Saikosaponin A and D Inhibit Adipogenesis via the AMPK and MAPK Signaling Pathways in 3T3-L1 Adipocytes
Abstract
:1. Introduction
2. Results
2.1. Effect of SSA and SSD on Cell Viability
2.2. Effect of SSA and SSD on Lipid Accumulation
2.3. Effect of SSA and SSD on the Expressions of PPARγ and C/EBPα
2.4. Effects of SSA and SSD on the Expressions of Adipogenesis-Related Genes
2.5. Effects of SSA and SSD on the Expression Levels of Adiponectin in 3T3-L1 Cells
2.6. Effects of SSA and SSD on the AMPK Signaling Pathway
2.7. Effects of SSA and SSD on the MAPK Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cell Culture and Differentiation
4.3. Cell Viability
4.4. Oil Red O Staining and Quantification
4.5. Western Blot Analysis
4.6. Quantitative Real-Time PCR
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Carneiro, I.P.; Elliott, S.A.; Siervo, M.; Padwal, R.; Bertoli, S.; Battezzati, A.; Prado, C.M. Is Obesity Associated with Altered Energy Expenditure? Adv. Nutr. 2016, 7, 476–487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Unger, R.H.; Zhou, Y.T. Lipotoxicity of Beta-Cells in Obesity and in Other Causes of Fatty Acid Spillover. Diabetes 2001, 50, S118–S121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guh, D.P.; Zhang, W.; Bansback, N.; Amarsi, Z.; Birmingham, C.L.; Anis, A.H. The Incidence of Co-Morbidities Related to Obesity and Overweight: A Systematic Review and Meta-Analysis. BMC Public Health 2009, 9, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ambele, M.A.; Dhanraj, P.; Giles, R.; Pepper, M.S. Adipogenesis: A Complex Interplay of Multiple Molecular Determinants and Pathways. Int. J. Mol. Sci. 2020, 21, 4283. [Google Scholar] [CrossRef]
- Avena, N.M.; Gold, J.; Kroll, C.; Gold, M.S. Further Developments in the Neurobiology of Food and Addiction: Update on the State of the Science. Nutrition 2012, 28, 341–343. [Google Scholar] [CrossRef] [Green Version]
- Jakab, J.; Miškić, B.; Mikšić, Š.; Juranić, B.; Ćosić, V.; Schwarz, D.; Včev, A. Adipogenesis as a Potential Anti-Obesity Target: A Review of Pharmacological Treatment and Natural Products. Diabetes Metab. Syndr. Obes. Targets Ther. 2021, 14, 67–83. [Google Scholar] [CrossRef]
- Cowherd, R.M.; Lyle, R.E.; McGehee, R.E., Jr. Molecular Regulation of Adipocyte Differentiation. Semin. Cell Dev. Biol. 1999, 10, 3–10. [Google Scholar] [CrossRef]
- Payne, V.A.; Au, W.-S.; Lowe, C.E.; Rahman, S.M.; Friedman, J.E.; O’Rahilly, S.; Rochford, J.J. C/EBP Transcription Factors Regulate SREBP1c Gene Expression during Adipogenesis. Biochem. J. 2009, 425, 215–223. [Google Scholar] [CrossRef] [Green Version]
- White, U.A.; Stephens, J.M. Transcriptional Factors That Promote Formation of White Adipose Tissue. Mol. Cell. Endocrinol. 2010, 318, 10–14. [Google Scholar] [CrossRef] [Green Version]
- Yanovski, S.Z.; Yanovski, J.A. Long-Term Drug Treatment for Obesity: A Systematic and Clinical Review. JAMA 2014, 311, 74–86. [Google Scholar] [CrossRef]
- Guru, A.; Issac, P.K.; Velayutham, M.; Saraswathi, N.T.; Arshad, A.; Arockiaraj, J. Molecular Mechanism of Down-Regulating Adipogenic Transcription Factors in 3T3-L1 Adipocyte Cells by Bioactive Anti-Adipogenic Compounds. Mol. Biol. Rep. 2021, 48, 743–761. [Google Scholar] [CrossRef] [PubMed]
- Riguera, R. Isolating Bioactive Compounds from Marine Organisms. J. Mar. Biotechnol. 1997, 5, 187–193. [Google Scholar]
- Francis, G.; Kerem, Z.; Makkar, H.P.S.; Becker, K. The Biological Action of Saponins in Animal Systems: A Review. Br. J. Nutr. 2002, 88, 587–605. [Google Scholar] [CrossRef] [PubMed]
- Netala, V.R.; Ghosh, S.B.; Bobbu, P.; Anitha, D.; Tartte, V. Triterpenoid Saponins: A Review on Biosynthesis, Applications and Mechanism of Their Action. Int. J. Pharm. Sci. 2015, 7, 24–28. [Google Scholar]
- Marrelli, M.; Conforti, F.; Araniti, F.; Statti, G.A. Effects of Saponins on Lipid Metabolism: A Review of Potential Health Benefits in the Treatment of Obesity. Molecules 2016, 21, 1404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, B.; Yang, R.; Ma, Y.; Zhou, S.; Zhang, X.; Liu, Y. A Systematic Review of the Active Saikosaponins and Extracts Isolated from Radix Bupleuri and Their Applications. Pharm. Biol. 2017, 55, 620–635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, F.; Dong, X.; Yin, X.; Wang, W.; You, L.; Ni, J. Radix Bupleuri: A Review of Traditional Uses, Botany, Phytochemistry, Pharmacology, and Toxicology. BioMed Res. Int. 2017, 2017, 7597596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, S.-L. Bupleurum Species: Scientific Evaluation and Clinical Applications, 1st ed.; CRC Press: Boca Laton, FL, USA, 2006; ISBN 978-1-4200-0907-1. [Google Scholar]
- Kim, B.M. The Role of Saikosaponins in Therapeutic Strategies for Age-Related Diseases. Oxid. Med. Cell. Longev. 2018, 2018, 8275256. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.-L.; Geng, C.-A.; Huang, X.-Y.; Ma, Y.-B.; Zheng, X.-H.; Yang, T.-H.; Chen, X.-L.; Yin, X.-J.; Zhang, X.-M.; Chen, J.-J. Bioassay-Guided Isolation of Saikosaponins with Agonistic Activity on 5-Hydroxytryptamine 2C Receptor from Bupleurum Chinense and Their Potential Use for the Treatment of Obesity. Chin. J. Nat. Med. 2017, 15, 467–473. [Google Scholar] [CrossRef]
- Kim, S.O.; Park, J.Y.; Jeon, S.Y.; Yang, C.H.; Kim, M.R. Saikosaponin a, an Active Compound of Radix Bupleuri, Attenuates Inflammation in Hypertrophied 3T3-L1 Adipocytes via ERK/NF-ΚB Signaling Pathways. Int. J. Mol. Med. 2015, 35, 1126–1132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kopelman, P.G. Obesity as a Medical Problem. Nature 2000, 404, 635–643. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Liu, M. Adipose Tissue in Control of Metabolism. J. Endocrinol. 2016, 231, R77–R99. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ali, A.T.; Hochfeld, W.E.; Myburgh, R.; Pepper, M.S. Adipocyte and Adipogenesis. Eur. J. Cell Biol. 2013, 92, 229–236. [Google Scholar] [CrossRef] [PubMed]
- Haczeyni, F.; Bell-Anderson, K.S.; Farrell, G.C. Causes and Mechanisms of Adipocyte Enlargement and Adipose Expansion. Obes. Rev. 2018, 19, 406–420. [Google Scholar] [CrossRef] [PubMed]
- Sarjeant, K.; Stephens, J.M. Adipogenesis. Cold Spring Harb. Perspect. Biol. 2012, 4, a008417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mu, Q.; Fang, X.; Li, X.; Zhao, D.; Mo, F.; Jiang, G.; Yu, N.; Zhang, Y.; Guo, Y.; Fu, M.; et al. Ginsenoside Rb1 Promotes Browning through Regulation of PPARγ in 3T3-L1 Adipocytes. Biochem. Biophys. Res. Commun. 2015, 466, 530–535. [Google Scholar] [CrossRef] [PubMed]
- Gu, W.; Kim, K.-A.; Kim, D.-H. Ginsenoside Rh1 Ameliorates High Fat Diet-Induced Obesity in Mice by Inhibiting Adipocyte Differentiation. Biol. Pharm. Bull. 2013, 36, 102–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, Y.; Li, Y.; Zhao, T.; Wang, Y.; Sun, C. Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway. PLoS ONE 2013, 8, e70135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Che, Y.; Wang, Q.; Xiao, R.; Zhang, J.; Zhang, Y.; Gu, W.; Rao, G.; Wang, C.; Kuang, H. Kudinoside-D, a Triterpenoid Saponin Derived from Ilex Kudingcha Suppresses Adipogenesis through Modulation of the AMPK Pathway in 3T3-L1 Adipocytes. Fitoterapia 2018, 125, 208–216. [Google Scholar] [CrossRef] [PubMed]
- Tontonoz, P.; Hu, E.; Spiegelman, B.M. Stimulation of Adipogenesis in Fibroblasts by PPAR Gamma 2, a Lipid-Activated Transcription Factor. Cell 1994, 79, 1147–1156. [Google Scholar] [CrossRef]
- Tang, Q.Q.; Lane, M.D. Activation and Centromeric Localization of CCAAT/Enhancer-Binding Proteins during the Mitotic Clonal Expansion of Adipocyte Differentiation. Genes Dev. 1999, 13, 2231–2241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosen, E.D.; Walkey, C.J.; Puigserver, P.; Spiegelman, B.M. Transcriptional Regulation of Adipogenesis. Genes Dev. 2000, 14, 1293–1307. [Google Scholar] [CrossRef] [PubMed]
- Shan, T.; Liu, W.; Kuang, S. Fatty Acid Binding Protein 4 Expression Marks a Population of Adipocyte Progenitors in White and Brown Adipose Tissues. FASEB J. 2013, 27, 277–287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ronnett, G.V.; Kim, E.-K.; Landree, L.E.; Tu, Y. Fatty Acid Metabolism as a Target for Obesity Treatment. Physiol. Behav. 2005, 85, 25–35. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Indias, I.; Tinahones, F.J. Impaired Adipose Tissue Expandability and Lipogenic Capacities as Ones of the Main Causes of Metabolic Disorders. J. Diabetes Res. 2015, 2015, e970375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shimomura, I.; Shimano, H.; Horton, J.D.; Goldstein, J.L.; Brown, M.S. Differential Expression of Exons 1a and 1c in MRNAs for Sterol Regulatory Element Binding Protein-1 in Human and Mouse Organs and Cultured Cells. J. Clin. Investig. 1997, 99, 838–845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arita, Y.; Kihara, S.; Ouchi, N.; Takahashi, M.; Maeda, K.; Miyagawa, J.; Hotta, K.; Shimomura, I.; Nakamura, T.; Miyaoka, K.; et al. Paradoxical Decrease of an Adipose-Specific Protein, Adiponectin, in Obesity. Biochem. Biophys. Res. Commun. 1999, 257, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Lindsay, R.S.; Funahashi, T.; Hanson, R.L.; Matsuzawa, Y.; Tanaka, S.; Tataranni, P.A.; Knowler, W.C.; Krakoff, J. Adiponectin and Development of Type 2 Diabetes in the Pima Indian Population. Lancet 2002, 360, 57–58. [Google Scholar] [CrossRef]
- Yokota, T.; Meka, C.S.R.; Medina, K.L.; Igarashi, H.; Comp, P.C.; Takahashi, M.; Nishida, M.; Oritani, K.; Miyagawa, J.; Funahashi, T.; et al. Paracrine Regulation of Fat Cell Formation in Bone Marrow Cultures via Adiponectin and Prostaglandins. J. Clin. Investig. 2002, 109, 1303–1310. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Luo, N.; Klein, R.L.; Garvey, W.T. Adiponectin Promotes Adipocyte Differentiation, Insulin Sensitivity, and Lipid Accumulation. J. Lipid Res. 2005, 46, 1369–1379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, S.; Reuss, L.; Wang, Y. Potential of Natural Products in the Inhibition of Adipogenesis through Regulation of PPARγ Expression and/or Its Transcriptional Activity. Molecules 2016, 21, 1278. [Google Scholar] [CrossRef]
- Tong, L. Acetyl-Coenzyme A Carboxylase: Crucial Metabolic Enzyme and Attractive Target for Drug Discovery. Cell. Mol. Life Sci. CMLS 2005, 62, 1784–1803. [Google Scholar] [CrossRef] [PubMed]
- Bost, F.; Aouadi, M.; Caron, L.; Binétruy, B. The Role of MAPKs in Adipocyte Differentiation and Obesity. Biochimie 2005, 87, 51–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, Q.-Q.; Otto, T.C.; Lane, M.D. Mitotic Clonal Expansion: A Synchronous Process Required for Adipogenesis. Proc. Natl. Acad. Sci. USA 2003, 100, 44–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qi, R.; Liu, H.; Wang, Q.; Wang, J.; Yang, F.; Long, D.; Huang, J. Expressions and Regulatory Effects of P38/ERK/JNK Mapks in the Adipogenic Trans-Differentiation of C2C12 Myoblasts. Cell. Physiol. Biochem. 2017, 44, 2467–2475. [Google Scholar] [CrossRef] [Green Version]
Name | Sequence of Primers (5′→3′) | Annealing Temp (°C) |
---|---|---|
Pparg | F: CAAGAATACCAAAGTGCGATCAA R: GAGCTGGGTCTTTTCAGAATAATAAG | 58.4 |
Cebpa | F: AGGTGCTGGAGTTGACCAGT R: CAGCCTAGAGATCCAGCGAC | 60.5 |
Srebf1 | F: GCTTAGCCTCTACACCAACTGGC R: ACAGACTGGTACGGGCCACAAG | 65.9 |
Adipoq | F: AGCCTGGAGAAGCCGCTTAT R: TTGCAGTAGAACTTGCCAGTGC | 60.5 |
Fabp4 | F: AAGACAGCTCCTCCTCGAAGGTT R: TGACCAAATCCCCATTTACGC | 64.7 |
Fasn | F: TTGCTGGCACTACAGAATGC R: AACAGCCTCAGAGCGACAAT | 58.4 |
Lpl | F: AGG ACC CCT GAA GAC ACA GCT R: TGT ACA GGG CGG CCA CAA GT | 63.3 |
Gapdh | F: TTGTTGCCATCAACGACCCC R: GCCGTTGAATTTGCCGTGAG | 60.5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, S.H.; Lee, H.S.; Han, H.-K.; Choi, C.-I. Saikosaponin A and D Inhibit Adipogenesis via the AMPK and MAPK Signaling Pathways in 3T3-L1 Adipocytes. Int. J. Mol. Sci. 2021, 22, 11409. https://doi.org/10.3390/ijms222111409
Lim SH, Lee HS, Han H-K, Choi C-I. Saikosaponin A and D Inhibit Adipogenesis via the AMPK and MAPK Signaling Pathways in 3T3-L1 Adipocytes. International Journal of Molecular Sciences. 2021; 22(21):11409. https://doi.org/10.3390/ijms222111409
Chicago/Turabian StyleLim, Sung Ho, Ho Seon Lee, Hyo-Kyung Han, and Chang-Ik Choi. 2021. "Saikosaponin A and D Inhibit Adipogenesis via the AMPK and MAPK Signaling Pathways in 3T3-L1 Adipocytes" International Journal of Molecular Sciences 22, no. 21: 11409. https://doi.org/10.3390/ijms222111409