Next Article in Journal
Green Synthesis of Endolichenic Fungi Functionalized Silver Nanoparticles: The Role in Antimicrobial, Anti-Cancer, and Mosquitocidal Activities
Previous Article in Journal
Salivary Exosomal miRNA-1307-5p Predicts Disease Aggressiveness and Poor Prognosis in Oral Squamous Cell Carcinoma Patients
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 18
10.3390/ijms231810603
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

1,25-Dihydroxyvitamin D3 Negatively Regulates the Inflammatory Response to Porcine Epidemic Diarrhea Virus Infection by Inhibiting NF-κB and JAK/STAT Signaling Pathway in IPEC-J2 Porcine Epithelial Cells

by
Jiwen Yang
,
Daiwen Chen
,
Gang Tian
,
Xiangbing Mao
,
Jun He
,
Ping Zheng
,
Jie Yu
,
Yuheng Luo
,
Junqiu Luo
,
Zhiqing Huang
,
Aimin Wu
,
Hui Yan
and
Bing Yu
*
Key Laboratory of Animal Disease Resistance and Nutrition, Institute of Animal Nutrition, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(18), 10603; https://doi.org/10.3390/ijms231810603
Submission received: 6 August 2022 / Revised: 6 September 2022 / Accepted: 8 September 2022 / Published: 13 September 2022
(This article belongs to the Section Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
Porcine epidemic diarrhea virus (PEDV) infection causes watery diarrhea and vomiting in piglets. The pathogenesis of PEDV infection is related to intestinal inflammation. It is known that 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) has potent anti-inflammatory activity, but it is unknown whether 1,25(OH)2D3 can inhibit the PEDV-induced inflammatory response and the underlying mechanism. We used transcriptome analysis, gene and protein expression, RNA interference and overexpression, and other techniques to study the anti-inflammatory effects of 1,25(OH)2D3 on PEDV infection in IPEC-J2 cells. The results showed that interleukin 19 (IL-19) and C-C motif chemokine ligand 20 (CCL20) gene expression were enhanced with the increase in PEDV infection time in IPEC-J2 cells. Interestingly, 1,25(OH)2D3 supplementation obviously inhibited IL-19 and CCL20 expression induced by PEDV. Meanwhile, we also found that 1,25(OH)2D3 reduced p-NF-κB, p-STAT1, and p-STAT3 protein levels induced by PEDV at 24 h post-infection. IκBα and SOCS3, NF-κB, and STAT inhibitor respectively, were increased by 1,25(OH)2D3 supplementation upon PEDV infection. In addition, 1,25(OH)2D3 supplementation inhibited ISG15 and MxA expression induced by PEDV. Although 1,25(OH)2D3 suppressed the JAK/STAT signal pathway and antiviral gene expression, it had no significant effects on PEDV replication and IFN-α-induced antiviral effects. In addition, when the vitamin D receptor (VDR) was silenced by siRNA, the anti-inflammatory effect of 1,25(OH)2D3 was inhibited. Meanwhile, the overexpression of VDR significantly downregulated IL-19 and CCL20 expression induced by PEDV infection. Together, our results provide powerful evidence that 1,25(OH)2D3 could alleviate PEDV-induced inflammation by regulating the NF-κB and JAK/STAT signaling pathways through VDR. These results suggest that vitamin D could contribute to inhibiting intestinal inflammation and alleviating intestinal damage in PEDV-infected piglets, which offers new approaches for the development of nutritional strategies to prevent PEDV infection in piglets.

1. Introduction

Porcine epidemic diarrhea virus (PEDV) infection causes watery diarrhea, vomiting, anorexia, and high mortality in suckling piglets [1], which leads to serious economic losses in many pig-producing countries. PEDV infects and replicates in small intestinal enterocytes and causes impaired intestinal morphology and disordered barrier function [2,3,4]. Intestinal damage caused by PEDV infection is often accompanied by increasing inflammatory cytokine expression and secretion. Wang et al. [5] reported that PEDV infection significantly enhanced INF-α, IFN-β, TNF-α, and IL-6 expression in IPEC-J2 cells. In vivo, PEDV infection also stimulated proinflammatory cytokine responses [6]. In addition, NF-κB activation was found due to PEDV infection in porcine small intestinal epithelial cells [7]. PEDV not only induced an inflammatory response in porcine intestinal epithelial cells, but also increased IL-1β, IL-6, IL-8, and TNF-α expression in Vero cells [8]. This evidence indicates that PEDV infection can lead to severe inflammatory responses. The production of proinflammatory cytokines is an important part of the host innate immunity; however, an excessive rise in proinflammatory cytokines or uncontrolled inflammation would be detrimental to the intestinal structure and function. Therefore, alleviation of inflammatory cytokine expression will be conducive to the prevention of intestinal injury induced by PEDV.
It has long been thought that vitamin D (VD) not only regulates calcium and phosphorus absorption, but also plays important roles in immune regulation. Previous reports have shown that VD has broad-spectrum antiviral effects, such as against HIV [9], hepatitis C virus [10], and dengue virus [11] infection. VD also has anti-inflammatory effects, which can inhibit the inflammatory cytokine expression induced by various viral infections [11,12,13]. In addition, VD inhibits the inflammatory response to respiratory syncytial virus (RSV) infection without jeopardizing viral clearance [14]. This indicates that VD can inhibit virus-induced inflammation independently of viral clearance. Our previous study demonstrated that 25(OH)D3 inhibits inflammatory cytokine expression induced by PEDV infection in the jejunal mucosa of weaned pigs [15]. Therefore, it is possible that 25(OH)D3 can alleviate the PEDV-induced intestinal inflammatory status and injury of piglets by suppressing the proinflammatory response; however, the underlying mechanism is not clear. It is known that 1,25(OH)2D3 is the active metabolite of VD and is widely used in vitro studies. In this study, we used 1,25(OH)2D3 to explore whether it can inhibit the PEDV-induced inflammatory response and the underlying mechanism in vitro.
Increasing evidence shows that the innate immune system is always activated by viral infection, leading to NF-κB activation for interferons’ (IFNs) and other cytokines’ production [16]. Then, IFNs bind to their receptors and activate the JAK/STAT pathway to induce interferon-stimulating gene (ISG) production and establish an antiviral state [17]. However, VD can inhibit NF-κB activation and decrease the NF-κB-driven gene expression induced by RSV infection [14]. In addition, VD also can repress RSV-induced STAT1 activation and target gene expression, thereby reducing immunopathology [18]. Therefore, we postulated that VD can alleviate the PEDV-induced intestinal inflammatory status and injury by inhibiting NF-κB and JAK/STAT signaling to suppress the production of proinflammatory cytokines.

2. Results

2.1. PEDV Induced Proinflammatory Cytokine Expression and NF-κB Activation in IPEC-J2 Cells

The original differentially expressed gene data are included in the Supplementary Materials. As presented in Table 1, the transcriptomics analysis showed that PEDV infection significantly increased IL-19 and CCL20 mRNA expression in IPEC-J2 cells. On this basis, the mRNA expression of IL-19 and CCL20 was verified by real-time qPCR (RT-qPCR). PEDV infection significantly increased IL-19 and CCL20 gene expression with time increasing (Figure 1A,B) in IPEC-J2 cells. Moreover, we also determined IL-8 mRNA expression with PEDV infection. Unlike the IL-19 and CCL20 mRNA expression profiles, PEDV only increased IL-8 gene expression at an early time point post-infection (Figure 1C).
NF-κB plays a central role in regulating a wide range of genes that control immunity and inflammatory responses. Thus, we proceeded to evaluate both NF-κB and phosphorylated NF-κB (p-NF-κB) protein levels. The results showed that PEDV infection obviously increased p-NF-κB levels both in the early and late stages of infection (Figure 1D).

2.2. 1,25(OH)2D3 Suppressed Proinflammatory Cytokine Expression and NF-κB Activation Induced by PEDV In Vitro

Firstly, we tested whether 1,25(OH)2D3 can inhibit the inflammatory cytokine expression induced by PEDV in IPEC-J2 cells. Results showed that pretreatment with 1,25(OH)2D3 significantly suppressed IL-8, IL-19, and CCL20 mRNA expression induced by PEDV at 1 h post-infection (Figure 2A–C), but did not decrease p-NF-κB protein levels (Figure 2D).
Nevertheless, pretreatment with 1,25(OH)2D3 significantly suppressed IL-19 and CCL20 mRNA expression and decreased p-NF-κB protein levels induced by PEDV at 24 h post-infection in IPEC-J2 cells (Figure 3A). Moreover, we also confirmed that 1,25(OH)2D3 could inhibit PEDV-induced proinflammatory cytokine expression and p-NF-κB protein levels at 24 h post-infection in 3D4/21 cells (Figure 3B). The results indicated that 1,25(OH)2D3 not only inhibited the inflammatory response induced by PEDV infection in intestinal epithelial cells, but also in immune cells.
BAY 11-7082, an NF-κB inhibitor, was used to verify whether inhibiting NF-κB activity can suppress PEDV-induced inflammatory cytokine expression. The result showed that BAY 11-7082 decreased IL-19 and CCL20 mRNA expression induced by PEDV infection (Figure 4A). It suggested that 1,25(OH)2D3 could suppress PEDV-induced inflammatory cytokine expression through inhibiting NF-κB activation. In addition, we also found that IκBα, an NF-κB inhibitor, was increased by 1,25(OH)2D3 treatment in the presence or absence of PEDV infection (Figure 4B).

2.3. 1,25(OH)2D3 Suppressed JAK/STAT Activation Induced by PEDV in IEPC-J2 and 3D4/21 Cells

Since 1,25(OH)2D3 did not inhibit NF-κB activation at 1 h post-PEDV-infection, we speculated that 1,25(OH)2D3 may also inhibit the production of inflammatory cytokines through other pathways. The JAK/STAT pathway plays important roles in the regulation of immune responses and inflammatory gene expression [19,20]. We next examined JAK/STAT activation after PEDV infection. As shown in Figure 5A, PEDV infection obviously increased p-STAT1 and p-STAT3 levels in IPEC-J2 cells. However, 1,25(OH)2D3 treatment not only inhibited p-STAT1 and p-STAT3 levels at 1 h post-infection (Figure 5B), but also at 24 h post-infection (Figure 5C) in IPEC-J2 cells. Moreover, we also confirmed that 1,25(OH)2D3 could inhibit PEDV-induced JAK/STAT pathway activation at 24 h post-infection in 3D4/21 cells (Figure 5D).
In addition, a JAK inhibitor (AG490) and STAT inhibitor (NSC 74859) were used to verify whether the inhibition of the JAK/STAT pathway can inhibit the proinflammatory cytokine expression induced by PEDV infection. The results showed that both AG490 and NSC 74859 decreased the production of proinflammatory cytokines induced by PEDV (Figure 6A). This suggested that 1,25(OH)2D3 could inhibit PEDV-induced proinflammatory cytokine expression through suppressing the JAK/STAT pathway. Moreover, we also found that SOCS3, a JAK/STAT inhibitor, was increased by 1,25(OH)2D3 treatment (Figure 6B). This indicated that 1,25(OH)2D3 inhibited the JAK/STAT pathway by increasing the SOCS3 protein level, thereby inhibiting the expression of proinflammatory cytokines induced by PEDV.

2.4. Effects of 1,25(OH)2D3 on Antiviral Effects

Generally, upon viral infection, IFNs are often produced to activate the JAK/STAT pathway, and then induce ISG expression and establish an antiviral state. Since 1,25(OH)2D3 suppressed PEDV-induced JAK/STAT activation, it is not clear whether 1,25(OH)2D3 would attenuate the ability of the IFN pathway against PEDV. As shown in Figure 7A, 1,25(OH)2D3 inhibited ISG15 and MxA expression induced by PEDV, which suggested that 1,25(OH)2D3 may be beneficial for viral replication. Fortunately, the result demonstrated that 1,25(OH)2D3 had no effect on PEDV replication after 24 h post-infection (Figure 7B), and this result is consistent with our previous study [21]. It indicated that despite the inhibition of ISG15 and MxA expression, viral replication was not influenced by 1,25(OH)2D3. In addition, we also found that 1,25(OH)2D3 inhibited poly(I:C)-induced proinflammatory cytokine expression (Figure 7C). Poly(I:C), a synthetic dsRNA, is often used to mimic viral infection. These results indicated that 1,25(OH)2D3 could inhibit the PEDV-induced excessive burst in proinflammatory cytokines but had no effect on PEDV replication after 24 h post-infection.
Moreover, we examined the effects of 1,25(OH)2D3 on JAK/STAT pathway activation and antiviral gene expression with IFN-α stimulation. Here, 1,25(OH)2D3 had no effect on ISG15 and MxA expression induced by recombinant swine IFN-α (Figure 8A). We also found that 1,25(OH)2D3 decreased the IFN-α-induced p-STAT3 level, but it obviously increased the p-STAT1 level (Figure 8B). Upon PEDV infection, 1,25(OH)2D3 had no effect on ISG15 and MxA expression induced by IFN-α, as well as the anti-PEDV effect of IFN-α (Figure 8C).

2.5. Effects of VDR on Anti-Inflammation of 1,25(OH)2D3

Generally, 1,25(OH)2D3 exerts its functions through binding to the VD receptor (VDR). To confirm that 1,25(OH)2D3 inhibited PEDV-induced proinflammatory cytokine expression through VDR, we tested whether knockdown VDR gene expression would impact the anti-inflammatory effect of 1,25(OH)2D3. Firstly, we found that 1,25(OH)2D3 increased the VDR protein level with or without PEDV infection (Figure 9A). Then, IPEC-J2 cells were transfected with control siRNA and VDR siRNA. The results showed that the anti-inflammatory effect of 1,25(OH)2D3 was eliminated by VDR siRNA (Figure 9B). In addition, we also found that the overexpression of VDR significantly inhibited the inflammatory cytokine expression induced by PEDV (Figure 9C).

3. Discussion

PEDV can infect pigs of all ages and cause high mortality in neonatal piglets, resulting in heavy economic losses in the pig breeding industry. Madson et al. [22] reported that PEDV infected intestinal epithelial cells and caused severe atrophy and variable fusion of villi with enterocyte necrosis. In addition, PEDV infection always induces a large number of inflammatory cytokines’ expression in porcine intestinal epithelial cells [5,6,7]. It is well documented that excessive intestinal inflammation can damage the integrity of the intestinal mucosal barrier, resulting in impaired intestinal barrier function [23,24]. Therefore, inhibiting PEDV-induced proinflammatory cytokines’ excessive expression is beneficial for alleviating intestinal damage.
IL-19 plays important roles in inflammatory responses and induces apoptosis [25,26]. CCL20 is also considered to be one of the markers of inflammation [27]. In this study, the transcriptomics analysis showed that PEDV infection significantly increased IL-19 and CCL20 mRNA expression in IPEC-J2 cells. Increasing evidence has revealed that 1,25(OH)2D3 has a strong anti-inflammatory effect [28]. In our study, 1,25(OH)2D3 not only inhibited PEDV-induced IL-19 and CCL20 expression, but also downregulated poly(I:C)-induced IL-19 and CCL20 expression. Poly(I:C), a synthetic dsRNA, is often used to mimic viral infection. Both Drirh et al. [13] and Hansdottir et al. [14] have shown that VD inhibits the inflammatory cytokine expression induced by virus infection without affecting viral clearance. In this study, we also found that 1,25(OH)2D3 had no effect on PEDV replication. These results indicated that 1,25(OH)2D3 could inhibit the PEDV-induced proinflammatory response independently of viral clearance.
NF-κB plays a central role in regulating a wide range of genes that control immunity and inflammatory responses. NF-κB is inactive in cytoplasm through interaction with inhibitory proteins, IκBs (e.g., IκBα, IκBβ) [29]. IκBs can be phosphorylated by IκB kinase (IKK) and then degraded by the ubiquitin/proteasome pathway [30]. Afterwards, the consequence is the nuclear entry of NF-κB and this induces a variety of genes’ expression [31]. Cao et al. [6] have shown that PEDV infection induces NF-κB activation in porcine intestinal epithelial cells. However, 1,25(OH)2D3 has been found to induce IκBα expression and inhibit RSV induced-inflammatory cytokines’ expression [14]. Moreover, 1,25(OH)2D3 also decreases the DNA binding of NF-κB in keratinocyte cells [32] and 1,25(OH)2D3 exerts its functions through binding to VDR. VDR can physically interact with IKKβ and this interaction is reinforced by 1,25(OH)2D3, thereby inhibiting NF-κB activation [33]. Our results showed that 1,25(OH)2D3 treatment decreased p-NF-κB levels induced by PEDV and increased IκBα protein levels with or without PEDV infection. These results suggested that 1,25(OH)2D3 inhibited PEDV-induced inflammatory cytokine expression by increasing the IκBα protein level. However, in this study, we did not find that 1,25(OH)2D3 reduced the level of p-NF-κB at 1 h after PEDV infection. The mechanism for this phenomenon is unclear. We speculated that 1,25(OH)2D3 may induce anti-inflammatory cytokine expression at an early time post-infection, but this needs to be further investigated.
The JAK/STAT pathway plays important roles in the regulation of immune responses and inflammatory gene expression [19,20]. Inhibition of the JAK/STAT pathway is beneficial to suppress inflammatory cytokine expression [34,35], especially reducing the levels of p-STAT1 and p-STAT3 [36,37]. In many cell types, STAT1 and STAT3 play important roles in directing cells toward cytokine responsiveness and gene expression [19]. In this study, we found that 1,25(OH)2D3 decreased p-STAT1 and p-STAT3 levels in both the early and late stage of PEDV infection. This suggested that 1,25(OH)2D3 could inhibit the inflammatory cytokine expression induced by PEDV through suppressing the JAK/STAT pathway. In addition, JAK/STAT signaling can be regulated by SOCS proteins, which directly antagonize STAT activation [19]. Previous studies suggested that 1,25(OH)2D3 can increase SOCS expression and decrease inflammatory cytokine expression [38,39]. Our results show that 1,25(OH)2D3 could increase the SOCS3 protein level with or without PEDV infection. These results indicated that 1,25(OH)2D3 suppressed the JAK/STAT signaling pathway by increasing SOCS3 expression, thereby inhibiting the inflammatory cytokine expression induced by PEDV.
Typically, the activation of the JAK/STAT pathway induced by virus infection causes ISG production [17]. ISGs are important in the host defense against viral infection. Our results demonstrated that 1,25(OH)2D3 suppressed the JAK/STAT pathway and ISG expression induced by PEDV. This raises the concern that PEDV replication may be enhanced with 1,25(OH)2D3 supplementation. Fortunately, in this study, we did not find that PEDV replication was affected by 1,25(OH)2D3 at 24 h post-infection, which is consistent with our previous study [20]. In human airway epithelial cells, 1,25(OH)2D3 also decreases RSV-induced inflammatory cytokine expression without jeopardizing viral replication [14]. One possibility is that the ISGs produced in the presence of 1,25(OH)2D3 were sufficient to restrict PEDV replication. Since 1,25(OH)2D3 inhibited the JAK/STAT antiviral signaling pathway, we sought to investigate whether 1,25(OH)2D3 could influence the antiviral effects of IFN-α. Interestingly, 1,25(OH)2D3 increased p-STAT1 levels and decreased p-STAT3 levels in the presence of IFN-α. STAT1 plays important roles in the transcription of ISGs that provide an antiviral state [40,41]. A previous study has shown that 1,25(OH)2D3 enhances the antiviral effect of IFN-α on HCV; in addition, IFN-α-induced binding of p-STAT1 to its DNA target sequences is also enhanced by 1,25(OH)2D3. Although, in this experiment, 1,25(OH)2D3 did not reinforce the anti-PEDV effect of IFN-α, it is further confirmed to some extent that 1,25(OH)2D3 can enhance the antiviral effect of IFN-α due to the increase in p-STAT1.
It is recognized that the biological effects of 1,25(OH)2D3 are mediated by VDR [42]. In the presence of 1,25(OH)2D3, VDR heterodimerizes with retinoid X receptors (RXR). Once dimerized, the complex binds to the VDR element, in the promoter regions of 1,25(OH)2D3 target genes, to regulate their expression [43]. In addition, it is reported that 1,25(OH)2D3 can exert nongenomic actions via membrane receptor VDR to mediate cell proliferation and apoptosis [44]. There have been many reports about the relationship between VDR and inflammation. A previous study has shown that VDR-/- mice developed dramatic weight loss and a colitis phenotype in TNBS and DSS colitis models, while reconstitution of VDR-/- mice with the VDR transgene protected mice from developing colitis [45]. Furthermore, 1,25(OH)2D3 also inhibited the NF-κB and JAK/STAT pathways through VDR, thereby inhibiting inflammatory cytokine expression and alleviating the inflammatory response [18,33]. In this study, through RNA interference and VDR gene overexpression, we found that VDR was indispensable for 1,25(OH)2D3 to inhibit PEDV-induced inflammatory cytokine expression. However, the interaction between VDR and key proteins is not known; it is worthy of further study to elucidate the underlying molecular signaling mechanism.
Taken together, these results demonstrated that 1,25(OH)2D3 inhibited the proinflammatory cytokine expression induced by PEDV in IPEC-J2 cells, by inhibiting the NF-κB and JAK/STAT signaling pathways (Figure 10). These results indicated that vitamin D3 could contribute to inhibiting intestinal inflammation and alleviate intestinal damage in PEDV-infected piglets, offering new approaches for the development of nutritional strategies to prevent PEDV infection and reduce the risk of diarrhea in piglets. Furthermore, the results may also be helpful to guide the prevention and control of viral diarrhea in children, which is the second major cause of death by malnutrition in children under five years of age.

4. Materials and Methods

4.1. Cells and Virus

The porcine small intestinal epithelial cell line IPEC-J2 cells were kindly provided by Per Torp Sangild (University of Copenhagen, Copenhagen, Denmark). IPEC-J2 cells were maintained in Dulbecco’s Modified Eagle’s Medium and Ham’s F-12 Nutrient Mixture (DMEM/F12, Gibco, Shanghai, China) enriched with 10% fetal bovine serum (Gibco, Shanghai, China). Porcine alveolar macrophage cell line 3D4/21 cells were grown in DMEM medium supplemented with 10% fetal bovine serum. The 3D4/21 cells were kindly provided by Professor Wenkai Ren (South China Agricultural University, Guangzhou, China). PEDV was propagated in VERO cells (African green monkey kidney cells) cultured in DMEM medium. All the cells were maintained at 37 °C in a 5% CO2 incubator. PEDV (the viral 50% tissue culture infectious dose (TCID50) of the PEDV was 5.62 × 107 TCID50/mL) was provided by Professor Zhiwen Xu. (College of Veterinary, Sichuan Agricultural University, Chengdu, China).

4.2. RNA-Seq Data Analysis

After the confluent growth of IPEC-J2 cells in a 12-well plate, cells were infected with PEDV (5.62 × 107 TCID50/mL) at an MOI of 1. After 1 h of absorption, the cells were washed with PBS and cultured for 48 h (n = 4). Then, the cells were collected. Total RNA was extracted using Trizol reagent (Invitrogen, Shanghai, China). Library construction and Illumina sequencing were conducted by the Novogene Company (Beijing, China). The fragment counts of each gene were normalized to fragments per kb of transcript per million (FPKM). Differentially expressed genes (DEGs) were screened according to |log2 Fold Change| > 0 and p < 0.05 by DESeq2 software. Then, the DEGs were subjected to Gene Ontology (GO) enrichment analysis by clusterProfiler software.

4.3. Pharmacological Inhibitors

After the confluent growth of IPEC-J2 cells (80%) in a 12-well plate, IPEC-J2 cells were infected with PEDV (5.62 × 107 TCID50/mL) at an MOI of 1 for 1 h, and then the cells were washed with PBS and incubated with NF-κB inhibitor (BAY 11-7082, 10 μM), JAK inhibitor (AG490, 100 μM) and STAT inhibitor (WP 1066, 10 mM) for 24 h, respectively. Finally, the cells were harvested for quantitative real-time RT-PCR (RT-qPCR) tests (n = 4).

4.4. Plasmid Construction and Transfection

The complete CDS of VDR was synthesized by the total gene synthesis method (Shanghai Sangon Biotechnology Co., Ltd., Shanghai, China). Then, the sequence was cloned into the pcDNA3.1(+) vector, which was digested with the appropriate restriction enzyme to construct the expression vector pcDNA3.1-VDR (Shanghai Sangon Biotechnology Co., Ltd, Shanghai, China.). The pcDNA3.1-VDR was transfected into IPEC-J2 cells by Lipofectamine 3000 reagent (Invitrogen, Shanghai, China), according to the manufacturer’s instructions, and cultured for 24 h, after which the cells were infected with PEDV (5.62 × 107 TCID50/mL, 1 MOI) and cultured for a further 24 h. Finally, the cells were collected for RT-qPCR assay. The plasmid map is included in the Supplementary Materials.

4.5. Poly(I:C) Transfection

When IPEC-J2 cells reached 80% confluence, the cells were incubated with 1,25(OH)2D3 (Sigma, Shanghai, China, 20 nM) for 24 h. Then, the cells were transfected with poly(I:C) (Sigma, Shanghai, China, 10 μg) by Lipofectamine 3000 reagent (Invitrogen, Shanghai, China) for an additional 24 h. Finally, the cells were collected for RT-qPCR assay.

4.6. IFN-α Treatment

When IPEC-J2 cells reached 80% confluence, they were pretreated with 1,25(OH)2D3 (20 nM) for 24 h, followed by recombinant swine IFN-α (Kingfisher, London, UK, 1 μg/mL) treatment for a further 24 h. Then, the cells were collected for RT-qPCR and Western blot assay. Moreover, IPEC-J2 cells were infected with PEDV (5.62 × 107 TCID50/mL) at an MOI of 1 for 1 h, and then the cells were washed with PBS and cultured with IFN-α (1 μg/mL) and 1,25(OH)2D3 (20 nM) for 24 h. Finally, the cells were collected for RT-qPCR assay.

4.7. RNA Interference

The siRNA targeting porcine VDR and negative control siRNA were synthesized by Shanghai Sangon Biotechnology Co., Ltd, Shanghai, China. The sequences are listed in Table 2. IPEC-J2 cells were transfected with VDR-specific or control siRNA by Lipofectamine 3000 reagent (Invitrogen), according to the manufacturer’s instructions. After transfection for 24 h, 1,25(OH)2D3 (20 nM) was supplemented for another 24 h, and then cells were infected with PEDV (5.62 × 107 TCID50/mL, 1 MOI) and cultured for a further 24 h. Finally, the cells were harvested for RT-qPCR test.

4.8. Western Blot Analysis

After washing with PBS, the cells were acquired by RIPA lysis buffer with PMSF and phosphatase inhibitor. Then, the cell samples were homogenized and centrifuged at 4 °C. The supernatants were collected. Then, the samples were separated by SDS-PAGE and transferred to PVDF membranes. The membranes were blocked by 5% nonfat milk. After this, the membranes were incubated overnight with the corresponding antibodies: anti-PEDV (Medgene Labs, Brookings, SD, USA); anti-STAT1, anti-p-STAT1, anti-STAT3, anti-p-STAT3, anti-JAK1, anti-JAK2, anti-NF-κB, anti-p-NF-κB, anti-IκBα (Cell Signaling Technology, Shanghai, China); anti-VDR (Abcam, Shanghai, China); anti-SOCS3 and anti-β-actin (Santa Cruz, Shanghai, China). Following washing, the samples were incubated with secondary antibodies for 1 h at room temperature, and then proteins were incubated with ECL reagent (Beyotime Biotechnology, Shanghai, China) for chemiluminescence by the ChemiDocTM XRS Imager System (Bio-Rad, Hercules, CA, USA).

4.9. Quantitative Real-Time RT-PCR

Total RNA was extracted using Trizol reagent (Invitrogen, Shanghai, China). The quality and concentration of RNA samples were tested by agarose gel electrophoresis and a nucleic acid analyzer (Nanodrop 2000, Thermo Scientific, Waltham, MA, USA), respectively. Then, RNA was converted into cDNA with a PrimeScript RT reagent kit (TaKaRa, Dalian, China). RT-qPCR was performed using the ABI 7900HT detection system (Applied Biosystems, Foster, CA, USA), using the SYBR Premix Ex Taq II with ROX reagents (TaKaRa, Dalian, China). The primer sequences used for RT-qPCR are listed in Table 3. The RT-qPCR reaction program was as follows: 95 °C for 30 s, then 40 cycles at 95 °C for 5 s, 60 °C for 34 s and 72 °C for 60 s. The relative mRNA expression of interested genes was quantified by the comparative ΔΔCt method by using the porcine housekeeping gene (GAPDH).

4.10. Statistical Analyzation

The data were presented as means ± SEM. The results of PEDV treatment for different time were analyzed by one-way analysis of variance tests followed by Tukey multiple comparison, and the other results were analyzed by Student’s t-test (IBM, SPSS 17.0 software, Chicago, IL, USA). The significance was declared at p < 0.05.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms231810603/s1.

Author Contributions

Conceptualization, J.Y. (Jiwen Yang), D.C. and B.Y.; Formal analysis, J.Y. (Jiwen Yang); Funding acquisition, B.Y.; Investigation, J.Y. (Jiwen Yang), Y.L. and J.L.; Methodology, J.Y. (Jiwen Yang), J.H. and P.Z.; Project administration, B.Y.; Resources, B.Y.; Software, X.M. and J.Y. (Jie Yu); Supervision, B.Y.; Validation, J.Y. (Jiwen Yang), G.T. and A.W.; Visualization, Z.H. and H.Y.; Writing—original draft, J.Y. (Jiwen Yang); Writing—review and editing, B.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant number 31972579.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the Supplementary Materials.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Sun, R.Q.; Cai, R.J.; Chen, Y.Q.; Liang, P.S.; Chen, D.K.; Song, C.X. Outbreak of Porcine Epidemic Diarrhea in Suckling Piglets, China. Emerg. Infect. Dis. 2012, 18, 161–163. [Google Scholar] [CrossRef] [PubMed]
  2. Curry, S.M.; Schwartz, K.J.; Yoon, K.J.; Gabler, N.K.; Burrough, E.R. Effects of Porcine Epidemic Diarrhea Virus Infection on Nursery Pig Intestinal Function and Barrier Integrity. Vet. Microbiol. 2017, 211, 58–66. [Google Scholar] [CrossRef] [PubMed]
  3. Jung, K.; Eyerly, B.; Annamalai, T.; Lu, Z.; Saif, L.J. Structural Alteration of Tight and Adherens Junctions in Villous and Crypt Epithelium of the Small and Large Intestine of Conventional Nursing Piglets Infected with Porcine Epidemic Diarrhea Virus. Vet. Microbiol. 2015, 177, 373–378. [Google Scholar] [CrossRef] [PubMed]
  4. Madson, D.M.; Magstadt, D.R.; Arruda, P.H.; Hoang, H.; Sun, D.; Bower, L.P.; Bhandari, M.; Burrough, E.R.; Gauger, P.C.; Pillatzki, A.E.; et al. Pathogenesis of Porcine Epidemic Diarrhea Virus Isolate (Us/Iowa/18984/2013) in 3-Week-Old Weaned Pigs. Vet. Microbiol. 2014, 174, 60–68. [Google Scholar] [CrossRef] [PubMed]
  5. Wang, S.; Wu, J.; Wang, F.; Wang, H.; Wu, Z.; Wu, S.; Bao, W. Expression Pattern Analysis of Antiviral Genes and Inflammatory Cytokines in PEDV-Infected Porcine Intestinal Epithelial Cells. Front. Vet. Sci. 2020, 7, 75. [Google Scholar] [CrossRef] [PubMed]
  6. Jung, K.; Miyazaki, A.; Saif, L.J. Immunohistochemical Detection of the Vomiting-Inducing Monoamine Neurotransmitter Serotonin and Enterochromaffin Cells in the Intestines of Conventional or Gnotobiotic (Gn) Pigs Infected with Porcine Epidemic Diarrhea Virus (PEDV) and Serum Cytokine Responses of Gn Pigs to Acute PEDV Infection. Res. Vet. Sci. 2018, 119, 99–108. [Google Scholar] [CrossRef]
  7. Cao, L.; Ge, X.; Gao, Y.; Ren, Y.; Ren, X.; Li, G. Porcine Epidemic Diarrhea Virus Infection Induces NF-κB Activation through the TLR2, TLR3 and TLR9 Pathways in Porcine Intestinal Epithelial Cells. J. Gen. Virol. 2015, 96, 1757–1767. [Google Scholar] [CrossRef]
  8. Gao, R.; Zhang, Y.; Kang, Y.; Xu, W.; Jiang, L.; Guo, T.; Huan, C. Glycyrrhizin Inhibits PEDV Infection and Proinflammatory Cytokine Secretion via the HMGB1/TLR4-MAPK p38 Pathway. Int. J. Mol. Sci. 2020, 21, 2961. [Google Scholar] [CrossRef]
  9. Campbell, G.R.; Spector, S.A. Hormonally Active Vitamin D3 (1alpha,25-Dihydroxycholecalciferol) Triggers Autophagy in Human Macrophages That Inhibits HIV-1 Infection. J. Biol. Chem. 2011, 286, 18890–18902. [Google Scholar] [CrossRef]
  10. Gal-Tanamy, M.; Bachmetov, L.; Ravid, A.; Koren, R.; Erman, A.; Tur-Kaspa, R.; Zemel, R. Vitamin D: An Innate Antiviral Agent Suppressing Hepatitis C Virus in Human Hepatocytes. Hepatology 2011, 54, 1570–1579. [Google Scholar] [CrossRef]
  11. Martínez-Moreno, J.; Hernandez, J.C.; Urcuqui-Inchima, S. Effect of High Doses of Vitamin D Supplementation on Dengue Virus Replication, Toll-Like Receptor Expression, and Cytokine Profiles on Dendritic Cells. Mol. Cell. Biochem. 2020, 464, 169–180. [Google Scholar] [CrossRef]
  12. Anderson, J.; Do, L.A.H.; Toh, Z.Q.; Hoe, E.; Reitsma, A.; Mulholland, K.; Licciardi, P.V. Vitamin D Induces Differential Effects on Inflammatory Responses During Bacterial and/or Viral Stimulation of Human Peripheral Blood Mononuclear Cells. Front. Immunol. 2020, 11, 602. [Google Scholar] [CrossRef]
  13. Khare, D.; Godbole, N.M.; Pawar, S.D.; Mohan, V.; Pandey, G.; Gupta, S.; Kumar, D.; Dhole, T.N.; Godbole, M.M. Calcitriol [1,25[OH]2D3] Pre- and Post-treament Suppresses Inflammatory Response to Influenza A (H1N1) Infection in Human Lung A549 Epithelial Cells. Eur. J. Nutr. 2013, 52, 1405–1415. [Google Scholar] [CrossRef]
  14. Hansdottir, S.; Monick, M.M.; Lovan, N.; Powers, L.; Gerke, A.; Hunninghake, G.W. Vitamin D Decreases Respiratory Syncytial Virus Induction of NF-Kappab-Linked Chemokines and Cytokines in Airway Epithelium While Maintaining the Antiviral State. J. Immunol. 2010, 184, 965–974. [Google Scholar] [CrossRef]
  15. Yang, J.; Tian, G.; Chen, D.; Zheng, P.; Yu, J.; Mao, X. Dietary 25-Hydroxyvitamin D3 Supplementation Alleviates Porcine Epidemic Diarrhea Virus Infection by Improving Intestinal Structure and Immune Response in Weaned Pigs. Animals 2019, 9, 627. [Google Scholar] [CrossRef]
  16. Rajsbaum, R.; García-Sastre, A. Viral Evasion Mechanisms of Early Antiviral Responses Involving Regulation of Ubiquitin Pathways. Trends Microbiol. 2013, 21, 421–429. [Google Scholar] [CrossRef]
  17. Stark, G.R.; Darnell, J.E., Jr. The JAK-STAT Pathway at Twenty. Immunity 2012, 36, 503–514. [Google Scholar] [CrossRef]
  18. Stoppelenburg, A.J.; von Hegedus, J.H.; Huis in’t Veld, R.; Bont, L.; Boes, M. Defective Control of Vitamin D Receptor-Mediated Epithelial STAT1 Signalling Predisposes to Severe Respiratory Syncytial Virus Bronchiolitis. J. Pathol. 2014, 232, 57–64. [Google Scholar] [CrossRef]
  19. Murray, P.J. The JAK-STAT Signaling Pathway: Input and Output Integration. J. Immunol. 2007, 178, 2623–2629. [Google Scholar] [CrossRef]
  20. Shuai, K.; Liu, B. Regulation of JAK-STAT Signalling in the Immune System. Nat. Rev. Immunol. 2003, 3, 900–911. [Google Scholar] [CrossRef]
  21. Yang, J.; Tian, G.; Chen, D.; Mao, X.; He, J.; Zheng, P.; Yu, J.; Luo, Y.; Luo, J.; Huang, Z.; et al. 1,25-Dihydroxyvitamin D3 Inhibits Porcine Epidemic Diarrhea Virus Replication by Regulating Cell Cycle Resumption in IPEC-J2 Porcine Epithelial Cells. Microb. Pathog. 2021, 158, 105017. [Google Scholar] [CrossRef]
  22. Madson, D.M.; Arruda, P.H.E.; Magstadt, D.R.; Burrough, E.R.; Hoang, H.; Sun, D.; Bower, L.P.; Bhandari, M.; Gauger, P.C.; Stevenson, G.W.; et al. Characterization of Porcine Epidemic Diarrhea Virus Isolate US/Iowa/18984/2013 Infection in 1-Day-Old Cesarean-Derived Colostrum-Deprived Piglets. Vet. Pathol. 2016, 53, 44–52. [Google Scholar] [CrossRef]
  23. Hu, C.H.; Xiao, K.; Luan, Z.S.; Song, J. Early Weaning Increases Intestinal Permeability, Alters Expression of Cytokine and Tight Junction Proteins, and Activates Mitogen-Activated Protein Kinases in Pigs. J. Anim. Sci. 2013, 91, 1094–1101. [Google Scholar] [CrossRef]
  24. Liu, Y.; Chen, F.; Odle, J.; Lin, X.; Jacobi, S.K.; Zhu, H.; Wu, Z.; Hou, Y. Fish Oil Enhances Intestinal Integrity and Inhibits TLR4 and NOD2 Signaling Pathways in Weaned Pigs after LPS Challenge. J. Nutr. 2012, 142, 2017–2024. [Google Scholar] [CrossRef] [PubMed]
  25. Huang, K.-Y.; Hsu, Y.-H.; Chen, W.-Y.; Tsai, H.-L.; Yan, J.-J.; Wang, J.-D.; Liu, W.-L.; Lin, R.-M. The Roles of IL-19 and IL-20 in the Inflammation of Degenerative Lumbar Spondylolisthesis. J. Inflamm. 2018, 15, 19. [Google Scholar] [CrossRef] [PubMed]
  26. Liao, Y.C.; Liang, W.G.; Chen, F.W.; Hsu, J.H.; Yang, J.J.; Chang, M.S. IL-19 Induces Production of IL-6 and TNF-Alpha and Results in Cell Apoptosis through TNF-Alpha. J. Immunol. 2002, 169, 4288–4297. [Google Scholar] [CrossRef] [PubMed]
  27. Larsen, J.M. The Immune Response to Prevotella Bacteria in Chronic Inflammatory Disease. Immunology 2017, 151, 363–374. [Google Scholar] [CrossRef] [PubMed]
  28. Christakos, S.; Dhawan, P.; Verstuyf, A.; Verlinden, L.; Carmeliet, G. Vitamin D: Metabolism, Molecular Mechanism of Action, and Pleiotropic Effects. Physiol. Rev. 2016, 96, 365–408. [Google Scholar] [CrossRef]
  29. Schottelius, A.J.; Baldwin, A.S., Jr. A Role for Transcription Factor NF-Kappa B in Intestinal Inflammation. Int. J. Color. Dis. 1999, 14, 18–28. [Google Scholar] [CrossRef]
  30. Mercurio, F.; Zhu, H.; Murray, B.W.; Shevchenko, A.; Bennett, B.L.; Li, J.W.; Young, D.B.; Barbosa, M.; Mann, M.; Manning, A.; et al. Ikk-1 and Ikk-2: Cytokine-Activated Ikappab Kinases Essential for NF-Kappab Activation. Science 1997, 278, 860–866. [Google Scholar] [CrossRef]
  31. Blackwell, T.S.; Christman, J.W. The Role of Nuclear Factor-Kappa B in Cytokine Gene Regulation. Am. J. Respir. Cell Mol. Biol. 1997, 17, 3–9. [Google Scholar] [CrossRef]
  32. Riis, J.L.; Johansen, C.; Gesser, B.; Larsen, C.G.; Kragballe, K.; Iversen, L. 1alpha,25(OH)2D3 Regulates NF-Kappab DNA Binding Activity in Cultured Normal Human Keratinocytes through an Increase in Ikappabalpha Expression. Arch. Dermatol. Res. 2004, 296, 195–202. [Google Scholar] [CrossRef]
  33. Chen, Y.; Zhang, J.; Ge, X.; Du, J.; Deb, D.K.; Li, Y.C. Vitamin D Receptor Inhibits Nuclear Factor κB Activation by Interacting with IκB Kinase β Protein. J. Biol. Chem. 2013, 288, 19450–19458. [Google Scholar] [CrossRef]
  34. Choi, W.-H.; Ji, K.-A.; Jeon, S.-B.; Yang, M.-S.; Kim, H.; Min, K.-J.; Shong, M.; Jou, I.; Joe, E.-H. Anti-Inflammatory Roles of Retinoic Acid in Rat Brain Astrocytes: Suppression of Interferon-Gamma-Induced JAK/STAT Phosphorylation. Biochem. Biophys. Res. Commun. 2005, 329, 125–131. [Google Scholar] [CrossRef]
  35. Ivanenkov, Y.A.; Balakin, K.V.; Lavrovsky, Y. Small Molecule Inhibitors of NF-κB and JAK/STAT Signal Transduction Pathways as Promising Anti-Inflammatory Therapeutics. Mini Rev. Med. Chem. 2011, 11, 55–78. [Google Scholar] [CrossRef]
  36. Wang, X.; Liu, Q.; Ihsan, A.; Huang, L.; Dai, M.; Hao, H.; Cheng, G.; Liu, Z.; Wang, Y.; Yuan, Z. JAK/STAT Pathway Plays a Critical Role in the Proinflammatory Gene Expression and Apoptosis of Raw264.7 Cells Induced by Trichothecenes as Don and T-2 Toxin. Toxicol. Sci. 2012, 127, 412–424. [Google Scholar] [CrossRef]
  37. Zhang, S.; Huo, C.; Xiao, J.; Fan, T.; Zou, S.; Qi, P.; Sun, L.; Wang, M.; Hu, Y. P-STAT1 Regulates the Influenza a Virus Replication and Inflammatory Response in Vitro and Vivo. Virology 2019, 537, 110–120. [Google Scholar] [CrossRef]
  38. Boontanrart, M.; Hall, S.D.; Spanier, J.A.; Hayes, C.E.; Olson, J.K. Vitamin D3 Alters Microglia Immune Activation by an IL-10 Dependent SOCS3 Mechanism. J. Neuroimmunol. 2016, 292, 126–136. [Google Scholar] [CrossRef]
  39. Chen, Y.; Liu, W.; Sun, T.; Huang, Y.; Wang, Y.; Deb, D.K.; Yoon, D.; Kong, J.; Thadhani, R.; Li, Y.C. 1,25-Dihydroxyvitamin D Promotes Negative Feedback Regulation of TLR Signaling Via Targeting MicroRNA-155-SOCS1 in Macrophages. J. Immunol. 2013, 190, 3687–3695. [Google Scholar] [CrossRef]
  40. Hogan, R.J.; Gao, G.; Rowe, T.; Bell, P.; Flieder, D.; Paragas, J.; Kobinger, G.P.; Wivel, N.A.; Crystal, R.G.; Boyer, J.; et al. Resolution of Primary Severe Acute Respiratory Syndrome-Associated Coronavirus Infection Requires STAT1. J. Virol. 2004, 78, 11416–11421. [Google Scholar] [CrossRef] [Green Version]
  41. Germain, M.-A.; Chatel-Chaix, L.; Gagné, B.; Bonneil, É.; Thibault, P.; Pradezynski, F.; de Chassey, B.; Meyniel-Schicklin, L.; Lotteau, V.; Baril, M.; et al. Elucidating Novel Hepatitis C Virus-Host Interactions Using Combined Mass Spectrometry and Functional Genomics Approaches. Mol. Cell. Proteom. 2014, 13, 184–203. [Google Scholar] [CrossRef] [PubMed]
  42. Baker, A.R.; McDonnell, D.P.; Hughes, M.; Crisp, T.M.; Mangelsdorf, D.J.; Haussler, M.R.; Pike, J.W.; Shine, J.; O’Malley, B.W. Cloning and Expression of Full-Length Cdna Encoding Human Vitamin D Receptor. Proc. Natl. Acad. Sci. USA 1988, 85, 3294–3298. [Google Scholar] [CrossRef] [PubMed]
  43. John, H.W. Vitamin D Metabolism and Signaling in The Immune System. Rev. Endocr. Metab. Disord. 2012, 13, 21–29. [Google Scholar] [CrossRef]
  44. Mihnea, T.Z.; Heidi, M.; Cristina, B.; Andy, B.; Sebastian, L.J.; Luminita, A.S. Vitamin D modulation of innate immune responses to respiratory viral infections. Rev. Med. Virol. 2017, 27, e1909. [Google Scholar] [CrossRef]
  45. Liu, W.; Chen, Y.; Golan, M.A.; Annunziata, M.L.; Du, J.; Dougherty, U.; Kong, J.; Musch, M.; Huang, Y.; Pekow, J.; et al. Intestinal Epithelial Vitamin D Receptor Signaling Inhibits Experimental Colitis. J. Clin. Investig. 2013, 123, 3983–3996. [Google Scholar] [CrossRef] [Green Version]
Ijms 23 10603 g001 550
Figure 1. Effects of PEDV infection on inflammatory cytokine expression in IPEC-J2 cells. IPEC-J2 cells were infected with PEDV (1 MOI) for 1 h, and then the cells were washed with PBS and cultured with fresh culture medium for different times. After this, the cells were collected for RT-qPCR (A–C), n = 4 and Western blotting analysis (D). a,b,c,d Means not sharing the same superscript differ at p < 0.05.
Figure 1. Effects of PEDV infection on inflammatory cytokine expression in IPEC-J2 cells. IPEC-J2 cells were infected with PEDV (1 MOI) for 1 h, and then the cells were washed with PBS and cultured with fresh culture medium for different times. After this, the cells were collected for RT-qPCR (A–C), n = 4 and Western blotting analysis (D). a,b,c,d Means not sharing the same superscript differ at p < 0.05.
Ijms 23 10603 g001
Ijms 23 10603 g002 550
Figure 2. Effects of 1,25(OH)2D3 on the inflammatory cytokine expression in PEDV-infected IPEC-J2 cells at 1 h post-infection. The sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which the cells were infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with 1,25(OH)2D3 (20 nM) for 1 h. Then, the cells were collected for RT-qPCR (A–C) and Western blotting analysis (D). * p < 0.05.
Figure 2. Effects of 1,25(OH)2D3 on the inflammatory cytokine expression in PEDV-infected IPEC-J2 cells at 1 h post-infection. The sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which the cells were infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with 1,25(OH)2D3 (20 nM) for 1 h. Then, the cells were collected for RT-qPCR (A–C) and Western blotting analysis (D). * p < 0.05.
Ijms 23 10603 g002
Ijms 23 10603 g003 550
Figure 3. Effects of 1,25(OH)2D3 on inflammatory cytokine expression in PEDV-infected IPEC-J2 cells (A) and 3D4/21 cells (B) at 24 h post-infection. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which the cells were infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and cultured with 1,25(OH)2D3 (20 nM) for further 24 h. Then, the cells were collected for RT-qPCR and Western blotting analysis. * p < 0.05.
Figure 3. Effects of 1,25(OH)2D3 on inflammatory cytokine expression in PEDV-infected IPEC-J2 cells (A) and 3D4/21 cells (B) at 24 h post-infection. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which the cells were infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and cultured with 1,25(OH)2D3 (20 nM) for further 24 h. Then, the cells were collected for RT-qPCR and Western blotting analysis. * p < 0.05.
Ijms 23 10603 g003
Ijms 23 10603 g004 550
Figure 4. Effects of 1,25(OH)2D3 on IκBα expression in PEDV-infected IPEC-J2 cells. IPEC-J2 cells were infected with PEDV for 1 h, and then the cells were washed with PBS and incubated with BAY 11-7082 (10 μM) for 24 h. After this, the cells were collected for RT-qPCR analysis (A). Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and the cells were collected for RT-qPCR and Western blotting analysis or infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with or without 1,25(OH)2D3 (20 nM) for another 24 h. Finally, the cells were collected for RT-qPCR and Western blotting analysis (B). * p < 0.05.
Figure 4. Effects of 1,25(OH)2D3 on IκBα expression in PEDV-infected IPEC-J2 cells. IPEC-J2 cells were infected with PEDV for 1 h, and then the cells were washed with PBS and incubated with BAY 11-7082 (10 μM) for 24 h. After this, the cells were collected for RT-qPCR analysis (A). Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and the cells were collected for RT-qPCR and Western blotting analysis or infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with or without 1,25(OH)2D3 (20 nM) for another 24 h. Finally, the cells were collected for RT-qPCR and Western blotting analysis (B). * p < 0.05.
Ijms 23 10603 g004
Ijms 23 10603 g005 550
Figure 5. Effects of 1,25(OH)2D3 supplementation on JAK/STAT signaling pathway in PEDV-infected-IPEC-J2 and 3D4/21 cells. IPEC-J2 cells were infected with PEDV at MOI of 1. After 1 h of absorption, the cells were washed with PBS and then cultured with fresh culture medium for different times. Then, the cells were collected for Western blotting analysis (A). IPEC-J2 cells were pretreated with 1,25(OH)2D3 (20 nM) for 24 h, and then infected with PEDV at MOI of 1. After 1 h of absorption, the cells were washed with PBS and then cultured with 1,25(OH)2D3 (20 nM) for 1 h (B) or 24 h in IPEC-J2 (C) and 3D4/21 cells (D). Finally, the cells were collected for Western blotting analysis.
Figure 5. Effects of 1,25(OH)2D3 supplementation on JAK/STAT signaling pathway in PEDV-infected-IPEC-J2 and 3D4/21 cells. IPEC-J2 cells were infected with PEDV at MOI of 1. After 1 h of absorption, the cells were washed with PBS and then cultured with fresh culture medium for different times. Then, the cells were collected for Western blotting analysis (A). IPEC-J2 cells were pretreated with 1,25(OH)2D3 (20 nM) for 24 h, and then infected with PEDV at MOI of 1. After 1 h of absorption, the cells were washed with PBS and then cultured with 1,25(OH)2D3 (20 nM) for 1 h (B) or 24 h in IPEC-J2 (C) and 3D4/21 cells (D). Finally, the cells were collected for Western blotting analysis.
Ijms 23 10603 g005
Ijms 23 10603 g006 550
Figure 6. Effects of 1,25(OH)2D3 on SOCS3 expression in PEDV-infected IPEC-J2 cells. IPEC-J2 cells were infected with PEDV for 1 h, and then the cells were washed with PBS and incubated with JAK inhibitor (AG490, 100 μM) or STAT inhibitor (NSC 74859, 10 μM) for 24 h. After this, the cells were collected for RT-qPCR analysis (A). Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and the cells were collected for RT-qPCR and Western blotting analysis or infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with or without 1,25(OH)2D3 (20 nM) for another 24 h. Finally, the cells were collected for RT-qPCR and Western blotting analysis (B). * p < 0.05.
Figure 6. Effects of 1,25(OH)2D3 on SOCS3 expression in PEDV-infected IPEC-J2 cells. IPEC-J2 cells were infected with PEDV for 1 h, and then the cells were washed with PBS and incubated with JAK inhibitor (AG490, 100 μM) or STAT inhibitor (NSC 74859, 10 μM) for 24 h. After this, the cells were collected for RT-qPCR analysis (A). Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and the cells were collected for RT-qPCR and Western blotting analysis or infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with or without 1,25(OH)2D3 (20 nM) for another 24 h. Finally, the cells were collected for RT-qPCR and Western blotting analysis (B). * p < 0.05.
Ijms 23 10603 g006
Ijms 23 10603 g007 550
Figure 7. Effects of 1,25(OH)2D3 on PEDV replication. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which the cells were infected with PEDV. After 1 h of absorption, the cells were washed with PBS and then cultured with 1,25(OH)2D3 (20 nM) for another 24 h. Then, the cells were collected for RT-qPCR analysis (A) and PEDV-N mRNA and protein determination (B). IPEC-J2 cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and then the cells were transfected with poly(I:C) by Lipofectamine 3000 reagent (Invitrogen) for an additional 24 h. Finally, the cells were collected for RT-qPCR analysis (C). * p < 0.05.
Figure 7. Effects of 1,25(OH)2D3 on PEDV replication. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which the cells were infected with PEDV. After 1 h of absorption, the cells were washed with PBS and then cultured with 1,25(OH)2D3 (20 nM) for another 24 h. Then, the cells were collected for RT-qPCR analysis (A) and PEDV-N mRNA and protein determination (B). IPEC-J2 cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and then the cells were transfected with poly(I:C) by Lipofectamine 3000 reagent (Invitrogen) for an additional 24 h. Finally, the cells were collected for RT-qPCR analysis (C). * p < 0.05.
Ijms 23 10603 g007
Ijms 23 10603 g008 550
Figure 8. Effects of 1,25(OH)2D3 on anti-PEDV effects of IFN-α in IPEC-J2 cells. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which recombinant swine IFNα (1 μg/mL) was supplemented, and then the cells were cultured for further 24 h. Finally, the cells were collected for RT-qPCR analysis (A) and Western blotting analysis (B). Sub-confluent cells were incubated IFN-α (1 μg/mL) alone or with 1,25(OH)2D3 (20 nM) for 24 h, and then the cells were infected with PEDV and incubated for further 24 h. Finally, the cells were collected for RT-qPCR analysis (C). * p < 0.05.
Figure 8. Effects of 1,25(OH)2D3 on anti-PEDV effects of IFN-α in IPEC-J2 cells. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, after which recombinant swine IFNα (1 μg/mL) was supplemented, and then the cells were cultured for further 24 h. Finally, the cells were collected for RT-qPCR analysis (A) and Western blotting analysis (B). Sub-confluent cells were incubated IFN-α (1 μg/mL) alone or with 1,25(OH)2D3 (20 nM) for 24 h, and then the cells were infected with PEDV and incubated for further 24 h. Finally, the cells were collected for RT-qPCR analysis (C). * p < 0.05.
Ijms 23 10603 g008
Ijms 23 10603 g009 550
Figure 9. Effects of VDR on inflammatory cytokine expression in PEDV-infected IPEC-J2 cells. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and then the cells were collected for Western blotting analysis or continued to be infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with or without 1,25(OH)2D3 (20 nM) for further 24 h. Then, the cells were collected for Western blotting analysis (A). After the IPEC-J2 cells were transfected with VDR siRNA for 24 h, 1,25(OH)2D3 (20 nM) was supplemented for another 24 h, and then cells were infected with PEDV (1 MOI) and cultured for a further 24 h. Finally, the cells were harvested for RT-qPCR tests (B). The pcDNA3.1-VDR was transfected into IPEC-J2 cells by Lipofectamine 3000 reagent and cultured for 24 h, after which the cells were infected by PEDV and cultured for a further 24 h. Then, the cells were collected for RT-qPCR analysis (C). * p < 0.05.
Figure 9. Effects of VDR on inflammatory cytokine expression in PEDV-infected IPEC-J2 cells. Sub-confluent cells were incubated with 1,25(OH)2D3 (20 nM) for 24 h, and then the cells were collected for Western blotting analysis or continued to be infected with PEDV (1 MOI). After 1 h of absorption, the cells were washed with PBS and then cultured with or without 1,25(OH)2D3 (20 nM) for further 24 h. Then, the cells were collected for Western blotting analysis (A). After the IPEC-J2 cells were transfected with VDR siRNA for 24 h, 1,25(OH)2D3 (20 nM) was supplemented for another 24 h, and then cells were infected with PEDV (1 MOI) and cultured for a further 24 h. Finally, the cells were harvested for RT-qPCR tests (B). The pcDNA3.1-VDR was transfected into IPEC-J2 cells by Lipofectamine 3000 reagent and cultured for 24 h, after which the cells were infected by PEDV and cultured for a further 24 h. Then, the cells were collected for RT-qPCR analysis (C). * p < 0.05.
Ijms 23 10603 g009
Ijms 23 10603 g010 550
Figure 10. The potential mechanism of 1,25(OH)2D3 in inhibiting inflammatory cytokine expression induced by PEDV in IPEC-J2 cells. In this study, 1,25(OH)2D3 attenuated PEDV-induced inflammatory cytokine expression via suppressing the NF/κB and JAK/STAT signaling pathways.
Figure 10. The potential mechanism of 1,25(OH)2D3 in inhibiting inflammatory cytokine expression induced by PEDV in IPEC-J2 cells. In this study, 1,25(OH)2D3 attenuated PEDV-induced inflammatory cytokine expression via suppressing the NF/κB and JAK/STAT signaling pathways.
Ijms 23 10603 g010
Table
Table 1. Transcription analysis results of IL-19 and CCL20 (PEDV vs. CON).
Table 1. Transcription analysis results of IL-19 and CCL20 (PEDV vs. CON).
Gene IDlog2 Fold Changep-ValuePadjGene Name
ENSSSCG000000156536.723.93 × 10−105.23 × 10−9IL-19
ENSSSCG000000162541.218.75 × 10−391.22 × 10−36CCL20
Table
Table 2. Sequences of VDR siRNA and control siRNA.
Table 2. Sequences of VDR siRNA and control siRNA.
RNASense Strand Sequence (5′-3′)
VDR siRNASense: CCACCGGCUUCCAUUUCAATT
Antisense: UUGAAAUGGAAGCCGGUGGTT
Control siRNASense: UUCUCCGAACGUGUCACGUTT
Antisense: ACGUGACACGUUCGGAGAATT
Table
Table 3. Primer sequences of the target and reference genes.
Table 3. Primer sequences of the target and reference genes.
GenePrimer Sequences (5′-3′)Product Length (bp)GeneBank Accession No.
IL-19F: TCTCTGTCTCCTGGGTACGA143XM003130464.3
R: GCATGGTGTCCTTAGCTTGG
CCL20F: CTGCTCTACCTCTGCAGCAA107NM001024589.1
R: TGCTGTGTGAAGCCCATGAT
IL-8F: AGTTTTCCTGCTTTCTGCAGCT72NM_213867.1
R: TGGCATCGAAGTTCTGCACT
MxAF: GCATCACCAGGGTAGCTGTA 195NM_214061.2
R: AGATCCCGATGGTCCTGTCT
ICAM-1F: GAGCTGTTCAGGCAGTCAGT108NM_213816.1
R: CAGCTCAGTGCGACAAGAGA
IκBαF: TGTTGGTGTCTTTGGGTGCT128NM_001005150.1
R: GACATCAGCCCCACACTTCA
SOCS3F: GAAAACAGTCAACGGCCACC95NM_001123196.1
R: AAAGTGGGGCATCGTACTGG
ISG15F: TGCAAAGCTTCAGAGACCCA145NM_001128469.3
R: CAGAACTGGTCAGCTTGCAC
PEDV-NF: AGATCGCCAGTTTAGCACC66JX_406145.1
R: GCTCACGAACAGCCACATTA
GAPDHF: TCGCCATCAATGACCCCTTC174NM001206359.1
R: CACCCCATTTGATGTTGGCG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yang, J.; Chen, D.; Tian, G.; Mao, X.; He, J.; Zheng, P.; Yu, J.; Luo, Y.; Luo, J.; Huang, Z.; et al. 1,25-Dihydroxyvitamin D3 Negatively Regulates the Inflammatory Response to Porcine Epidemic Diarrhea Virus Infection by Inhibiting NF-κB and JAK/STAT Signaling Pathway in IPEC-J2 Porcine Epithelial Cells. Int. J. Mol. Sci. 2022, 23, 10603. https://doi.org/10.3390/ijms231810603

AMA Style

Yang J, Chen D, Tian G, Mao X, He J, Zheng P, Yu J, Luo Y, Luo J, Huang Z, et al. 1,25-Dihydroxyvitamin D3 Negatively Regulates the Inflammatory Response to Porcine Epidemic Diarrhea Virus Infection by Inhibiting NF-κB and JAK/STAT Signaling Pathway in IPEC-J2 Porcine Epithelial Cells. International Journal of Molecular Sciences. 2022; 23(18):10603. https://doi.org/10.3390/ijms231810603

Chicago/Turabian Style

Yang, Jiwen, Daiwen Chen, Gang Tian, Xiangbing Mao, Jun He, Ping Zheng, Jie Yu, Yuheng Luo, Junqiu Luo, Zhiqing Huang, and et al. 2022. "1,25-Dihydroxyvitamin D3 Negatively Regulates the Inflammatory Response to Porcine Epidemic Diarrhea Virus Infection by Inhibiting NF-κB and JAK/STAT Signaling Pathway in IPEC-J2 Porcine Epithelial Cells" International Journal of Molecular Sciences 23, no. 18: 10603. https://doi.org/10.3390/ijms231810603

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop