Amino Acid Usage Bias in AT-rich Pseudomonas aeruginosa Phage PhiKZ. Acta Biochim. Biophys. Sin. 2010, 37, 625–633. [Google Scholar] [CrossRef] [PubMed]
  46. Kielbowicz-Matuk, A. Involvement of plant C2H2-type zinc finger transcription factors in stress responses. Plant Sci. 2012, 185, 78–85. [Google Scholar] [CrossRef]
  47. Zhang, H.; Liu, Y.; Wen, F.; Yao, D.; Wang, L.; Guo, J.; Ni, L.; Zhang, A.; Tan, M.; Jiang, M. A novel rice C2H2-type zinc finger protein, ZFP36, is a key player involved in abscisic acid-induced antioxidant defence and oxidative stress tolerance in rice. J. Exp. Bot. 2014, 65, 5795–5809. [Google Scholar] [CrossRef]
  48. Ali-Benali, M.A.; Badawi, M.; Houde, Y.; Houde, M. Identification of oxidative stress-responsive C2H2 zinc fingers associated with Al tolerance in near-isogenic wheat lines. Plant Soil 2013, 366, 199–212. [Google Scholar] [CrossRef]
  49. Pauwels, L.; Morreel, K.; De Witte, E.; Lammertyn, F.; Van Montagu, M.; Boerjan, W.; Inzé, D.; Goossens, A. Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Ara-bidopsis cells. Proc. Natl. Acad. Sci. USA 2008, 105, 1380–1385. [Google Scholar] [CrossRef] [PubMed]
  50. Gourcilleau, D.; Lenne, C.; Armenise, C.; Moulia, B.; Julien, J.L.; Bronner, G.; Leblanc-Fournier, N. Phylogenetic Study of Plant Q-type C2H2 Zinc Finger Proteins and Expression Analysis of Poplar Genes in Response to Osmotic, Cold and Mechanical Stresses. DNA Res. 2011, 18, 77–92. [Google Scholar] [CrossRef]
  51. Ciftci-Yilmaz, S.; Mittler, R. The zinc finger network of plants. Cellular and molecular life sciences. Cell Mol. Life Sci. 2008, 65, 1150–1160. [Google Scholar] [CrossRef]
  52. Zhang, H.; Ni, L.; Liu, Y.; Wang, Y.; Zhang, A.; Tan, M.; Jiang, M. The C2H2-type Zinc Finger Protein ZFP182 is Involved in Abscisic Acid-Induced Antioxidant Defense in Rice. J. Integr. Plant Biol. 2012, 54, 500–510. [Google Scholar] [CrossRef] [PubMed]
  53. Girollet, N.; Rubio, B.; Lopez-Roques, C.; Valière, S.; Ollat, N.; Bert, P.-F. De novo phased assembly of the Vitis riparia grape genome. Sci. Data 2019, 6, 127. [Google Scholar] [CrossRef] [PubMed]
  54. Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]
  55. Bailey, T.L.; Gribskov, M. Combining evidence using p-values: Application to sequence homology searches. Bioinformatics 1998, 14, 48–54. [Google Scholar] [CrossRef] [PubMed]
  56. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  57. Hershberg, R.; Petrov, D.A. Selection on codon bias. Annu. Rev. Genet. 2008, 42, 287–299. [Google Scholar] [CrossRef] [PubMed]
  58. Plotkin, J.B.; Kudla, G. Synonymous but not the same: The causes and consequences of codon bias. Nat. Rev. Genet. 2011, 12, 32–42. [Google Scholar] [CrossRef] [PubMed]
  59. Yupeng, W.; Haibao, T.; Debarry, J.D.; Xu, T.; Jingping, L.; Xiyin, W.; Tae-Ho, L.; Huizhe, J.; Barry, M.; Hui, G. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  60. Gamborg, O.L.; Miller, R.A.; Ojima, K. Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res. 1968, 50, 151–158. [Google Scholar] [CrossRef] [PubMed]
  61. Kassambara, A. ‘ggplot2’ Based Publication Ready Plots, Version 0.1.0; R Foundation: Ames, IA, USA, 2017.
  62. Villanueva, R.A.M.; Chen, Z.J. Ggplot2: Elegant Graphics for Data Analysis (2nd ed.). Meas-Interdiscip. Res. 2019, 17, 160–167. [Google Scholar] [CrossRef]
Ijms 24 15180 g001
Figure 1. Phylogenetic analysis of ZFP Proteins in Arabidopsis thaliana (At), Vitis vinifera (Vv), Vitis amurensis (Va), and Vitis riparia (Vr). Note: The amino acid sequences of ZFP proteins were aligned using ClustalX, and a phylogenetic tree was constructed using the neighbor-joining method (NJ) method in MEGA 7.0 [28]. Each node is represented by a number that indicates the bootstrap value for 1000 replicates. The subgroups are marked by a colorful background.
Figure 1. Phylogenetic analysis of ZFP Proteins in Arabidopsis thaliana (At), Vitis vinifera (Vv), Vitis amurensis (Va), and Vitis riparia (Vr). Note: The amino acid sequences of ZFP proteins were aligned using ClustalX, and a phylogenetic tree was constructed using the neighbor-joining method (NJ) method in MEGA 7.0 [28]. Each node is represented by a number that indicates the bootstrap value for 1000 replicates. The subgroups are marked by a colorful background.
Ijms 24 15180 g001
Ijms 24 15180 g002
Figure 2. Phylogenetic relationships, gene structure, and architecture of conserved protein motifs in VvZFPs, VaZFPs, and VrZFPs. (A) The phylogenetic tree was constructed based on the protein sequences of ZFPs using MEGA 7.0 software with NJ method, bootstrap replicated 1000 times [28], Details of clusters are shown in different colors. (B) The motif composition of ZFP members; the motifs, numbered 1–15, are displayed in different colored boxes. (C) Exon–intron structure of ZFPs, Yellow boxes indicate untranslated 5′- and 3′-regions; green boxes indicate exons; and green lines indicate introns.
Figure 2. Phylogenetic relationships, gene structure, and architecture of conserved protein motifs in VvZFPs, VaZFPs, and VrZFPs. (A) The phylogenetic tree was constructed based on the protein sequences of ZFPs using MEGA 7.0 software with NJ method, bootstrap replicated 1000 times [28], Details of clusters are shown in different colors. (B) The motif composition of ZFP members; the motifs, numbered 1–15, are displayed in different colored boxes. (C) Exon–intron structure of ZFPs, Yellow boxes indicate untranslated 5′- and 3′-regions; green boxes indicate exons; and green lines indicate introns.
Ijms 24 15180 g002
Ijms 24 15180 g003
Figure 3. Distribution of major stress- and hormone response-related cis-acting regulatory elements in the promoters of VvZFP, VrZFP, and VaZFP genes. Note: Different colors represent different genes, the location of the circle corresponds to the corresponding cis-acting element, and the size of the circle represents the number of corresponding cis-elements.
Figure 3. Distribution of major stress- and hormone response-related cis-acting regulatory elements in the promoters of VvZFP, VrZFP, and VaZFP genes. Note: Different colors represent different genes, the location of the circle corresponds to the corresponding cis-acting element, and the size of the circle represents the number of corresponding cis-elements.
Ijms 24 15180 g003
Ijms 24 15180 g004
Figure 4. Chromosomal distributions of ZFP family genes in Vitis vinifera, Vitis amurensis, and Vitis riparia. Note: The physical positions of ZFP were mapped according to the grape genome, the left scale for the chromosomal length is mega bases (Mb), and the chromosome number is shown at the right of each chromosome. The color on the chromosome indicates the density of genes, with red indicating the highest density and blue indicating the lowest density. (A) Chromosome distribution of VvZFPs, (B) chromosome distribution of VaZFPs, (C) chromosome distribution of VrZFPs.
Figure 4. Chromosomal distributions of ZFP family genes in Vitis vinifera, Vitis amurensis, and Vitis riparia. Note: The physical positions of ZFP were mapped according to the grape genome, the left scale for the chromosomal length is mega bases (Mb), and the chromosome number is shown at the right of each chromosome. The color on the chromosome indicates the density of genes, with red indicating the highest density and blue indicating the lowest density. (A) Chromosome distribution of VvZFPs, (B) chromosome distribution of VaZFPs, (C) chromosome distribution of VrZFPs.
Ijms 24 15180 g004
Ijms 24 15180 g005
Figure 5. Schematics for the chromosomal distribution, interchromosomal relationships, Ka/Ks, and codon usage bias analysis of ZFP genes in the three grape species genomes. Note: (A–C), Syntenic relationship of ZFP in V. vinifera, V. riparia, and V. amurensis, respectively, genes in gray lines indicate all synteny blocks in the grape genome, and the red lines indicate duplicated VvZFP, VrZFP, VaZFP gene pairs; the chromosome number is indicated at the bottom of each chromosome. (D–F), Codon usage indexes correlation analysis of VvZFPs, VrZFPs, and VaZFPs, respectively; blue represents positive correlation, red represents negative correlation, and white represents no correlation; the larger the circle and the darker the color, the stronger the correlation and vice versa; “T3s, C3s, A3s, G3s”: refer to the T, C, A, and G content of the third position of the synonymous codon, respectively; “CAI” refers to the codon adaptation index; “CBI” refers to the codon bias index; “FOP” refers to the frequency of optimal codons; “GC3s” refers to the amount of the third codon (G+C); “GC” refers to the count of genes (G+C). “GC3s” refers to the amount of the third codon; “Nc”: refers to the number of codon; “L_sym” refer to the degeneracy of Symmetry codon; “L_aa”: refers to the number of synonymous and non-synonymous codons; “Gravy”: refers to hydrophobicity of protein; “Aromo”: refers to aromaticity of protein. (G–I), the Ka/Ks analysis of VvZFPs, VrZFPs, and VaZFPs, respectively; purple represents Ka/Ks of VvZFPs, blue represents Ka/Ks of VrZFPs, orange represents Ka/Ks of VaZFPs.
Figure 5. Schematics for the chromosomal distribution, interchromosomal relationships, Ka/Ks, and codon usage bias analysis of ZFP genes in the three grape species genomes. Note: (A–C), Syntenic relationship of ZFP in V. vinifera, V. riparia, and V. amurensis, respectively, genes in gray lines indicate all synteny blocks in the grape genome, and the red lines indicate duplicated VvZFP, VrZFP, VaZFP gene pairs; the chromosome number is indicated at the bottom of each chromosome. (D–F), Codon usage indexes correlation analysis of VvZFPs, VrZFPs, and VaZFPs, respectively; blue represents positive correlation, red represents negative correlation, and white represents no correlation; the larger the circle and the darker the color, the stronger the correlation and vice versa; “T3s, C3s, A3s, G3s”: refer to the T, C, A, and G content of the third position of the synonymous codon, respectively; “CAI” refers to the codon adaptation index; “CBI” refers to the codon bias index; “FOP” refers to the frequency of optimal codons; “GC3s” refers to the amount of the third codon (G+C); “GC” refers to the count of genes (G+C). “GC3s” refers to the amount of the third codon; “Nc”: refers to the number of codon; “L_sym” refer to the degeneracy of Symmetry codon; “L_aa”: refers to the number of synonymous and non-synonymous codons; “Gravy”: refers to hydrophobicity of protein; “Aromo”: refers to aromaticity of protein. (G–I), the Ka/Ks analysis of VvZFPs, VrZFPs, and VaZFPs, respectively; purple represents Ka/Ks of VvZFPs, blue represents Ka/Ks of VrZFPs, orange represents Ka/Ks of VaZFPs.
Ijms 24 15180 g005
Ijms 24 15180 g006
Figure 6. Synteny analysis of VvZFP genes of the five plant species. Note: Gray lines in the background indicate the collinear blocks within Arabidopsis thaliana and Vitis vinifera; Malus domestica and Vitis vinifera; Prunus persica and Vitis vinifera; Musa acuminata and Vitis vinifera; and Solanum lycopersicum and Vitis vinifera genomes, while the red lines highlight the syntenic VvZFP gene pairs among grape and other five plant species genomes.
Figure 6. Synteny analysis of VvZFP genes of the five plant species. Note: Gray lines in the background indicate the collinear blocks within Arabidopsis thaliana and Vitis vinifera; Malus domestica and Vitis vinifera; Prunus persica and Vitis vinifera; Musa acuminata and Vitis vinifera; and Solanum lycopersicum and Vitis vinifera genomes, while the red lines highlight the syntenic VvZFP gene pairs among grape and other five plant species genomes.
Ijms 24 15180 g006
Ijms 24 15180 g007
Figure 7. Hierarchical clustering of the expression profiles of 41 VvZFP genes in different tissues of grapevine at different growth and development stages. Note: Heatmaps were plotted using gene expression data of genechip microarrays, which were obtained from the GEO database on the NCBI website (NCBI accession number: GSE36128) [31]. The FPKM value was normalized to Log2 (FPKM+1) for data processing. Red and green shades represent the upregulated and downregulated expression levels, respectively. The scale denotes the relative expression level.
Figure 7. Hierarchical clustering of the expression profiles of 41 VvZFP genes in different tissues of grapevine at different growth and development stages. Note: Heatmaps were plotted using gene expression data of genechip microarrays, which were obtained from the GEO database on the NCBI website (NCBI accession number: GSE36128) [31]. The FPKM value was normalized to Log2 (FPKM+1) for data processing. Red and green shades represent the upregulated and downregulated expression levels, respectively. The scale denotes the relative expression level.
Ijms 24 15180 g007
Ijms 24 15180 g008
Figure 8. The expression of VvZFP genes under MeJA treatment. Note: The suspension cells samples were collected after 3 h, 6 h, 12 h and 24 h under 100 μM·L−1 MeJA. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Figure 8. The expression of VvZFP genes under MeJA treatment. Note: The suspension cells samples were collected after 3 h, 6 h, 12 h and 24 h under 100 μM·L−1 MeJA. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Ijms 24 15180 g008
Ijms 24 15180 g009
Figure 9. The expression of VvZFP genes under ABA treatment. Note: The suspension cells samples were collected after 3 h, 6 h, 12 h and 24 h under 100 μM·L−1 ABA. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Figure 9. The expression of VvZFP genes under ABA treatment. Note: The suspension cells samples were collected after 3 h, 6 h, 12 h and 24 h under 100 μM·L−1 ABA. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Ijms 24 15180 g009
Ijms 24 15180 g010
Figure 10. The expression of VvZFP genes under SA treatment. Notes: The suspension cells samples were collected after 3 h, 6 h, 12 h and 24 h under 200 μM·L−1 SA. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Figure 10. The expression of VvZFP genes under SA treatment. Notes: The suspension cells samples were collected after 3 h, 6 h, 12 h and 24 h under 200 μM·L−1 SA. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Ijms 24 15180 g010
Ijms 24 15180 g011
Figure 11. The expression of VvZFP genes under 4 °C treatment. Notes: The suspension cell samples were collected after 3 h, 6 h, 12 h and 24 h under 4 °C. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Figure 11. The expression of VvZFP genes under 4 °C treatment. Notes: The suspension cell samples were collected after 3 h, 6 h, 12 h and 24 h under 4 °C. Untreated suspension cells at each time point were as control, respectively. The expression levels of VvZFPs were normalized with elongation factor-1α (EF-1α), and the relative expression was calculated using the 2−∆∆Ct method [32]. Error bars represent the standard deviation for three biological replicates. Statistical analysis was performed using SPSS version 26.0, with pairwise comparison using the LSD method (‘*’ represents p < 0.05; ‘**’ represents p < 0.01).
Ijms 24 15180 g011
Ijms 24 15180 g012
Figure 12. Subcellular localization of VvZFP10 and VvZFP46 proteins. Note: GFP stands for green fluorescence field, DAPI stands for DAPI field (cell nuclear staining), CHI stands for chloroplast autofluorescence field, DIC stands for bright field, and Merge stands for superimposed field. Excitation light wavelengths: GFP field: 488 nm, DAPI field: 358 nm, CHI field: 488 nm. Note: green fluorescence and chloroplast autofluorescence excitation light wavelengths were the same, and the acquisition light wavelengths were different. Bars = 20 μM.
Figure 12. Subcellular localization of VvZFP10 and VvZFP46 proteins. Note: GFP stands for green fluorescence field, DAPI stands for DAPI field (cell nuclear staining), CHI stands for chloroplast autofluorescence field, DIC stands for bright field, and Merge stands for superimposed field. Excitation light wavelengths: GFP field: 488 nm, DAPI field: 358 nm, CHI field: 488 nm. Note: green fluorescence and chloroplast autofluorescence excitation light wavelengths were the same, and the acquisition light wavelengths were different. Bars = 20 μM.
Ijms 24 15180 g012
Table 1. Physical and chemical properties of ZFP genes in grapes.
Table 1. Physical and chemical properties of ZFP genes in grapes.
Gene
Name		Gene IDChr: Start..EndCDS
(bp)		Peptide
(aa)		MW
(Da)		pIAliphatic
Index		Instability
Index		Subcellular
Localization		Alpha
Helix (%)		Extended
Strand (%)		Beta
Turn (%)		Random
Coil (%)
VvZFP1Vitvi01g00063Chr1: 616,107..617,675157252357,541.708.8261.6348.42Nucleus.32.8817.370.0049.75
VvZFP2Vitvi01g01939Chr1: 3,252,820..3,255,454105635137,407.677.5559.0350.27Nucleus.32.5916.040.0051.37
VvZFP3Vitvi01g00309Chr1: 3,422,695..3,423,36066922223,139.718.3756.2453.3Nucleus.27.9722.150.0049.87
VvZFP4Vitvi01g00529Chr1: 6,009,188..6,009,92874424726,776.905.4365.8553.07Nucleus.31.9517.080.0050.97
VvZFP5Vitvi01g00845Chr1: 9,724,651..9,725,54189429733,581.029.1058.5464.60Nucleus.10.8612.003.7173.43
VvZFP6Vitvi02g00686Chr2: 7,241,834..7,242,58666622124,181.375.0655.0961.21Nucleus.26.368.642.7362.27
VvZFP7Vitvi03g00230Chr3: 2,660,982..2,661,95078926228,337.088.4269.9658.16Nucleus.14.9413.793.8367.43
VvZFP8Vitvi03g00582Chr3: 6,548,735..6,549,30457319021,159.716.5257.8350.21Nucleus.29.638.471.5960.32
VvZFP9Vitvi03g00630Chr3: 7,125,512..7,126,21971123625,656.668.5352.3870.23Nucleus.15.328.093.4073.19
VvZFP10Vitvi04g00527Chr4: 5,630,158..5,631,01886428731,544.125.9665.5656.93Nucleus.21.3312.241.7566.69
VvZFP11Vitvi05g00082Chr5: 1,128,866..1,129,48962720822,072.408.5947.2577.98Nucleus.29.4710.633.8656.04
VvZFP12Vitvi05g01913Chr5: 7,082,504..7,083,19069022925,470.518.7263.6853.86Nucleus.27.638.333.5160.53
VvZFP13Vitvi05g01914Chr5: 7,094,682..7,095,30562720823,008.676.2164.5966.8Nucleus.33.3310.636.7649.28
VvZFP14Vitvi05g01915Chr5: 7,102,567..7,103,10354017920,359.126.9734.6162.89Nucleus.14.619.552.8173.03
VvZFP15Vitvi06g01682Chr6: 5,152,508..5,152,98748316017,811.689.1581.5146.90Nucleus.19.5011.322.5266.67
VvZFP16Vitvi06g01710Chr6: 6,156,545..6,157,12358219320,968.396.9057.5038.51Nucleus.14.588.332.0875.00
VvZFP17Vitvi06g00521Chr6: 6,160,463..6,161,28182227330,657.639.1966.1163.46Nucleus.25.3710.661.1062.87
VvZFP18Vitvi06g01862Chr6: 14,981,645..14,982,970132944248,569.679.5855.7847.97Nucleus.24.498.163.1764.17
VvZFP19Vitvi06g01864Chr6: 14,989,117..14,990,382126942245,557.159.0851.4860.45Nucleus.16.158.554.5170.78
VvZFP20Vitvi06g01865Chr6: 15,002,349..15,003,701135645149,058.139.4958.5345.02Nucleus.18.6710.003.7865.56
VvZFP21Vitvi06g01866Chr6: 15,005,234..15,006,622139246350,164.489.3159.7646.43Nucleus.19.9712.774.1163.20
VvZFP22Vitvi06g01867Chr6: 15,013,314..15,014,594128442745,964.158.6858.5753.67Nucleus.23.008.223.7665.02
VvZFP23Vitvi06g01350Chr6: 18,287,579..18,288,44887329030,928.256.7056.0671.75Nucleus.10.7311.073.4674.74
VvZFP24Vitvi07g02261Chr7: 5,788,161..5,788,70354618120,235.549.1554.7858.62Nucleus.26.6710.003.8959.44
VvZFP25Vitvi07g02262Chr7: 5,794,112..5,794,63953117619,739.774.7951.8967.57Nucleus.22.2910.862.8664.00
VvZFP26Vitvi07g02342Chr7: 9,671,071..9,671,62255518420,226.559.0359.2948.14Nucleus.24.5911.483.2860.66
VvZFP27Vitvi07g01602Chr7: 15,505,941..15,506,64270523425,007.847.2260.3967.42Nucleus.16.316.443.0074.25
VvZFP28Vitvi07g01645Chr7: 15,914,286..15,914,86758519421,466.786.1650.6743.88Nucleus.30.579.841.5558.03
VvZFP29Vitvi07g01724Chr7: 16,589,850..16,590,74089429731,837.316.8748.4865.66Nucleus.12.5021.967.4358.11
VvZFP30Vitvi08g04156Chr8: 11,691,926..11,692,954103234337,210.249.3751.4661.82Nucleus.24.2710.824.0960.82
VvZFP31Vitvi08g04157Chr8: 11,698,586..11,699,56097832535,886.028.1159.0154.74Nucleus.29.949.574.9455.56
VvZFP32Vitvi08g02113Chr8: 11,710,332..11,711,29796932234,967.558.9949.8445.38Nucleus.22.1210.595.6161.68
VvZFP33Vitvi08g02203Chr8: 15,040,331..15,040,891116438720,527.685.8557.2048.76Nucleus.15.5915.052.1567.20
VvZFP34Vitvi08g01249Chr8: 15,048,333..15,049,24480126629,979.589.0859.2870.52Nucleus.24.918.302.6464.15
VvZFP35Vitvi08g01600Chr8: 18,752,543..18,753,37368422730,176.536.3754.1770.05Nucleus.11.9613.413.2671.38
VvZFP36Vitvi08g01771Chr8: 20,543,918..20,544,63472023926,467.246.7653.2856.27Nucleus.15.9713.031.2669.75
VvZFP37Vitvi09g00827Chr9: 10,638,815..10,639,61880726829,405.597.1367.6455.45Nucleus.19.1013.112.2565.54
VvZFP38Vitvi11g01259Chr11: 18,868,891..18,869,35546815517,251.047.9162.0859.60Nucleus.27.9214.293.2554.55
VvZFP39Vitvi13g00262Chr13: 2,500,654..2,501,18453417719,227.159.2573.8159.02Nucleus.22.1614.771.7061.36
VvZFP40Vitvi13g00340Chr13: 3,432,929..3,433,77785228330,817.446.8666.7767.47Nucleus.26.248.512.1363.12
VvZFP41Vitvi13g00694Chr13: 7,002,863..7,003,77191230333,185.906.0083.9659.90Nucleus.16.8914.244.3064.57
VvZFP42Vitvi13g01403Chr13: 18,524,495..18,525,42193030933,906.908.2952.8965.25Nucleus.21.110.062.2766.56
VvZFP43Vitvi14g02872Chr14: 20,758,279..20,758,91163621123,154.298.8359.1962.25Nucleus.24.7613.330.4861.43
VvZFP44Vitvi14g01822Chr14: 28,162,609..28,163,33172624127,027.558.8966.7154.50Nucleus.30.8311.673.7553.75
VvZFP45Vitvi15g00644Chr15: 13,742,179..13,743,973147949253,927.396.9461.8153.23Nucleus.22.618.763.8764.77
VvZFP46Vitvi15g01472Chr15: 13,755,848..13,756,927108336040,177.605.3657.9970.04Nucleus.30.089.473.0657.38
VvZFP47Vitvi16g00499Chr16: 9,490,833..9,491,54071123626,341.588.7753.6256.48Nucleus.20.4312.773.8362.98
VvZFP48Vitvi17g00670Chr17: 7,475,229..7,477,459105935238,525.419.4261.1457.18Nucleus.28.7713.393.1354.70
VvZFP49Vitvi18g00675Chr18: 7,732,710..7,733,41170523425,291.378.9161.2472.28Nucleus.12.887.733.0076.39
VvZFP50Vitvi18g00708Chr18: 8,000,360..8,000,94158519421,621.298.3753.1154.30Nucleus.25.9111.402.0760.62
VvZFP51Vitvi19g00912Chr19: 10,503,115..10,505,322183060965,943.196.4352.8843.44Nucleus.19.749.870.0070.39
VvZFP52Vitvi02g00560ChrUn: 15,415,314..15,416,28597532435,711.515.8055.9170.98Nucleus.27.7616.500.0055.75
VaZFP1VAG0100928.1Chr1: 17,333,363..17,334,10374124626,762.875.4265.8552.76Nucleus23.5812.200.0064.23
VaZFP2VAG0101159.1Chr1: 19,799,732..19,802,38089729831,807.048.1748.0957.43Nucleus12.089.400.0078.52
VaZFP3VAG0101417.1Chr1: 22,359,578..22,361,926165655161,040.879.0062.2948.67Nucleus26.1313.790.0060.07
VaZFP4VAG0101986.1Chr2: 5,166,395..5,168,415110436740,529.116.3656.6869.07Nucleus32.976.540.0060.49
VaZFP5VAG0102194.1Chr2: 8,213,767..8,215,73677425728,235.065.1057.7862.65Nucleus29.577.000.0063.42
VaZFP6VAG0103111.1Chr3: 13,633,297..13,653,939147349054,091.128.1072.6353.50Cell membrane,
Nucleus		27.557.140.0065.31
VaZFP7VAG0103166.1Chr3: 14,187,647..14,189,70971423726,675.288.3664.1849.68Nucleus22.3613.080.0064.56
VaZFP8VAG0103518.1Chr3: 17,847,415..17,848,38396932235,038.467.5766.0954.66Nucleus18.3212.730.0068.94
VaZFP9VAG0104819.1Chr4: 19,776,441..19,777,30186128631,604.165.9665.5656.33Nucleus23.438.390.0068.18
VaZFP10VAG0105424.1Chr5: 724,847..731,07677425728,247.839.6461.1360.37Nucleus24.5120.620.0054.86
VaZFP11VAG0105875.1Chr5: 5,823,943..5,824,79468422725,553.707.6367.8449.78Nucleus39.212.200.0058.59
VaZFP12VAG0105876.1Chr5: 5,836,792..5,845,261109836540,943.958.2443.1064.52Nucleus19.453.840.0076.71
VaZFP13VAG0106999.1Chr6: 3,224,617..3,225,49587929231,485.926.2755.4869.89Nucleus7.8815.410.0076.71
VaZFP14VAG0107168.1Chr6: 6,152,873..6,154,261138946250,333.629.2860.1748.09Nucleus23.598.230.0068.18
VaZFP15VAG0107169.1Chr6: 6,167,187..6,170,659112537440,810.879.3958.2151.67Nucleus17.3813.100.0069.52
VaZFP16VAG0107172.1Chr6: 6,206,628..6,207,884125741845,670.689.9756.2752.09Nucleus25.847.890.0066.27
VaZFP17VAG0107173.1Chr6: 6,214,231..6,215,511128142645,912.178.6660.6353.82Nucleus8.4513.620.0077.93
VaZFP18VAG0107180.1Chr6: 6,339,579..6,340,862128442746,126.569.0359.7952.37Nucleus10.3013.350.0076.35
VaZFP19VAG0107181.1Chr6: 6,347,333..6,348,721138946250,062.399.4459.7646.49Nucleus21.868.230.0069.91
VaZFP20VAG0107185.1Chr6: 6,369,265..6,370,530126642145,542.219.2262.3052.83Nucleus12.8310.690.0076.48
VaZFP21VAG0107708.1Chr6: 16,631,844..16,632,66281927230,572.479.1962.0264.40Nucleus23.5314.710.0061.76
VaZFP22VAG0107805.1Chr6: 17,689,739..17,695,11366622124,781.689.8177.6954.48Nucleus28.5110.860.0060.63
VaZFP23VAG0109054.1Chr7: 13,229,020..13,235,502108336040,449.955.6956.1459.44Nucleus23.3310.560.0066.11
VaZFP24VAG0109724.1Chr7: 25,148,488..25,161,891258386094,567.567.3081.5546.58Cell membrane36.5113.260.0050.23
VaZFP25VAG0109762.1Chr7: 25,543,220..25,571,722244881592,490.146.1063.5538.40Nucleus24.5419.510.0055.95
VaZFP26VAG0109816.1Chr7: 26,316,847..26,317,73488829531,755.236.4646. 0066.23Nucleus15.9313.220.0070.85
VaZFP27VAG0110325.1Chr8: 1,994,129..1,995,21776225328,208.248.2651.6652.61Nucleus13.8315.810.0070.36
VaZFP28VAG0110521.1Chr8: 4,033,984..4,034,81483127630,176.536.3754.1770.05Nucleus28.397.260.0064.35
VaZFP29VAG0110874.1Chr8: 7,544,736..7,545,64779826529,979.589.0859.2870.52Nucleus17.847.600.0074.56
VaZFP30VAG0110875.1Chr8: 7,551,607..7,553,54253717819,482.456.3053.8254.81Nucleus23.036.180.0070.79
VaZFP31VAG0111156.1Chr8: 10,604,900..10,605,88698732835,580.288.8848.7846.77Nucleus12.3215.580.0072.10
VaZFP32VAG0111157.1Chr8: 10,616,669..10,617,62295431735,110.098.3959.0950.64Nucleus28.397.260.0064.35
VaZFP33VAG0111158.1Chr8: 10,623,270..10,624,298102934237,242.199.3950.0363.91Nucleus23.036.180.0070.79
VaZFP34VAG0112436.1Chr9: 14,077,157..14,077,96080426729,405.597.1367.6455.45Nucleus27.928.680.0063.40
VaZFP35VAG0114471.1Chr11: 864,420..896,550217272380,321.464.9475.1742.25Nucleus15.557.930.0076.52
VaZFP36VAG0117437.1Chr13: 10,279,271..10,280,19792730833,975.978.3052.8965.28Nucleus28.377.090.0064.54
VaZFP37VAG0118243.1Chr13: 2,1951,931..21,959,02963321023,176.6910.0074.3869.36Nucleus15.7313.110.0071.16
VaZFP38VAG0118338.1Chr13: 22,954,546..22,955,39484928230,794.366.6366.4266.79Nucleus32.9214.110.0052.97
VaZFP39VAG0118611.1Chr13: 26,509,806..26,510,79599032935,924.059.0064.4472.84Nucleus31.909.050.0059.05
VaZFP40VAG0119731.1Chr14: 19,561,186..19,584,42682227330,537.709.3855.9060.37Nucleus27.477.690.0064.84
VaZFP41VAG0120008.1Chr14: 23,954,383..23,955,31247415717,102.017.9152.9361.88Nucleus15.5012.460.0072.04
VaZFP42VAG0120315.1Chr14: 26,818,406..26,819,53590029933,836.448.9969.8359.54Nucleus19.169.740.0071.10
VaZFP43VAG0121158.1Chr15: 8,053,433..8,054,836140446751,114.126.7660.6047.41Nucleus22.0612.630.0065.31
VaZFP44VAG0121159.1Chr15: 8,066,755..8,067,837108336040,236.635.3557.8368.71Nucleus23.618.060.0068.33
VaZFP45VAG0122572.1Chr16: 17,249,757..17,250,69173224327,101.488.7253.4656.73Nucleus29.6312.760.0057.61
VaZFP46VAG0123756.1Chr17: 7,323,153..7,324,843159052958,536.298.5758.6654.59Nucleus24.0115.120.0060.87
VaZFP47VAG0123852.1Chr17: 8,584,588..8,597,04195431735,447.086.9265.2749.71Nucleus30.287.890.0061.83
VaZFP48VAG0125708.1Chr18: 33,103,767..33,114,322167755861,587.315.9477.0640.08Nucleus18.4627.780.0053.76
VaZFP49VAG0125736.1Chr18: 33,378,797..33,381,05878926228,363.718.4058.2179.33Nucleus17.948.780.0073.28
VaZFP50VAG0126909.1Chr19: 15,420,039..15,422,244182760866,030.266.3653.3644.38Nucleus19.5710.530.0069.90
VaZFP51VAG0128236.1Scaffold_187: 19,406..19,98649816518,085.187.7355.0938.21Nucleus30.3010.300.0059.39
VaZFP52VAG0128237.1Scaffold_187: 23,941..24,75981927230,553.439.0862.0265.27Nucleus23.9015.070.0061.03
VaZFP53VAG0129335.1Scaffold_503: 45,030..50,40169323026,231.456.2467.0058.53Nucleus27.8311.300.0060.87
VaZFP54VAG0130661.1Scaffold_1,201: 6,417..8,12769323025,480.898.9074.7444.92Nucleus41.747.830.0050.43
VaZFP55VAG0131613.1Scaffold_1,769: 9,136..19,344253584493,149.447.8261.3953.56Nucleus27.0114.810.0058.18
VrZFP1XP_034681774.1Chr1: 553,635..556,371156652157,509.688.9061.9448.70Nucleus22.6515.160.0062.19
VrZFP2XP_034682326.1Chr1: 3,258,529..3,261,62582527429,280.158.4944.8556.43Nucleus8.769.120.0082.12
VrZFP3XP_034682333.1Chr1: 3,258,870..3,260,99482227329,209.078.4944.6556.60Nucleus8.799.520.0081.68
VrZFP4XP_034695126.1Chr1: 3,424,130..3,425,16666622123,139.718.3756.2453.30Nucleus21.7213.570.0064.71
VrZFP5XP_034697189.1Chr1: 6,102,930..6,106,90774124626,810.935.4363.8656.18Nucleus22.3612.200.0065.45
VrZFP6XP_034697191.1Chr1: 6,102,755..6,106,90774124626,810.935.4363.8656.18Nucleus22.3612.200.0065.45
VrZFP7XP_034674477.1Chr1: 10,678,040..10,683,79885528432,077.119.0856.6966.02Nucleus18.3114.440.0067.25
VrZFP8XP_034674418.1Chr1: 10,678,300..10,679,19089129633,638.139.0759.6663.17Nucleus19.9316.220.0063.85
VrZFP9XP_034705328.1Chr2: 11,357,933..11,359,15974724827,154.834.9658.3164.55Nucleus25.407.260.0067.34
VrZFP10XP_034703703.1Chr2: 13,915,433..13,916,77298132635,996.775.6854.5171.19Cell membrane26.388.590.0065.03
VrZFP11XP_034682127.1Chr3: 2,510,558..2,511,97896932235,038.467.5766.0954.66Nucleus18.3212.730.0068.94
VrZFP12XP_034680378.1Chr3: 6,228,170..6,233,00657018921,216.786.5256.3051.58Nucleus19.586.880.0073.54
VrZFP13XP_034679895.1Chr3: 6,752,634..6,753,59070823525,608.618.5353.2371.97Nucleus10.644.680.0084.68
VrZFP14XP_034682721.1Chr4: 5,909,744..5,911,15386428731,672.255.9665.3356.98Nucleus23.008.360.0068.64
VrZFP15XP_034686446.1Chr5: 776,318..777,29870823525,349.218.8751.1573.99Nucleus25.1114.470.0060.43
VrZFP16XP_034686918.1Chr5: 6,643,815..6,644,99268722825,498.558.7265.3953.58Nucleus31.143.950.0064.91
VrZFP17XP_034685738.1Chr5: 6,656,758..6,657,37862120622,844.476.2164.4262.93Nucleus23.300.970.0075.73
VrZFP18XP_034686948.1Chr5: 6,664,514..6,665,57453717820,294.016.5332.4262.89Nucleus17.425.060.0077.53
VrZFP19XP_034688450.1Chr6: 3,546,885..3,547,99389129631,697.136.2756.0570.01Nucleus7.7715.540.0076.69
VrZFP20XP_034689063.1Chr6: 6,443,038..6,444,321128442746,095.599.1459.3454.52Nucleus9.8413.350.0076.81
VrZFP21XP_034689064.1Chr6: 6,451,092..6,452,480138946250,154.409.2960.3947.21Nucleus22.088.660.0069.26
VrZFP22XP_034688666.1Chr6: 16,774,764..16,776,11681927230,626.489.1060.5970.40Nucleus23.5313.970.0062.50
VrZFP23XP_034689169.1Chr6: 16,779,202..16,779,78358219321,182.566.1058.1937.24Nucleus28.5012.440.0059.07
VrZFP24XP_034688453.1Chr6: 17,847,675..17,848,39448015917,839.709.1781.5150.20Nucleus28.309.430.0062.26
VrZFP25XP_034689071.1Chr6: 6,514,792..6,516,054126342045,497.089.1761.2953.16Nucleus11.9012.140.0075.95
VrZFP26XP_034689322.1Chr7: 4,267,202..4,268,08988829531,820.296.6447.9767.37Nucleus15.2514.240.0070.51
VrZFP27XP_034691695.1Chr7: 4,923,281..4,924,38358219321,442.806.1652.6945.49Nucleus23.3210.880.0065.80
VrZFP28XP_034689870.1Chr7: 5,329,636..5,330,68269323024,733.617.2261.6167.80Nucleus8.2613.040.0078.70
VrZFP29XP_034691020.1Chr7: 20,623,883..20,626,71957619120,988.509.1958.8545.75Nucleus37.708.380.0053.93
VrZFP30XP_034691021.1Chr7: 20,624,803..20,626,50157619120,988.509.1958.8545.75Nucleus37.708.380.0053.93
VrZFP31XP_034691940.1Chr7: 24,703,955..24,706,38752817519,741.784.7854.1166.80Nucleus20.5711.430.0068.00
VrZFP32XP_034690590.1Chr7: 24,711,726..24,712,26854318020,346.739.3056.9459.24Nucleus31.679.440.0058.89
VrZFP33XP_034694709.1Chr8: 15,096,568..15,097,50056118620,496.716.1459.3048.92Nucleus22.049.140.0068.82
VrZFP34XP_034693315.1Chr8: 15,104,445..1,510,595591230334,090.078.7059.8769.40Nucleus27.398.910.0063.70
VrZFP35XP_034694346.1Chr8: 18,924,297..18,925,59383727830,314.616.0753.7869.19Nucleus10.4315.470.0074.10
VrZFP36XP_034693265.1Chr8: 20,767,588..20,768,74871723826,451.186.7653.2858.92Nucleus14.2913.030.0072.69
VrZFP37XP_034696432.1Chr9: 11,094,899..11,096,01180426729,396.587.1067.6456.92Nucleus15.7313.110.0071.16
VrZFP38XP_034700480.1Chr11: 930,628..933,01046515417,251.047.9162.0859.60Nucleus20.1316.230.0063.64
VrZFP39XP_034704073.1Chr13: 7,805,286..7,806,16487929232,002.738.6151.7864.67Nucleus15.759.930.0074.32
VrZFP40XP_034703438.1Chr13: 21,915,467..21,916,66490930233,145.876.1360.8680.72Nucleus20.537.620.0071.85
VrZFP41XP_034704234.1Chr13: 25,793,212..25,794,05484328030,664.176.6765.5068.04Nucleus30. 006.790.0063.21
VrZFP42XP_034704827.1Chr13: 26,761,501..26,762,30353117619,162.049.1071.5955.76Nucleus29.5510.230.0060.23
VrZFP43XP_034706344.1Chr14: 154,977..157,422171357063,789.926.3955.6057.03Nucleus22.9813.860.0063.16
VrZFP44XP_034708229.1Chr14: 2,105,931..2,107,90087028932,409.728.7968.5557.69Nucleus30.1012.460.0057.44
VrZFP45XP_034706389.1Chr14: 5,129,008..5,129,40339613114,365.078.6960.5369.37Nucleus25.956.110.0067.94
VrZFP46XP_034707874.1Chr14: 10,193,748..10,194,59963321023,213.318.8357.3360.93Nucleus27.628.570.0063.81
VrZFP47XP_034708534.1Chr15: 7,068,109..7,069,605108035940,180.525.3656.6369.67Nucleus23.408.360.0068.25
VrZFP48XP_034708821.1Chr15: 7,266,510..7,267,953140446751,080.16.7661.4347.82Nucleus22.0612.630.0065.31
VrZFP49XP_034711786.1Chr16: 9,463,294..9,464,25170823526,355.618.7753.6257.54Nucleus30.6411.910.0057.45
VrZFP50XP_034672939.1Chr17: 11,002,420..11,003,57459119621,982.626.1860.2655.26Nucleus29.597.650.0062.76
VrZFP51XP_034712135.1Chr17: 12,160,011..12,162,489169256362,310.448.6457.0254.64Nucleus20.6014.920.0064.48
VrZFP52XP_034674136.1Chr18: 7,697,776..7,698,81670223325,322.348.9159.1474.76Nucleus18.036.870.0075.11
VrZFP53XP_034674743.1Chr18: 8,025,926..8,027,41758219321,543.188.7352.1253.15Nucleus24.358.810.0066.84
VrZFP54XP_034678325.1Chr19: 10,956,892..10,959,5451,83661166,157.246.2851.1843.75Nucleus18.999.980.0071.03
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chu, M.; Wang, T.; Li, W.; Liu, Y.; Bian, Z.; Mao, J.; Chen, B. Genome-Wide Identification and Analysis of the Genes Encoding Q-Type C2H2 Zinc Finger Proteins in Grapevine. Int. J. Mol. Sci. 2023, 24, 15180. https://doi.org/10.3390/ijms242015180

AMA Style

Chu M, Wang T, Li W, Liu Y, Bian Z, Mao J, Chen B. Genome-Wide Identification and Analysis of the Genes Encoding Q-Type C2H2 Zinc Finger Proteins in Grapevine. International Journal of Molecular Sciences. 2023; 24(20):15180. https://doi.org/10.3390/ijms242015180

Chicago/Turabian Style

Chu, Mingyu, Tiaoye Wang, Wenfang Li, Yashi Liu, Zhiyuan Bian, Juan Mao, and Baihong Chen. 2023. "Genome-Wide Identification and Analysis of the Genes Encoding Q-Type C2H2 Zinc Finger Proteins in Grapevine" International Journal of Molecular Sciences 24, no. 20: 15180. https://doi.org/10.3390/ijms242015180

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop