Next Article in Journal
Circulating MicroRNAs and Extracellular Vesicle-Derived MicroRNAs as Predictors of Functional Recovery in Ischemic Stroke Patients: A Systematic Review and Meta-Analysis
Next Article in Special Issue
Bacteriophages and the Microbiome in Dermatology: The Role of the Phageome and a Potential Therapeutic Strategy
Previous Article in Journal
Blockade of CB1 or Activation of CB2 Cannabinoid Receptors Is Differentially Efficacious in the Treatment of the Early Pathological Events in Streptozotocin-Induced Diabetic Rats
Previous Article in Special Issue
Intraspecific Diversity of Microbial Anti-Inflammatory Molecule (MAM) from Faecalibacterium prausnitzii
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 1
10.3390/ijms24010252
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice

by
Kurtis F. Budden
1,
Shaan L. Gellatly
1,
Annalicia Vaughan
2,
Nadia Amorim
2,
Jay C. Horvat
1,
Nicole G. Hansbro
2,
David L. A. Wood
3,
Philip Hugenholtz
3,
Paul G. Dennis
4,
Peter A. B. Wark
1 and
Philip M. Hansbro
1,2,*
1
Priority Research Centre for Healthy Lungs and Immune Health Research Program, Hunter Medical Research Institute and The University of Newcastle, Callaghan, NSW 2308, Australia
2
Centre for Inflammation, School of Life Sciences, Faculty of Science, Centenary Institute and University of Technology Sydney, Sydney, NSW 2007, Australia
3
Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, QLD 4102, Australia
4
School of Earth and Environmental Sciences, The University of Queensland, Brisbane, QLD 4072, Australia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(1), 252; https://doi.org/10.3390/ijms24010252
Submission received: 1 December 2022 / Revised: 18 December 2022 / Accepted: 20 December 2022 / Published: 23 December 2022
(This article belongs to the Special Issue Recent Advances and Future Perspective in Microbiota and Probiotics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Bifidobacterium are prominent gut commensals that produce the short-chain fatty acid (SCFA) acetate, and they are often used as probiotics. Connections between the gut and the lung, termed the gut–lung axis, are regulated by the microbiome. The gut–lung axis is increasingly implicated in cigarette smoke-induced diseases, and cigarette smoke exposure has been associated with depletion of Bifidobacterium species. In this study, we assessed the impact of acetate-producing Bifidobacterium longum subsp. longum (WT) and a mutant strain with an impaired acetate production capacity (MUT) on cigarette smoke-induced inflammation. The mice were treated with WT or MUT B. longum subsp. longum and exposed to cigarette smoke for 8 weeks before assessments of lung inflammation, lung tissue gene expression and cecal SCFAs were performed. Both strains of B. longum subsp. longum reduced lung inflammation, inflammatory cytokine expression and adhesion factor expression and alleviated cigarette smoke-induced depletion in caecum butyrate. Thus, the probiotic administration of B. longum subsp. longum, irrespective of its acetate-producing capacity, alleviated cigarette smoke-induced inflammation and the depletion of cecal butyrate levels.

1. Introduction

The genus Bifidobacterium is comprised of strictly anaerobic Gram-positive rods [1,2]. Whilst they are particularly prominent in the gut microbiome during early life, especially amongst breastfed infants, their role in human health remains important in adulthood, and they are widely used as probiotics [2,3,4]. Bifidobacterium are considered to be beneficial components of the gut microbiome, inducing a range of immunoregulatory responses in the host, and promoting the effective clearance of bacterial and viral infections in the gastrointestinal tract, while limiting excessive inflammation [1,2]. Although the beneficial effects of Bifidobacterium spp. are often associated with their production of the short-chain fatty acid (SCFA) acetate [5], they can also regulate immune responses through other metabolites or direct interactions with immune cells via antigen presentation to host pattern recognition receptors [6,7].
The connections between the gut microbiome and the lungs are being increasingly well recognized, and cigarette smoking has a strong influence on the microbiome and the gut–microbiome–lung axis [8,9]. Gut microbiome changes are implicated in smoking-associated lung diseases such as chronic obstructive pulmonary disease (COPD) [10] and lung cancer [11], as well as inflammatory bowel [12] and non-alcoholic fatty liver [13] diseases. The abundance of Bifidobacterium and SCFAs (including acetate) are reduced by cigarette smoke exposure in humans [4,14,15] and rats [16]. Additionally, cigarette smoke condensate impaired the growth, exopolysaccharide and acetate production of Bifidobacterium animalis in vitro [17].
Bifidobacterium longum subsp. longum is an acetate-producing species that is commonly used as a probiotic [18], and it has been previously associated with a lower incidence of asthma [19], demonstrating a likely involvement in the gut–lung axis. Additionally, the insertional mutagenesis of an ABC-type transporter gene in B. longum subsp. longum NCC2705 produced a strain with a severely impaired ability to produce acetate [5]. This enabled us to distinguish between the effects mediated by acetate and those mediated by other bacterial products to define the underlying mechanisms by which this bacterium interacts with host immunity.
Given the critical role of smoking in the development of chronic respiratory and systemic inflammatory diseases [20,21,22,23] and its association with reduced Bifidobacterium abundance [8,14,16], we aimed to assess the effectiveness of probiotic B. longum subsp. longum in reducing cigarette smoke-induced inflammation in mice. We utilized two strains of B. longum subsp. longum which differed in their acetate production capacity and facilitated the investigation of the role of acetate in mediating the effects. Airway and parenchymal inflammation were assessed after cigarette smoke exposure. The gene expression of inflammatory cytokines and adhesion factors was also assessed, and the SCFA abundance was quantified in caecum contents. This demonstrated that both the strains of B. longum subsp. longum alleviated cigarette smoke-induced inflammation and the expression of cytokines and adhesion factors, which is associated with protection against cigarette smoke-induced depletion in caecum butyrate levels.

2. Results

Female C57BL/6 mice were administered either vehicle (PBS + 0.05% L-cysteine) or B. longum subsp. longum by gavage three times per week and exposed to cigarette smoke or normal air for 8 weeks before assessments of inflammation, cytokine and adhesion factor gene expression, and cecal SCFA abundance were performed. Two strains of B. longum subsp. longum were used: a wild-type strain (WT; NCC2705) capable of producing acetate and a genetically modified strain (MUT; NCC9036) which has an impaired ability to produce acetate [5].

2.1. B. longum subsp. longum Reduced Cigarette Smoke-Induced Airway and Parenchymal Inflammation

Cigarette smoke exposure induced airway inflammation in vehicle-treated mice, with increased total leukocytes, neutrophils, macrophages and lymphocytes in bronchoalveolar lavage fluid (BALF, Figure 1A–D). In the mice administered with either strain of B. longum subsp. longum, the cigarette smoke exposure also increased the amount of total leukocytes, neutrophils and macrophages (p = 0.06; WT), but the magnitude of airway inflammation was significantly lower in the mice receiving the B. longum subsp. longum MUT strain. The parenchymal immune cells were enumerated in hematoxylin/eosin-stained histopathology sections, and this demonstrated that both strains of B. longum subsp. longum significantly attenuated cigarette smoke-induced parenchymal inflammation. Thus, the mutant strain of B. longum subsp. longum, with a lower acetate production potential, attenuated both airway and parenchymal inflammation, whilst wild-type B. longum subsp. longum attenuated parenchymal inflammation only.

2.2. B. longum subsp. longum Reduced Cigarette Smoke-Induced Cytokine and Adhesion Factor Expression

The gene expression of cytokines and adhesion factors was assessed in the whole lung tissue by qPCR. The cigarette smoke exposure increased the mRNA expression of the cytokines tumor necrosis factor-α (Tnfa), chemokine (C-C motif) ligand (Ccl)8, chemokine (C-X-C motif) ligand 2 (Cxcl2), and Ccl22 (Figure 2A–D). WT B. longum subsp. longum significantly attenuated Tnfa and Ccl8 expression (Figure 2A,B), and MUT B. longum subsp. longum attenuated Tnfa, Ccl8, and Cxcl2 expression (Figure 2A–C). However, Ccl22 expression was not reduced by either strain of B. longum subsp. longum (Figure 2D). The cigarette smoke also induced increases in the expression of adhesion factors such as vascular cell adhesion molecule-1 (Vcam1) and intercellular adhesion molecule-1 (Icam1; Figure 2E,F). These increases were alleviated by both the WT and MUT strains of B. longum subsp. longum, demonstrating that their anti-inflammatory impacts are likely associated with the suppression of cytokine and adhesion factor expression.

2.3. B. longum subsp. longum Prevented Cigarette Smoke-Induced Butyrate Depletion

The production of acetate is severely impaired in the MUT B. longum subsp. longum strain, which appeared to have greater anti-inflammatory impacts compared to those of the WT strain. The cigarette smoke exposure increased the total SCFA abundance in the mice treated with WT, but not in those treated with MUT B. longum subsp. longum (Figure 3A). This effect was primarily driven by acetate, the amount of which was significantly increased by the cigarette smoke exposure in both the vehicle and WT B. longum subsp. longum-treated mice, but not in the MUT B. longum subsp. longum-treated mice (Figure 3B). Propionate abundance was highly variable and not significantly altered by either the cigarette smoke exposure or treatment (Figure 3C). However, cigarette smoke exposure reduced caecum butyrate (Figure 3D), which was partially alleviated by the treatment with WT B. longum subsp. longum. This also corresponded to an increase (p = 0.0503) in butyrate in the mice treated with WT B. longum subsp. longum and exposed only to normal air. Interestingly, MUT B. longum subsp. longum completely reversed the cigarette smoke-induced depletion of butyrate, to the extent that the cigarette smoke increased the butyrate levels in the MUT B. longum subsp. longum-treated mice to be greater than those of the air-exposed controls. Overall, the anti-inflammatory effects of B. longum subsp. longum were associated with protection against the cigarette smoke-induced depletion of butyrate, which was most pronounced in the mice treated with MUT B. longum subsp. longum.

3. Discussion

Overall, these results demonstrate that probiotic B. longum subsp. longum alleviates cigarette smoke-induced lung inflammation in mice, as evidenced by the reduced number of BALF and parenchymal immune cells. While further research is required in specific disease contexts, these findings indicate the use of B. longum subsp. longum or other probiotics as potential treatments to reduce the risk of developing chronic inflammatory diseases of the lungs. Smokers frequently struggle to stop smoking behavior, and even if smoking cessation is successful, chronic inflammation and microbial dysbiosis persist afterward, which are key drivers of disease [24,25]. Billions of people worldwide are exposed to chronic air pollution, which can exert similar effects [22,26]. Interventions to rectify these chronic mechanisms of pathogenesis, including probiotics, could alleviate this disease burden.
TNFα, which is primarily produced by macrophages, drives numerous inflammatory responses including the upregulation of Icam1 and Vcam1 [27,28]. It has been implicated in cigarette smoke-induced airway remodeling, emphysema, the epithelial–mesenchymal transition, and lung cancer [29,30]. Ccl8 is a monocyte chemoattractant [31], whilst CXCL2 acts largely as a neutrophil chemoattractant [32] and promotes neutrophil adhesion for migration to the sites of inflammation [33]. The production of inflammatory cytokines such as Tnfa, Ccl8, and Cxcl2 is a normal acute response to cigarette smoke exposure, but chronic exposure leads to persistent inflammation that drives chronic respiratory disease [21,29,32,34,35], suggesting that there are benefits to alleviation by B. longum subsp. longum. However, the protective effects of B. longum subsp. longum were not universal, as neither strain alleviated the cigarette smoke-induced expression of Ccl22.
The adhesion molecules Icam1 and Vcam1 contribute to the adhesion and migration of immune cells from the circulation into lung tissue, and their reduced expression may contribute to the anti-inflammatory effects of B. longum subsp. longum. In addition, smokers are at increased risk of respiratory infections [36,37], and Icam1 is an adhesion target for bacterial and viral pathogens such as Haemophilus influenzae [38] and rhinovirus [39]. B. longum subsp. longum has been associated with protection against both bacterial [40] and viral infections in mice [3,41], and the use of Bifidobacterium probiotics reduces the incidence of respiratory infections in humans [42,43,44]. Similarly, Icam1 has also been implicated in tumor metastasis in the lung [45], and both Icam1 and Vcam1 contribute to atherosclerosis [46], which are diseases associated with cigarette smoking [34]. Although these findings of a reduced mRNA expression of cytokines and adhesion factors indicates a potential mechanism by which B. longum subsp. longum alleviates cigarette smoke-induced inflammation, we did not investigate the changes in the proteins. The validation of changes in the protein abundance should be further investigated.
Interestingly, the MUT B. longum subsp. longum strain, which has a severely impaired ability to produce acetate, successfully alleviated all of the measures of lung inflammation, and unlike the WT strain, it even reduced the BALF immune cell influx. Thus, the mechanism of protection was independent of acetate production. Indeed, in contrast to the findings in humans [15] and rats [16], the total SCFAs were not decreased by the cigarette smoke exposure, but they were increased by it, which was driven largely by the increased acetate levels in the vehicle and WT B. longum subsp. longum-treated mice. Other models in mice have identified no impact of cigarette smoke on the fecal SCFA levels, albeit with the concurrent administration of poly I:C, which suggests that cigarette smoke-induced changes in SCFA abundance are dependent on the experimental conditions [47].
The presence or absence of particular bacteria, such as the nicotine-degrading Bacteroides xylanisolvens can substantially alter the responsiveness of the microbiome to exogenous challenges such as cigarette smoke [13]. Moreover, host–microbiome interactions are bi-directional, and the characteristics of the host can influence the effects of microbiota and vice versa. For example, heat-inactivated Bifidobacterium spp. isolated from allergic infants induced greater pro-inflammatory responses than those did from healthy individuals [48]. Cigarette smoke can directly affect the virulence of bacteria [49], and it alters the growth, metabolism, and exopolysaccharide structure of B. animalis [17]. Given that cigarette smoke exposure causes a gastrointestinal pathology [35,50,51,52], there is likely a direct influence of cigarette smoke on local microbiota which is further influenced by host–microbe and microbe–microbe interactions in this complex system. Thus, it is likely that the host species and/or environment-associated differences in the microbiome composition account for the differing effects of cigarette smoke exposure on SCFA abundance between the previous studies and our current findings.
Although there was no cigarette smoke-induced depletion of caecum acetate and B. longum subsp. longum did not increase the amount of acetate, WT B. longum subsp. longum partially alleviated the cigarette smoke-induced butyrate depletion and MUT B. longum subsp. longum increased the amount of butyrate in the cigarette smoke-exposed mice. B. longum subsp. longum is not a butyrate producer, but it can increase the rate of butyrate production through the cross-feeding of bacteria containing butyryl CoA:acetate CoA-transferase [53]. Thus, Bifidobacterium species can co-operate with other members of the microbiome to more efficiently digest complex carbohydrates, facilitating an increased availability of nutrients for butyrogenesis by other commensal microorganisms [54].
Finally, while increased butyrate abundance may contribute to the anti-inflammatory effects of B. longum subsp. longum, Bifidobacterium species can directly interact with the hosts’ immunity independent of the SCFAs. B. breve reduced the inflammatory responses in macrophages exposed to cigarette smoke extract in vitro [6], and mice treated intranasally with exopolysaccharide from B. longum subsp. longum stimulated TLR2 to promote allergic tolerance through IL-10 and an increased M1/M2 macrophage ratio [7]. Such anti-inflammatory effects help to maintain homeostatic immune tolerance to commensal gut microbiota [55], and they may directly influence the immune cells in the lung if ligands enter the circulation through cigarette smoke-induced “leaky” epithelial barriers [50]. Interestingly, cigarette smoke alters the structure of the TLR2-agonist exopolysaccharide [17], and TLR2 protects against cigarette smoke-induced lung pathology [56], but whether this is associated with stimulation by the gut microbiota is unclear.
Overall, this study demonstrates that the probiotic administration of B. longum subsp. longum, irrespective of their acetate-producing capacity, alleviated cigarette smoke-induced inflammation and the depletion of cecal butyrate levels. Further research in specific disease contexts will aid in determining whether this is a viable intervention.

4. Materials and Methods

4.1. Mice, Cigarette Smoke Exposure, and Probiotic Treatment

Female C57BL/6 mice (6–8 weeks old) were obtained from Australian Bioresources (Moss Vale, Australia). The mice were exposed to normal air or the smoke of twelve 3R4F reference cigarettes (University of Kentucky, Lexington, KY, USA) in a custom-designed, purpose-built, nose-only inhalation apparatus (CH Technologies, Westwood, NJ, USA)twice per day, 5 days per week, for 8 weeks, as previously described [24,51,52,57,58,59,60,61,62,63,64]. The mice were treated with 3 × 108 colony forming units (cfu) of B. longum subsp. longum by intragastric gavage, with non-treated mice receiving a vehicle (PBS + 0.05% L-cysteine, 150 μL). Two strains were utilized: B. longum subsp. longum NCC2705 (WT), or the genetically modified strain B. longum subsp. longum NCC9036 (MUT), where the sugar ABC transporter solute-binding protein BL0033 was disrupted by insertional mutagenesis, causing a significantly reduced capacity to produce acetate [5]. All of the experiments were approved by the University of Newcastle Animal Care and Ethics Committee (A-2013–303).

4.2. Airway Inflammation

Airway inflammation was quantified by the total and differential enumeration of inflammatory cells in BALF [24,56,57,58]. Briefly, two 0.4 mL washes with PBS of the left lung were performed, the red blood cells were removed by lysis, and the total inflammatory cells counted, cytospun, air dried and stained with May–Grunwald–Giemsa stain for differential counts.

4.3. Parenchymal Inflammation

For the histological analysis, the lung tissue was perfused with saline administered via a cardiac puncture, inflated (500 µL), and fixed in formalin prior to mounting, sectioning, and staining. Parenchymal inflammation was assessed from hematoxylin and eosin (H&E)-stained lung sections by counting the number of inflammatory cells in 10 randomized fields of view at 100× magnification [24,56,58,65].

4.4. RNA Extraction, Reverse Transcription, and qPCR

Freshly excised lung and colon tissues were snap frozen for subsequent storage at 80 °C. The RNA was extracted using standard protocols [50,56,58,59,65]. Briefly, the tissue was thawed and homogenized (1 mL of TRIzol, 4 °C; ThermoFisher Scientific, Scoresby, Australia) using a tissue tearor homogenizer (Biospec Products, Bartlesville, OK, USA). The DNA was precipitated by chloroform addition, which was followed by centrifugation (12,000× g, 15 min, 4 °C), and the RNA-containing aqueous phase was collected. The RNA was precipitated by the addition of isopropyl alcohol and pelleted (12,000× g, 10 min, 4 °C) prior to 2 washes with 75% ethanol. The RNA pellets were dissolved in nuclease-free water, and the RNA purity and quantity were assessed by absorbance at 260 and 280 nm using a Nanodrop spectrophotometer. For the cDNA synthesis, the RNA (1000 ng) was pre-incubated with 1 unit of DNAse I (Sigma-Aldrich, Macquarie Park, Aus; 15 min, room temperature). The samples were heated (10 min, 65 °C) prior to the addition of random hexamer primers (50 ng, Meridian Bioscience, Memphis, TN, USA) and dNTPs (10 mM, Meridian Bioscience, Memphis, TN, USA), and it was further heated (5 min, 65 °C). Dithiothreitol (10 mM) and Bioscript reverse transcriptase (200 units in reaction buffer, Meridian Bioscience, Memphis, TN, USA) were added, and reverse transcription was performed (10 min, 25 °C; 50 min, 42 °C; 15 min, 70 °C). The qPCR analysis was performed in 384-well plates with primers for specific transcripts (Table 1) and SYBR-green-based detection using a Viia 7 Real Time PCR system (ThermoFisher Scientific, Scoresby, Australia). Data are expressed as the relative abundance compared to hypoxanthine-guanine phosphoribosyltransferase (Hprt).

4.5. SCFA Quantification

The SCFA quantification was performed using established methods [66,67]. Briefly, caecum contents were mixed thoroughly with ultrapure water (2000 μL) by mechanically disrupting the contents using a pipette tip and vortexing them. The extracts were passed through 0.22 μm filters, and an aliquot of sample (100 μL) mixed with 10% formic acid (11 μL) and injected into a gas chromatograph with a polar capillary column (DB-FFAP; Agilent, Santa Clara, CA, USA) at 140 °C and a flame ionization detector at 250 °C. A standard calibration curve was used to quantify the SCFAs by the peak area.

4.6. Statistical Analysis

The statistical analysis was performed using GraphPad Prism v9.0 (San Diego, CA, USA), including the identification of the outliers using Grubbs test. The data were analyzed by one-way ANOVA with Holm-Šídák’s post hoc test.

Author Contributions

Conceptualization and methodology: K.F.B., S.L.G., D.L.A.W., P.H. and P.M.H. Investigation: K.F.B., S.L.G., J.C.H. and P.G.D. Analysis and interpretation: K.F.B., S.L.G., A.V., N.A., D.L.A.W., P.H. and P.M.H. Writing—Original Draft Preparation: K.F.B. Writing: Review and Editing: All authors. Supervision, Project Administration and Funding Acquisition: N.G.H., P.H., P.A.B.W. and P.M.H. All authors have read and agreed to the published version of the manuscript.

Funding

PMH and this work was funded by a Fellowship and grants from the National Health and Medical Research Council (NHMRC) of Australia (1175134, 1059283, 20110287), Australian Research Council (110101107), Cancer Council of NSW (190100091) and by The Rainbow Foundation, The University of Newcastle and UTS.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Animal Care and Ethics Committee of The University of Newcastle (protocol code A-2013-303; approved 22 April 2013).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data in this study are available upon request from the corresponding author.

Acknowledgments

We thank the Rainbow Foundation and Felicity and Michael Thompson for their continued support, and Kristy Wheeldon, Nathalie Kiaos and Matthew Bowman for their help with the animal models.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Lim, H.J.; Shin, H.S. Antimicrobial and Immunomodulatory Effects of Bifidobacterium Strains: A Review. J. Microbiol. Biotechnol. 2020, 30, 1793–1800. [Google Scholar] [CrossRef] [PubMed]
  2. Alessandri, G.; van Sinderen, D.; Ventura, M. The genus bifidobacterium: From genomics to functionality of an important component of the mammalian gut microbiota running title: Bifidobacterial adaptation to and interaction with the host. Comput. Struct. Biotechnol. J. 2021, 19, 1472–1487. [Google Scholar] [CrossRef] [PubMed]
  3. Kawahara, T.; Takahashi, T.; Oishi, K.; Tanaka, H.; Masuda, M.; Takahashi, S.; Takano, M.; Kawakami, T.; Fukushima, K.; Kanazawa, H.; et al. Consecutive oral administration of Bifidobacterium longum MM-2 improves the defense system against influenza virus infection by enhancing natural killer cell activity in a murine model. Microbiol. Immunol. 2015, 59, 1–12. [Google Scholar] [CrossRef] [PubMed]
  4. Khonsari, S.; Suganthy, M.; Burczynska, B.; Dang, V.; Choudhury, M.; Pachenari, A. A comparative study of bifidobacteria in human babies and adults. Biosci. Microbiota Food Health 2016, 35, 97–103. [Google Scholar]
  5. Fukuda, S.; Toh, H.; Hase, K.; Oshima, K.; Nakanishi, Y.; Yoshimura, K.; Tobe, T.; Clarke, J.M.; Topping, D.L.; Suzuki, T.; et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 2011, 469, 543–547. [Google Scholar] [CrossRef]
  6. Mortaz, E.; Adcock, I.M.; Ricciardolo, F.L.; Varahram, M.; Jamaati, H.; Velayati, A.A.; Folkerts, G.; Garssen, J. Anti-Inflammatory Effects of Lactobacillus Rahmnosus and Bifidobacterium Breve on Cigarette Smoke Activated Human Macrophages. PLoS ONE 2015, 10, e0136455. [Google Scholar] [CrossRef] [Green Version]
  7. Schiavi, E.; Plattner, S.; Rodriguez-Perez, N.; Barcik, W.; Frei, R.; Ferstl, R.; Kurnik-Lucka, M.; Groeger, D.; Grant, R.; Roper, J.; et al. Exopolysaccharide from Bifidobacterium longum subsp. longum 35624™ modulates murine allergic airway responses. Benef. Microbes 2018, 9, 761–773. [Google Scholar] [CrossRef]
  8. Budden, K.F.; Gellatly, S.L.; Wood, D.L.; Cooper, M.A.; Morrison, M.; Hugenholtz, P.; Hansbro, P.M. Emerging pathogenic links between microbiota and the gut-lung axis. Nat. Rev. Microbiol. 2017, 15, 55–63. [Google Scholar] [CrossRef]
  9. Alemao, C.A.; Budden, K.F.; Gomez, H.M.; Rehman, S.F.; Marshall, J.E.; Shukla, S.D.; Donovan, C.; Forster, S.C.; Yang, I.A.; Keely, S.; et al. Impact of diet and the bacterial microbiome on the mucous barrier and immune disorders. Allergy 2021, 76, 714–734. [Google Scholar] [CrossRef]
  10. Bowerman, K.L.; Rehman, S.F.; Vaughan, A.; Lachner, N.; Budden, K.F.; Kim, R.Y.; Wood, D.L.A.; Gellatly, S.L.; Shukla, S.D.; Wood, L.G.; et al. Disease-associated gut microbiome and metabolome changes in patients with chronic obstructive pulmonary disease. Nat. Commun. 2020, 11, 5886. [Google Scholar] [CrossRef]
  11. Vernocchi, P.; Gili, T.; Conte, F.; Del Chierico, F.; Conta, G.; Miccheli, A.; Botticelli, A.; Paci, P.; Caldarelli, G.; Nuti, M.; et al. Network Analysis of Gut Microbiome and Metabolome to Discover Microbiota-Linked Biomarkers in Patients Affected by Non-Small Cell Lung Cancer. Int. J. Mol. Sci. 2020, 21, 8730. [Google Scholar] [CrossRef] [PubMed]
  12. Glassner, K.L.; Abraham, B.P.; Quigley, E.M.M. The microbiome and inflammatory bowel disease. J. Allergy Clin. Immunol. 2020, 145, 16–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Chen, B.; Sun, L.; Zeng, G.; Shen, Z.; Wang, K.; Yin, L.; Xu, F.; Wang, P.; Ding, Y.; Nie, Q.; et al. Gut bacteria alleviate smoking-related NASH by degrading gut nicotine. Nature 2022, 610, 562–568. [Google Scholar] [CrossRef] [PubMed]
  14. Biedermann, L.; Brülisauer, K.; Zeitz, J.; Frei, P.; Scharl, M.; Vavricka, S.R.; Fried, M.; Loessner, M.J.; Rogler, G.; Schuppler, M. Smoking cessation alters intestinal microbiota: Insights from quantitative investigations on human fecal samples. Inflamm. Bowel. Dis. 2014, 20, 1496–1501. [Google Scholar] [CrossRef] [PubMed]
  15. Lin, R.; Zhang, Y.; Chen, L.; Qi, Y.; He, J.; Hu, M.; Zhang, Y.; Fan, L.; Yang, T.; Wang, L.; et al. The effects of cigarettes and alcohol on intestinal microbiota in healthy men. J. Microbiol. 2020, 58, 926–937. [Google Scholar] [CrossRef]
  16. Tomoda, K.; Kubo, K.; Asahara, T.; Andoh, A.; Nomoto, K.; Nishil, Y.; Yamamoto, Y.; Yoshikawa, M.; Kimura, H. Cigarette smoke decreases organic acids levels and population of bifidobacterium in caecum of rats. J. Toxicol. Sci. 2011, 36, 261–266. [Google Scholar] [CrossRef] [Green Version]
  17. Hu, J.; Wei, T.; Sun, S.; Zhao, A.; Xu, C. Effects of cigarette smoke condensate on the production and characterization of exopolysaccharides by Bifidobacterium. An. Acad. Bras. Cienc. 2015, 87, 997–1005. [Google Scholar] [CrossRef] [Green Version]
  18. Chen, J.; Chen, X.; Ho, C.L. Recent Development of Probiotic Bifidobacteria for Treating Human Diseases. Front. Bioeng. Biotechnol. 2021, 9, 770248. [Google Scholar] [CrossRef]
  19. Akay, H.K.; Bahar Tokman, H.; Hatipoglu, N.; Hatipoglu, H.; Siraneci, R.; Demirci, M.; Borsa, B.A.; Yuksel, P.; Karakullukcu, A.; Kangaba, A.A.; et al. The relationship between bifidobacteria and allergic asthma and/or allergic dermatitis: A prospective study of 0-3 years-old children in Turkey. Anaerobe 2014, 28, 98–103. [Google Scholar] [CrossRef]
  20. Budden, K.F.; Shukla, S.D.; Rehman, S.F.; Bowerman, K.L.; Keely, S.; Hugenholtz, P.; Armstrong-James, D.P.H.; Adcock, I.M.; Chotirmall, S.H.; Chung, K.F.; et al. Functional effects of the microbiota in chronic respiratory disease. Lancet. Respir. Med. 2019, 7, 907–920. [Google Scholar] [CrossRef]
  21. Jones, B.; Donovan, C.; Liu, G.; Gomez, H.M.; Chimankar, V.; Harrison, C.L.; Wiegman, C.H.; Adcock, I.M.; Knight, D.A.; Hirota, J.A.; et al. Animal models of COPD: What do they tell us? Respirology 2017, 22, 21–32. [Google Scholar] [CrossRef] [PubMed]
  22. Chotirmall, S.H.; Gellatly, S.L.; Budden, K.F.; Mac Aogain, M.; Shukla, S.D.; Wood, D.L.; Hugenholtz, P.; Pethe, K.; Hansbro, P.M. Microbiomes in respiratory health and disease: An Asia-Pacific perspective. Respirology 2017, 22, 240–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Tu, X.; Donovan, C.; Kim, R.Y.; Wark, P.A.B.; Horvat, J.C.; Hansbro, P.M. Asthma-COPD overlap: Current understanding and the utility of experimental models. Eur. Respir. Rev. 2021, 30, 190185. [Google Scholar] [CrossRef] [PubMed]
  24. Beckett, E.L.; Stevens, R.L.; Jarnicki, A.G.; Kim, R.Y.; Hanish, I.; Hansbro, N.G.; Deane, A.; Keely, S.; Horvat, J.C.; Yang, M.; et al. A new short-term mouse model of chronic obstructive pulmonary disease identifies a role for mast cell tryptase in pathogenesis. J. Allergy Clin. Immunol. 2013, 131, 752–762. [Google Scholar] [CrossRef] [Green Version]
  25. Shapiro, H.; Goldenberg, K.; Ratiner, K.; Elinav, E. Smoking-induced microbial dysbiosis in health and disease. Clin. Sci. (Lond.) 2022, 136, 1371–1387. [Google Scholar] [CrossRef]
  26. Dharwal, V.; Paudel, K.R.; Hansbro, P.M. Impact of bushfire smoke on respiratory health. Med. J. Aust. 2020, 213, 284–284.e1. [Google Scholar] [CrossRef]
  27. Tanigaki, R.; Takahashi, R.; Nguyen, M.T.T.; Nguyen, N.T.; Do, T.V.N.; Nguyen, H.X.; Kataoka, T. 4-Hydroxypanduratin A and Isopanduratin A Inhibit Tumor Necrosis Factor α-Stimulated Gene Expression and the Nuclear Factor κB-Dependent Signaling Pathway in Human Lung Adenocarcinoma A549 Cells. Biol. Pharm. Bull. 2019, 42, 26–33. [Google Scholar] [CrossRef] [Green Version]
  28. Liang, J.; Yuan, S.; Wang, X.; Lei, Y.; Zhang, X.; Huang, M.; Ouyang, H. Attenuation of pristimerin on TNF-α-induced endothelial inflammation. Int. Immunopharmacol. 2020, 82, 106326. [Google Scholar] [CrossRef]
  29. Wang, Y.; Xu, J.; Meng, Y.; Adcock, I.M.; Yao, X. Role of inflammatory cells in airway remodeling in COPD. Int. J. Chron. Obstruct. Pulmon. Dis. 2018, 13, 3341–3348. [Google Scholar] [CrossRef] [Green Version]
  30. Shang, G.S.; Liu, L.; Qin, Y.W. IL-6 and TNF-α promote metastasis of lung cancer by inducing epithelial-mesenchymal transition. Oncol. Lett. 2017, 13, 4657–4660. [Google Scholar] [CrossRef] [Green Version]
  31. Naderi, A.; Farmaki, E.; Chavez, B.; Cai, C.; Kaza, V.; Zhang, Y.; Soltanmohammadi, E.; Daneshvar, N.; Chatzistamou, I.; Kiaris, H. Beneficial effects of CCL8 inhibition at lipopolysaccharide-induced lung injury. iScience 2022, 25, 105520. [Google Scholar] [CrossRef] [PubMed]
  32. Betsuyaku, T.; Hamamura, I.; Hata, J.; Takahashi, H.; Mitsuhashi, H.; Adair-Kirk, T.L.; Senior, R.M.; Nishimura, M. Bronchiolar chemokine expression is different after single versus repeated cigarette smoke exposure. Respir. Res. 2008, 9, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Rouault, C.; Pellegrinelli, V.; Schilch, R.; Cotillard, A.; Poitou, C.; Tordjman, J.; Sell, H.; Clément, K.; Lacasa, D. Roles of chemokine ligand-2 (CXCL2) and neutrophils in influencing endothelial cell function and inflammation of human adipose tissue. Endocrinology 2013, 154, 1069–1079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Caramori, G.; Ruggeri, P.; Mumby, S.; Ieni, A.; Lo Bello, F.; Chimankar, V.; Donovan, C.; Andò, F.; Nucera, F.; Coppolino, I.; et al. Molecular links between COPD and lung cancer: New targets for drug discovery? Expert. Opin. Ther. Targets 2019, 23, 539–553. [Google Scholar] [CrossRef]
  35. Keely, S.; Talley, N.J.; Hansbro, P.M. Pulmonary-intestinal cross-talk in mucosal inflammatory disease. Mucosal. Immunol. 2012, 5, 7–18. [Google Scholar] [CrossRef] [Green Version]
  36. Cooper, G.E.; Mayall, J.; Donovan, C.; Haw, T.J.; Budden, K.F.; Hansbro, N.G.; Blomme, E.E.; Maes, T.; Kong, C.W.; Horvat, J.C.; et al. Anti-Viral Responses of Tissue-Resident CD49a+ Lung NK Cells Are Dysregulated in COPD. Am. J. Respir. Crit. Care Med. 2022. [Google Scholar] [CrossRef]
  37. Leung, J.M.; Tiew, P.Y.; Mac Aogáin, M.; Budden, K.F.; Yong, V.F.; Thomas, S.S.; Pethe, K.; Hansbro, P.M.; Chotirmall, S.H. The role of acute and chronic respiratory colonization and infections in the pathogenesis of COPD. Respirology 2017, 22, 634–650. [Google Scholar] [CrossRef] [Green Version]
  38. Novotny, L.A.; Bakaletz, L.O. Intercellular adhesion molecule 1 serves as a primary cognate receptor for the Type IV pilus of nontypeable Haemophilus influenzae. Cell. Microbiol. 2016, 18, 1043–1055. [Google Scholar] [CrossRef] [Green Version]
  39. Shukla, S.D.; Shastri, M.D.; Vanka, S.K.; Jha, N.K.; Dureja, H.; Gupta, G.; Chellappan, D.K.; Oliver, B.G.; Dua, K.; Walters, E.H. Targeting intercellular adhesion molecule-1 (ICAM-1) to reduce rhinovirus-induced acute exacerbations in chronic respiratory diseases. Inflammopharmacology 2022, 30, 725–735. [Google Scholar] [CrossRef]
  40. Vieira, A.T.; Rocha, V.M.; Tavares, L.; Garcia, C.C.; Teixeira, M.M.; Oliveira, S.C.; Cassali, G.D.; Gamba, C.; Martins, F.S.; Nicoli, J.R. Control of Klebsiella pneumoniae pulmonary infection and immunomodulaation by oral treatment with commensal probiotic Bifidobacterium longum 51A. Microbes Infect. 2016, 18, 180–189. [Google Scholar] [CrossRef]
  41. Wu, S.; Jiang, Z.Y.; Sun, Y.F.; Yu, B.; Chen, J.; Dai, C.Q.; Wu, X.L.; Tang, X.L.; Chen, X.Y. Microbiota regulates the TLR7 signaling pathway against respiratory tract influenza A virus infection. Curr. Microbiol. 2013, 67, 414–422. [Google Scholar] [CrossRef] [PubMed]
  42. Luoto, R.; Ruuskanen, O.; Waris, M.; Kalliomäki, M.; Salminen, S.; Isolauri, E. Prebiotic and probiotic supplementation prevents rhinovirus infections in preterm infants: A randomized placebo-controlled trial. J. Allergy Clin. Immunol. 2014, 133, 405–413. [Google Scholar] [CrossRef] [PubMed]
  43. King, S.; Glanville, J.; Sanders, M.E.; Fitzgerald, A.; Varley, D. Effectiveness of probiotics on the duration of illness in healthy children and adults who develop common acute respiratory infectious conditions: A systematic review and meta-analysis. Br. J. Nutr. 2014, 112, 41–54. [Google Scholar] [CrossRef] [PubMed]
  44. West, N.P.; Horn, P.L.; Pyne, D.B.; Gebski, V.J.; Lahtinen, S.J.; Fricker, P.A.; Cripps, A.W. Probiotic supplementation for respiratory and gastrointestinal illness symptoms in healthy physically active individuals. Clin. Nutr. 2014, 33, 581–587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Taftaf, R.; Liu, X.; Singh, S.; Jia, Y.; Dashzeveg, N.K.; Hoffmann, A.D.; El-Shennawy, L.; Ramos, E.K.; Adorno-Cruz, V.; Schuster, E.J.; et al. ICAM1 initiates CTC cluster formation and trans-endothelial migration in lung metastasis of breast cancer. Nat. Commun. 2021, 12, 4867. [Google Scholar] [CrossRef] [PubMed]
  46. Choi, K.A.; Kim, J.H.; Ryu, K.; Kaushik, N. Current Nanomedicine for Targeted Vascular Disease Treatment: Trends and Perspectives. Int. J. Mol. Sci. 2022, 23, 12397. [Google Scholar] [CrossRef]
  47. Jang, Y.O.; Lee, S.H.; Choi, J.J.; Kim, D.H.; Choi, J.M.; Kang, M.J.; Oh, Y.M.; Park, Y.J.; Shin, Y.; Lee, S.W. Fecal microbial transplantation and a high fiber diet attenuates emphysema development by suppressing inflammation and apoptosis. Exp. Mol. Med. 2020, 52, 1128–1139. [Google Scholar] [CrossRef]
  48. He, F.; Morita, H.; Ouwehand, A.C.; Hosoda, M.; Hiramatsu, M.; Kurisaki, J.; Isolauri, E.; Benno, Y.; Salminen, S. Stimulation of the secretion of pro-inflammatory cytokines by Bifidobacterium strains. Microbiol. Immunol. 2002, 46, 781–785. [Google Scholar] [CrossRef]
  49. Kulkarni, R.; Antala, S.; Wang, A.; Amaral, F.E.; Rampersaud, R.; LaRussa, S.J.; Planet, P.J.; Ratner, A.J. Cigarette smoke increases Staphylococcus aureus biofilm formation via oxidative stress. Intect. Immun. 2012, 80, 3804–3811. [Google Scholar] [CrossRef] [Green Version]
  50. Fricker, M.; Goggins, B.J.; Mateer, S.; Jones, B.; Kim, R.Y.; Gellatly, S.L.; Jarnicki, A.G.; Powell, N.; Oliver, B.G.; Radford-Smith, G.; et al. Chronic cigarette smoke exposure induces systemic hypoxia that drives intestinal dysfunction. JCI Insight 2018, 3, 94040. [Google Scholar] [CrossRef] [Green Version]
  51. Liu, G.; Jarnicki, A.G.; Paudel, K.R.; Lu, W.; Wadhwa, R.; Philp, A.M.; Van Eeckhoutte, H.; Marshall, J.E.; Malyla, V.; Katsifis, A.; et al. Adverse roles of mast cell chymase-1 in chronic obstructive pulmonary disease. Eur. Respir. J. 2022. [Google Scholar] [CrossRef] [PubMed]
  52. Tu, X.; Kim, R.Y.; Brown, A.C.; de Jong, E.; Jones-Freeman, B.; Ali, M.K.; Gomez, H.M.; Budden, K.F.; Starkey, M.R.; Cameron, G.J.M.; et al. Airway and parenchymal transcriptomics in a novel model of asthma and COPD overlap. J. Allergy Clin. Immunol. 2022, 150, 817–829.e816. [Google Scholar] [CrossRef] [PubMed]
  53. Rivière, A.; Gagnon, M.; Weckx, S.; Roy, D.; De Vuyst, L. Mutual Cross-Feeding Interactions between Bifidobacterium longum subsp. longum NCC2705 and Eubacterium rectale ATCC 33656 Explain the Bifidogenic and Butyrogenic Effects of Arabinoxylan Oligosaccharides. Appl. Environ. Microbiol. 2015, 81, 7767–7781. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Fernandez-Julia, P.; Commane, D.M.; van Sinderen, D.; Munoz-Munoz, J. Cross-feeding interactions between human gut commensals belonging to the Bacteroides and Bifidobacterium genera when grown on dietary glycans. Microbiome Res. Rep. 2022, 1, 12. [Google Scholar] [CrossRef]
  55. Ruff, W.E.; Greiling, T.M.; Kriegel, M.A. Host-microbiota interactions in immune-mediated diseases. Nat. Rev. Microbiol. 2020, 18, 521–538. [Google Scholar] [CrossRef]
  56. Haw, T.J.; Starkey, M.R.; Pavlidis, S.; Fricker, M.; Arthurs, A.L.; Nair, P.M.; Liu, G.; Hanish, I.; Kim, R.Y.; Foster, P.S.; et al. Toll-like receptor 2 and 4 have opposing roles in the pathogenesis of cigarette smoke-induced chronic obstructive pulmonary disease. Am. J. Physiol. Lung. Cell. Mol. Physiol. 2018, 314, L298–L317. [Google Scholar] [CrossRef]
  57. Hansbro, P.M.; Hamilton, M.J.; Fricker, M.; Gellatly, S.L.; Jarnicki, A.G.; Zheng, D.; Frei, S.M.; Wong, G.W.; Hamadi, S.; Zhou, S.; et al. Importance of mast cell Prss31/transmembrane tryptase/tryptase-gamma in lung function and experimental chronic obstructive pulmonary disease and colitis. J. Biol. Chem. 2014, 289, 18214–18227. [Google Scholar] [CrossRef] [Green Version]
  58. Starkey, M.R.; Plank, M.W.; Casolari, P.; Papi, A.; Pavlidis, S.; Guo, Y.; Cameron, G.J.M.; Haw, T.J.; Tam, A.; Obiedat, M.; et al. IL-22 and its receptors are increased in human and experimental COPD and contribute to pathogenesis. Eur. Respir. J. 2019, 54, 1800174. [Google Scholar] [CrossRef]
  59. Hsu, A.C.; Dua, K.; Starkey, M.R.; Haw, T.J.; Nair, P.M.; Nichol, K.; Zammit, N.; Grey, S.T.; Baines, K.J.; Foster, P.S.; et al. MicroRNA-125a and -b inhibit A20 and MAVS to promote inflammation and impair antiviral response in COPD. JCI Insight 2017, 2, e90443. [Google Scholar] [CrossRef] [Green Version]
  60. Hsu, A.C.; Starkey, M.R.; Hanish, I.; Parsons, K.; Haw, T.J.; Howland, L.J.; Barr, I.; Mahony, J.B.; Foster, P.S.; Knight, D.A.; et al. Targeting PI3K-p110α Suppresses Influenza Virus Infection in Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med. 2015, 191, 1012–1023. [Google Scholar] [CrossRef]
  61. Prihandoko, R.; Kaur, D.; Wiegman, C.H.; Alvarez-Curto, E.; Donovan, C.; Chachi, L.; Ulven, T.; Tyas, M.R.; Euston, E.; Dong, Z.; et al. Pathophysiological regulation of lung function by the free fatty acid receptor FFA4. Sci. Transl. Med. 2020, 12, aaw9009. [Google Scholar] [CrossRef] [PubMed]
  62. Schanin, J.; Gebremeskel, S.; Korver, W.; Falahati, R.; Butuci, M.; Haw, T.J.; Nair, P.M.; Liu, G.; Hansbro, N.G.; Hansbro, P.M.; et al. A monoclonal antibody to Siglec-8 suppresses non-allergic airway inflammation and inhibits IgE-independent mast cell activation. Mucosal Immunol. 2021, 14, 366–376. [Google Scholar] [CrossRef] [PubMed]
  63. Tay, H.L.; Kaiko, G.E.; Plank, M.; Li, J.; Maltby, S.; Essilfie, A.T.; Jarnicki, A.; Yang, M.; Mattes, J.; Hansbro, P.M.; et al. Antagonism of miR-328 increases the antimicrobial function of macrophages and neutrophils and rapid clearance of non-typeable Haemophilus influenzae (NTHi) from infected lung. PLoS Pathog. 2015, 11, e1004549. [Google Scholar] [CrossRef]
  64. Liu, G.; Cooley, M.A.; Jarnicki, A.G.; Hsu, A.C.; Nair, P.M.; Haw, T.J.; Fricker, M.; Gellatly, S.L.; Kim, R.Y.; Inman, M.D.; et al. Fibulin-1 regulates the pathogenesis of tissue remodeling in respiratory diseases. JCI Insight 2016, 1, 86380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Lu, Z.; Van Eeckhoutte, H.P.; Liu, G.; Nair, P.M.; Jones, B.; Gillis, C.M.; Nalkurthi, B.C.; Verhamme, F.; Buyle-Huybrecht, T.; Vandenabeele, P.; et al. Necroptosis Signalling Promotes Inflammation, Airway Remodelling and Emphysema in COPD. Am. J. Respir. Crit. Care Med. 2021. [Google Scholar] [CrossRef] [PubMed]
  66. Dennis, P.G.; Harnisch, F.; Yeoh, Y.K.; Tyson, G.W.; Rabaey, K. Dynamics of cathode-associated microbial communities and metabolite profiles in a glycerol-fed bioelectrochemical system. Appl. Environ. Microbiol. 2013, 79, 4008–4014. [Google Scholar] [CrossRef] [Green Version]
  67. Lynch, J.P.; Werder, R.B.; Loh, Z.; Sikder, M.A.A.; Curren, B.; Zhang, V.; Rogers, M.J.; Lane, K.; Simpson, J.; Mazzone, S.B.; et al. Plasmacytoid dendritic cells protect from viral bronchiolitis and asthma through semaphorin 4a-mediated T reg expansion. J. Exp. Med. 2018, 215, 537–557. [Google Scholar] [CrossRef] [PubMed]
Ijms 24 00252 g001 550
Figure 1. Probiotic Bifidobacterium longum subsp. longum reduced cigarette smoke-induced lung inflammation. Mice received wild-type (WT) or mutant (MUT) B. longum subsp. longum or vehicle (Veh) by oral gavage and were exposed to cigarette smoke (CS; black) or normal air (Air; white) for 8 weeks. (A) Total leukocytes, (B) neutrophils, (C) macrophages, and (D) lymphocytes were quantified in bronchoalveolar lavage fluid (BALF). (E) Immune cells in lung parenchyma were quantified in hematoxylin/eosin-stained lung sections. (F) Representative histology images. Black arrows indicate immune cells. Data are presented as mean ± SEM. N = 5–6. * = p < 0.05.
Figure 1. Probiotic Bifidobacterium longum subsp. longum reduced cigarette smoke-induced lung inflammation. Mice received wild-type (WT) or mutant (MUT) B. longum subsp. longum or vehicle (Veh) by oral gavage and were exposed to cigarette smoke (CS; black) or normal air (Air; white) for 8 weeks. (A) Total leukocytes, (B) neutrophils, (C) macrophages, and (D) lymphocytes were quantified in bronchoalveolar lavage fluid (BALF). (E) Immune cells in lung parenchyma were quantified in hematoxylin/eosin-stained lung sections. (F) Representative histology images. Black arrows indicate immune cells. Data are presented as mean ± SEM. N = 5–6. * = p < 0.05.
Ijms 24 00252 g001
Ijms 24 00252 g002 550
Figure 2. Probiotic Bifidobacterium longum subsp. longum suppressed cigarette smoke-induced cytokine and adhesion factor gene expression. Mice were treated with wild-type (WT) or mutant (MUT) B. longum subsp. longum or vehicle (Veh) by oral gavage and were exposed to cigarette smoke (CS: black) or normal air (Air: white) for 8 weeks. (A) Tnfa, (B) Ccl8, (C) Cxcl2, (D) Ccl22, (E) Vcam1, and (F) Icam1 gene expression relative to Hprt was assessed by qPCR in lung tissues. Data are presented as mean ± SEM. N = 5–6. * = p < 0.05.
Figure 2. Probiotic Bifidobacterium longum subsp. longum suppressed cigarette smoke-induced cytokine and adhesion factor gene expression. Mice were treated with wild-type (WT) or mutant (MUT) B. longum subsp. longum or vehicle (Veh) by oral gavage and were exposed to cigarette smoke (CS: black) or normal air (Air: white) for 8 weeks. (A) Tnfa, (B) Ccl8, (C) Cxcl2, (D) Ccl22, (E) Vcam1, and (F) Icam1 gene expression relative to Hprt was assessed by qPCR in lung tissues. Data are presented as mean ± SEM. N = 5–6. * = p < 0.05.
Ijms 24 00252 g002
Ijms 24 00252 g003 550
Figure 3. Probiotic Bifidobacterium longum subsp. longum protected against cigarette smoke-induced decreases in cecal butyrate. Mice treated with wild-type (WT) or mutant (MUTMUT) B. longum subsp. longum or vehicle (Veh) by oral gavage and were exposed to cigarette smoke (CS: black) or normal air (Air: white) for 8 weeks. (A) Total levels of short chain fatty acids (SCFAs), (B) acetate, (C) propionate, and (D) butyrate were quantified in cecal contents by gas chromatography. Data are presented as mean ± SEM. N = 5–6. * = p < 0.05.
Figure 3. Probiotic Bifidobacterium longum subsp. longum protected against cigarette smoke-induced decreases in cecal butyrate. Mice treated with wild-type (WT) or mutant (MUTMUT) B. longum subsp. longum or vehicle (Veh) by oral gavage and were exposed to cigarette smoke (CS: black) or normal air (Air: white) for 8 weeks. (A) Total levels of short chain fatty acids (SCFAs), (B) acetate, (C) propionate, and (D) butyrate were quantified in cecal contents by gas chromatography. Data are presented as mean ± SEM. N = 5–6. * = p < 0.05.
Ijms 24 00252 g003
Table
Table 1. List of primers for qPCR.
Table 1. List of primers for qPCR.
TargetForward Sequence (5′–3′)Reverse Sequence (5′–3′)
HprtAGGCCAGACTTTGTTGGATTTGAACAACTTGCGCTCATCTTAGGCTTT
TnfaTCTGTCTACTGAACTTCGGGGTGATTGTCTTTGAGATCCATGCCGTT
Ccl8GCAGCAGGTGACTGGAGCCTGCCTGCTGCTCATAGCTGTCCC
Cxcl2TGCTGCTGGCCACCAACCACAGTGTGACGCCCCCAGGACC
Ccl22TGGCTACCCTGCGTCGTGTCCCACGTGATGGCAGAGGGTGACGG
Vcam1CCCACCATTGAAGATACCGGGATAGTATAGGAGAGGGGCTGACC
Icam1GCCTTGGTAGAGGTGACTGAGGACCGGAGCTGAAAAGTTGTA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Budden, K.F.; Gellatly, S.L.; Vaughan, A.; Amorim, N.; Horvat, J.C.; Hansbro, N.G.; Wood, D.L.A.; Hugenholtz, P.; Dennis, P.G.; Wark, P.A.B.; et al. Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice. Int. J. Mol. Sci. 2023, 24, 252. https://doi.org/10.3390/ijms24010252

AMA Style

Budden KF, Gellatly SL, Vaughan A, Amorim N, Horvat JC, Hansbro NG, Wood DLA, Hugenholtz P, Dennis PG, Wark PAB, et al. Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice. International Journal of Molecular Sciences. 2023; 24(1):252. https://doi.org/10.3390/ijms24010252

Chicago/Turabian Style

Budden, Kurtis F., Shaan L. Gellatly, Annalicia Vaughan, Nadia Amorim, Jay C. Horvat, Nicole G. Hansbro, David L. A. Wood, Philip Hugenholtz, Paul G. Dennis, Peter A. B. Wark, and et al. 2023. "Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice" International Journal of Molecular Sciences 24, no. 1: 252. https://doi.org/10.3390/ijms24010252

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop