Unveiling the Significance of FGF8 Overexpression in Orchestrating the Progression of Ovarian Cancer
Abstract
:1. Introduction
2. Results
2.1. FGF8 Expression in Saliva Samples
2.2. FGF8 Expression in Tissue Samples
2.3. FGF8 mRNA Expression by Quantitative PCR
2.4. FGF8 Gene Silencing in SKOV3 Cells
2.5. Effect of FGF8 Silencing on Various Properties of SKOV3 Cells
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Quantification of FGF8 in Saliva Samples
4.3. Extraction of Tissue Proteins
4.4. Quantitative Real-Time PCR (RT-PCR)
4.5. Immunohistochemistry (IHC)
4.6. Cell Culture and Transfection
4.7. Cell Viability Assay
4.8. Adhesion Assay
4.9. Wound Healing Assay
4.10. Cell Migration and Invasion Assay
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- UICC. GLOBOCAN 2020: New Global Cancer Data. Available online: https://www.uicc.org/news/globocan-2020-new-global-cancer-data (accessed on 17 March 2023).
- Kauff, N.D.; Domchek, S.M.; Friebel, T.M.; Robson, M.E.; Lee, J.; Garber, J.E.; Isaacs, C.; Evans, D.G.; Lynch, H.; Eeles, R.A.; et al. Risk-reducing salpingo-oophorectomy for the prevention of BRCA1- and BRCA2-associated breast and gynecologic cancer: A multicenter, prospective study. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 2008, 26, 1331–1337. [Google Scholar] [CrossRef]
- Tschernichovsky, R.; Goodman, A. Risk-Reducing Strategies for Ovarian Cancer in BRCA Mutation Carriers: A Balancing Act. Oncologist 2017, 22, 450–459. [Google Scholar] [CrossRef]
- Walker, J.L.; Powell, C.B.; Chen, L.-M.; Carter, J.; Jump, V.L.B.; Parker, L.P.; Borowsky, M.E.; Gibb, R.K. Society of Gynecologic Oncology recommendations for the prevention of ovarian cancer. Cancer 2015, 121, 2108–2120. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, D.K.; Alvarez, R.D.; Backes, F.J.; Bakkum-Gamez, J.N.; Barroilhet, L.; Behbakht, K.; Berchuck, A.; Chen, L.-M.; Chitiyo, V.C.; Cristea, M.; et al. NCCN Guidelines® Insights: Ovarian Cancer, Version 3.2022. J. Natl. Compr. Cancer Netw. JNCCN 2022, 20, 972–980. [Google Scholar] [CrossRef] [PubMed]
- O’Cearbhaill, R.E. Using PARP Inhibitors in Advanced Ovarian Cancer. Oncol. Williston Park N. 2018, 32, 339–343. [Google Scholar]
- Jayson, G.C.; Kohn, E.C.; Kitchener, H.C.; Ledermann, J.A. Ovarian cancer. Lancet Lond. Engl. 2014, 384, 1376–1388. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Payson, R.A.; Lang, J.C.; Chiu, I.-M. Activation of fibroblast growth factor 8 gene expression in human embryonal carcinoma cells. J. Steroid Biochem. Mol. Biol. 1997, 62, 1–10. [Google Scholar] [CrossRef]
- Fibroblast Growth Factor Signaling in Liver Carcinogenesis—Sandhu—2014—Hepatology—Wiley Online Library. Available online: https://aasldpubs.onlinelibrary.wiley.com/doi/10.1002/hep.26679 (accessed on 17 March 2023).
- Yun, Y.-R.; Won, J.E.; Jeon, E.; Lee, S.; Kang, W.; Jo, H.; Jang, J.H.; Shin, U.S.; Kim, H.W. Fibroblast Growth Factors: Biology, Function, and Application for Tissue Regeneration. J. Tissue Eng. 2010, 2010, 218142. [Google Scholar] [CrossRef] [PubMed]
- Turner, N.; Grose, R. Fibroblast growth factor signalling: From development to cancer. Nat. Rev. Cancer 2010, 10, 116–129. [Google Scholar] [CrossRef]
- Kreuger, J.; Jemth, P.; Sanders-Lindberg, E.; Eliahu, L.; Ron, D.; Basilico, C.; Salmivirta, M.; Lindahl, U. Fibroblast growth factors share binding sites in heparan sulphate. Biochem. J. 2005, 389, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Szebenyi, G.; Fallon, J.F. Fibroblast Growth Factors as Multifunctional Signaling Factors. Int. Rev. Cytol. 1999, 185, 45–106. [Google Scholar] [CrossRef]
- Loo, B.-M.; Salmivirta, M. Heparin/heparan sulfate domains in binding and signaling of fibroblast growth factor 8b. J. Biol. Chem. 2002, 277, 32616–32623. [Google Scholar] [CrossRef]
- Viklund, L.; Vorontsova, N.; Henttinen, T.; Salmivirta, M. Syndecan-1 regulates FGF8b responses in S115 mammary carcinoma cells. Growth Factors 2006, 24, 151–157. [Google Scholar] [CrossRef]
- Liu, R.; Huang, S.; Lei, Y.; Zhang, T.; Wang, K.; Liu, B.; Nice, E.C.; Xiang, R.; Xie, K.; Li, J. FGF8 promotes colorectal cancer growth and metastasis by activating YAP1. Oncotarget 2014, 6, 935–952. [Google Scholar] [CrossRef]
- Hao, Y.; Xiao, Y.; Liao, X.; Tang, S.; Xie, X.; Liu, R.; Chen, Q. FGF8 induces epithelial-mesenchymal transition and promotes metastasis in oral squamous cell carcinoma. Int. J. Oral Sci. 2021, 13, 6. [Google Scholar] [CrossRef] [PubMed]
- Jomrich, G.; Wilfing, L.; Radosavljevic, S.; Parak, A.; Winkler, D.; Timelthaler, G.; Schindl, M.; Schoppmann, S.F.; Klösch, B. Fibroblast growth factor 8 overexpression is predictive of poor prognosis in pancreatic ductal adenocarcinoma. Eur. Surg. 2020, 52, 282–289. [Google Scholar] [CrossRef]
- Kurman, R.J.; Shih, I.-M. Molecular pathogenesis and extraovarian origin of epithelial ovarian cancer—Shifting the paradigm. Hum. Pathol. 2011, 42, 918–931. [Google Scholar] [CrossRef] [PubMed]
- Lheureux, S.; Gourley, C.; Vergote, I.; Oza, A.M. Epithelial ovarian cancer. Lancet Lond. Engl. 2019, 393, 1240–1253. [Google Scholar] [CrossRef] [PubMed]
- Goldfarb, M. Fibroblast growth factor homologous factors: Evolution, structure, and function. Cytokine Growth Factor Rev. 2005, 16, 215–220. [Google Scholar] [CrossRef]
- Hao, Y.; Tang, S.; Yuan, Y.; Liu, R.; Chen, Q. Roles of FGF8 subfamily in embryogenesis and oral-maxillofacial diseases (Review). Int. J. Oncol. 2019, 54, 797–806. [Google Scholar] [CrossRef]
- Tanaka, A.; Miyamoto, K.; Minamino, N.; Takeda, M.; Sato, B.; Matsuo, H.; Matsumoto, K. Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc. Natl. Acad. Sci. USA 1992, 89, 8928–8932. [Google Scholar] [CrossRef]
- Sun, X.; Meyers, E.N.; Lewandoski, M.; Martin, G.R. Targeted disruption of Fgf8 causes failure of cell migration in the gastrulating mouse embryo. Genes Dev. 1999, 13, 1834–1846. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Powell, W.C.; Kasahara, N.; Van Bokhoven, A.; Miller, G.J.; Roy-Burman, P. The effect of fibroblast growth factor 8, isoform b, on the biology of prostate carcinoma cells and their interaction with stromal cells. Cancer Res. 2000, 60, 6730–6736. [Google Scholar]
- Mattila, M.M.; Ruohola, J.K.; Valve, E.M.; Tasanen, M.J.; Seppänen, J.A.; Härkönen, P.L. FGF-8b increases angiogenic capacity and tumor growth of androgen-regulated S115 breast cancer cells. Oncogene 2001, 20, 2791–2804. [Google Scholar] [CrossRef] [PubMed]
- Saini, A.; Chandra, K.B.; Kumar, V.; Mathur, S.R.; Sharma, J.B.; Kumar, S.; Yadav, S. Analysis of Multimerin 1 (MMRN1) expression in ovarian cancer. Mol. Biol. Rep. 2020, 47, 9459–9468. [Google Scholar] [CrossRef]
- Valve, E.; Martikainen, P.; Seppänen, J.; Oksjoki, S.; Hinkka, S.; Anttila, L.; Grenman, S.; Klemi, P.; Härkönen, P. Expression of fibroblast growth factor (FGF)-8 isoforms and FGF receptors in human ovarian tumors. Int. J. Cancer 2000, 88, 718–725. [Google Scholar] [CrossRef]
- Kai, F.; Drain, A.P.; Weaver, V.M. The Extracellular Matrix Modulates the Metastatic Journey. Dev. Cell 2019, 49, 332–346. [Google Scholar] [CrossRef] [PubMed]
- Kuroki, L.; Guntupalli, S.R. Treatment of epithelial ovarian cancer. BMJ 2020, 371, m3773. [Google Scholar] [CrossRef] [PubMed]
- Staff, A.C. An introduction to cell migration and invasion. Scand. J. Clin. Lab. Investig. 2001, 61, 257–268. [Google Scholar] [CrossRef]
- SenGupta, S.; Parent, C.A.; Bear, J.E. The principles of directed cell migration. Nat. Rev. Mol. Cell Biol. 2021, 22, 529–547. [Google Scholar] [CrossRef]
- Novikov, N.M.; Zolotaryova, S.Y.; Gautreau, A.M.; Denisov, E.V. Mutational drivers of cancer cell migration and invasion. Br. J. Cancer 2021, 124, 102–114. [Google Scholar] [CrossRef] [PubMed]
- Winkler, J.; Abisoye-Ogunniyan, A.; Metcalf, K.J.; Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat. Commun. 2020, 11, 5120. [Google Scholar] [CrossRef] [PubMed]
- Spitzer, M.; Wildenhain, J.; Rappsilber, J.; Tyers, M. BoxPlotR: A web tool for generation of box plots. Nat. Methods 2014, 11, 121–122. [Google Scholar] [CrossRef] [PubMed]
Particulars | Saliva Samples | Tissue Samples | ||||
---|---|---|---|---|---|---|
Ethnicity | Indian | Indian | ||||
Smoking History | No | No | ||||
Controls | Low-Grade EOC | High-Grade EOC | Controls | Low-Grade EOC | High-Grade EOC | |
Number of samples | 20 | 10 | 20 | 8 | 5 | 11 |
Age (years) Mean ± SD | 38.6 ± 7.0 | 42.6 ± 16.5 | 46.8 ± 10.2 | 47.0 ± 2.8 | 50.2 ± 14.4 | 44.9 ± 9.6 |
Gene | Primers | Tm (°C) |
---|---|---|
FGF8 | Forward: 5′TAGGGCACCCAAAACTCAAG3′ | 50.7 |
GAPDH | Reverse: 5′AACAGCAAAAACCCAACAGC3′ | 53.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chandra, K.B.; Kumar, V.; Ranjan, S.; Saini, A.; Tomar, A.K.; Sharma, J.B.; Mathur, S.R.; Yadav, S. Unveiling the Significance of FGF8 Overexpression in Orchestrating the Progression of Ovarian Cancer. Int. J. Mol. Sci. 2023, 24, 14239. https://doi.org/10.3390/ijms241814239
Chandra KB, Kumar V, Ranjan S, Saini A, Tomar AK, Sharma JB, Mathur SR, Yadav S. Unveiling the Significance of FGF8 Overexpression in Orchestrating the Progression of Ovarian Cancer. International Journal of Molecular Sciences. 2023; 24(18):14239. https://doi.org/10.3390/ijms241814239
Chicago/Turabian StyleChandra, Kumari Binita, Vikrant Kumar, Swati Ranjan, Abhinav Saini, Anil Kumar Tomar, Jai Bhagwan Sharma, Sandeep R. Mathur, and Savita Yadav. 2023. "Unveiling the Significance of FGF8 Overexpression in Orchestrating the Progression of Ovarian Cancer" International Journal of Molecular Sciences 24, no. 18: 14239. https://doi.org/10.3390/ijms241814239