Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Compliance
2.2. Case and Control
2.3. DNA Extraction and Quantification
2.4. Genotyping
2.5. Analysis of the Hardy–Weinberg Equilibrium (HWE)
2.6. Genetic Ancestry Analysis
2.7. Statistic Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Duma, N.; Santana-Davila, R.; Molina, J.R. Non-Small Cell Lung Cancer: Epidemiology, Screening, Diagnosis, and Treatment. Mayo Clin. Proc. 2019, 94, 1623–1640. [Google Scholar] [CrossRef]
- Saltos, A.; Shafique, M.; Chiappori, A. Update on the Biology, Management, and Treatment of Small Cell Lung Cancer (SCLC). Front. Oncol. 2020, 10, 1074. [Google Scholar] [CrossRef] [PubMed]
- Araujo, L.H.; Baldotto, C.; Castro, G.; Katz, A.; Ferreira, C.G.; Mathias, C.; Mascarenhas, E.; Lopes, G.D.L.; Carvalho, H.; Tabacof, J.; et al. Lung cancer in Brazil. J. Bras. Pneumol. 2018, 44, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Gil Ferreira, C.; Abadi, M.D.; de Mendonça Batista, P.; Serra, F.B.; Peixoto, R.B.; Okumura, L.M.; Cerqueira, E.R. Demographic and Clinical Outcomes of Brazilian Patients with Stage III or IV Non–Small-Cell Lung Cancer: Real-World Evidence Study on the Basis of Deterministic Linkage Approach. JCO Glob. Oncol. 2021, 7, 1454–1461. [Google Scholar] [CrossRef] [PubMed]
- Tsao, A.S.; Scagliotti, G.V.; Bunn, P.A.; Carbone, D.P.; Warren, G.W.; Bai, C.; de Koning, H.J.; Yousaf-Khan, A.U.; McWilliams, A.; Tsao, M.S.; et al. Scientific Advances in Lung Cancer 2015. J. Thorac. Oncol. 2016, 11, 613–638. [Google Scholar] [CrossRef] [PubMed]
- Cavalcante, G.C.; Amador, M.A.; Ribeiro-Dos-Santos, A.M.; Carvalho, D.C.; Andrade, R.B.; Pereira, E.E.; Fernandes, M.R.; Costa, D.F.; Santos, N.P.C.; Assumpção, P.P.; et al. Analysis of 12 variants in the development of gastric and colorectal cancers. World J. Gastroenterol. 2017, 23, 8533–8543. [Google Scholar] [CrossRef]
- Eaton, K.D.; Romine, P.E.; Goodman, G.E.; Thornquist, M.D.; Barnett, M.J.; Petersdorf, E.W. Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility. J. Thorac. Oncol. 2018, 13, 649–659. [Google Scholar] [CrossRef]
- Sagne, C.; Marcel, V.; Amadou, A.; Hainaut, P.; Olivier, M.; Hall, J. A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): Geographic and tumor-specific effects. Cell Death Dis. 2013, 4, e492. [Google Scholar] [CrossRef]
- Xia, H.; Chen, Y.; Meng, J.; Liang, C. Effect of polymorphism on IL1A to cancer susceptibility: Evidence based on 34,016 subjects. Artif. Cells Nanomed. Biotechnol. 2019, 47, 3138–3152. [Google Scholar] [CrossRef] [Green Version]
- Kulmann-Leal, B.; Ellwanger, J.H.; Chies, J.A.B. CCR5Δ32 in Brazil: Impacts of a European Genetic Variant on a Highly Admixed Population. Front. Immunol. 2021, 12, 758358. [Google Scholar] [CrossRef] [PubMed]
- Karami, S.; Sarabandi, S.; Pourzand, P.; Tabasi, F.; Hashemi, M.; Bahari, G. Lack of association between 4-base pair insertion/deletion (rs3783553) polymorphism within the 3′UTR of IL1A and breast cancer: A preliminary report. Gene Rep. 2021, 23, 101067. [Google Scholar] [CrossRef]
- Tajbakhsh, A.; Farjami, Z.; Nesaei-Bajestani, A.; Afzaljavan, F.; Rivandi, M.; Moezzi, A.; Abedini, S.; Asghari, M.; Kooshyar, M.M.; Shandiz, F.H.; et al. Evaluating the Association between CCR5delta32 Polymorphism (rs333) and the Risk of Breast Cancer in a Cohort of Iranian Population. Iran. J. Public Health 2021, 50, 583–591. [Google Scholar] [CrossRef]
- Aguilar, E.; Esteves, P.; Sancerni, T.; Lenoir, V.; Aparicio, T.; Bouillaud, F.; Dentin, R.; Prip-Buus, C.; Ricquier, D.; Pecqueur, C.; et al. UCP2 Deficiency Increases Colon Tumorigenesis by Promoting Lipid Synthesis and Depleting NADPH for Antioxidant Defenses. Cell Rep. 2019, 28, 2306–2316. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Yin, X.-X.; Qin, J.; Wang, W.; He, X.-F. Association Between the TP53 Polymorphisms and Breast Cancer Risk: An Updated Meta-Analysis. Front. Genet. 2022, 13, 807466. [Google Scholar] [CrossRef]
- Hashemi, M.; Bahari, G.; Sarhadi, S.; Eskandari, E.; Narouie, B.; Taheri, M.; Ghavami, S. 4-bp insertion/deletion (rs3783553) polymorphism within the 3′UTR of IL1A contributes to the risk of prostate cancer in a sample of Iranian population. J. Cell. Biochem. 2018, 119, 2627–2635. [Google Scholar] [CrossRef]
- Li, L.; Zhang, Z.-T. Genetic Association between NFKBIA and NFKB1 Gene Polymorphisms and the Susceptibility to Head and Neck Cancer: A Meta-Analysis. Dis. Markers 2019, 2019, 6523837. [Google Scholar] [CrossRef] [PubMed]
- Yazdani, Z.; Mousavi, Z.; Ghasemimehr, N.; Khandany, B.K.; Nikbakht, R.; Jafari, E.; Fatemi, A.; Hassanshahi, G. Differential regulatory effects of chemotherapeutic protocol on CCL3_CCL4_CCL5/CCR5 axes in acute myeloid leukemia patients with monocytic lineage. Life Sci. 2020, 240, 117071. [Google Scholar] [CrossRef] [PubMed]
- Pinto, P.; Salgado, C.; Santos, N.P.C.; Santos, S.; Ribeiro-Dos-Santos, Â. Influence of Genetic Ancestry on INDEL Markers of NFKβ1, CASP8, PAR1, IL4 and CYP19A1 Genes in Leprosy Patients. PLoS Negl. Trop. Dis. 2015, 9, e0004050. [Google Scholar] [CrossRef]
- Ramos, B.R.D.A.; D’Elia, M.P.B.; Amador, M.A.T.; Santos, N.P.C.; Santos, S.E.B.; da Cruz Castelli, E.; Witkin, S.S.; Miot, H.A.; Miot, L.D.B.; da Silva, M.G. Neither self-reported ethnicity nor declared family origin are reliable indicators of genomic ancestry. Genetica 2016, 144, 259–265. [Google Scholar] [CrossRef] [Green Version]
- Carvalho, D.C.; Wanderley, A.V.; Amador, M.A.T.; Fernandes, M.R.; Cavalcante, G.C.; Pantoja, K.B.C.C.; Mello, F.A.R.; de Assumpção, P.P.; Khayat, A.S.; Ribeiro-Dos-Santos, Â.; et al. Amerindian genetic ancestry and INDEL polymorphisms associated with susceptibility of childhood B-cell Leukemia in an admixed population from the Brazilian Amazon. Leuk. Res. 2015, 39, 1239–1245. [Google Scholar] [CrossRef]
- Thandra, K.C.; Barsouk, A.; Saginala, K.; Aluru, J.S.; Barsouk, A. Epidemiology of lung cancer. Contemp. Oncol. (Pozn) 2021, 25, 45–52. [Google Scholar] [CrossRef]
- Rodak, O.; Peris-Díaz, M.D.; Olbromski, M.; Podhorska-Okołów, M.; Dzięgiel, P. Current Landscape of Non-Small Cell Lung Cancer: Epidemiology, Histological Classification, Targeted Therapies, and Immunotherapy. Cancers 2021, 13, 4705. [Google Scholar] [CrossRef] [PubMed]
- Brasil. Ministério da Saúde. Instituto Nacional de Câncer José Alencar Gomes da Silva. Estimativa 2020: Incidência de Câncer no Brasil. Rio de Janeiro: INCA; 2019. Available online: https://www.inca.gov.br/sites/ufu.sti.inca.local/files//media/document//estimativa-2020-incidencia-de-cancer-no-brasil.pdf (accessed on 15 November 2021).
- De Sá, V.K.; Coelho, J.C.; Capelozzi, V.L.; Azevedo, S.J. Lung cancer in Brazil: Epidemiology and treatment challenges. Lung Cancer Targets Ther. 2016, 7, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Nicolau, J.S.; Lopez, R.V.M.; de Moraes Luizaga, C.T.; Ribeiro, K.B.; Roela, R.A.; Maistro, S.; Katayama, M.L.H.; Natalino, R.J.M.; de Castro, G.; Neto, J.E.; et al. Survival analysis of young adults from a Brazilian cohort of non-small cell lung cancer patients. ecancermedicalscience 2021, 15, 1279. [Google Scholar] [CrossRef] [PubMed]
- Delva, F.; Margery, J.; Laurent, F.; Petitprez, K.; Pairon, J.-C.; RecoCancerProf Working Group. Medical follow-up of workers exposed to lung carcinogens: French evidence-based and pragmatic recommendations. BMC Public Health 2017, 17, 191. [Google Scholar] [CrossRef]
- Stapelfeld, C.; Dammann, C.; Maser, E. Sex-specificity in lung cancer risk. Int. J. Cancer 2020, 146, 2376–2382. [Google Scholar] [CrossRef]
- Ragavan, M.; Patel, M.I. The evolving landscape of sex-based differences in lung cancer: A distinct disease in women. Eur. Respir. Rev. 2022, 31, 210100. [Google Scholar] [CrossRef]
- Barta, J.A.; Powell, C.A.; Wisnivesky, J.P. Global Epidemiology of Lung Cancer. Ann. Glob. Health 2019, 85, 8. [Google Scholar] [CrossRef]
- Meiners, S.; Eickelberg, O.; Königshoff, M. Hallmarks of the ageing lung. Eur. Respir. J. 2015, 45, 807–827. [Google Scholar] [CrossRef] [Green Version]
- Schneider, J.L.; Rowe, J.H.; Garcia-De-Alba, C.; Kim, C.F.; Sharpe, A.H.; Haigis, M.C. The aging lung: Physiology, disease, and immunity. Cell 2021, 184, 1990–2019. [Google Scholar] [CrossRef] [PubMed]
- Concetti, J.; Wilson, C.L. NFKB1 and Cancer: Friend or Foe? Cells 2018, 7, 133. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.-Y.; Liu, F.; Zhang, T.; Tian, T.; Luo, F.; Li, X.-M.; Yang, Y.-N. Association of NFKB1 gene rs28362491 mutation with the occurrence of major adverse cardiovascular events. BMC Cardiovasc. Disord. 2022, 22, 313. [Google Scholar] [CrossRef] [PubMed]
- Dimitrakopoulos, F.-I.D.; Kottorou, A.E.; Kalofonou, M.; Kalofonos, H.P. The Fire Within: NF-κB Involvement in Non–Small Cell Lung Cancer. Cancer Res 2020, 80, 4025–4036. [Google Scholar] [CrossRef] [PubMed]
- Oltulu, Y.M.; Coskunpinar, E.; Ozkan, G.; Aynaci, E.; Yildiz, P.; Isbir, T.; Yaylim, I. Investigation of NF-κB1 and NF-κBIA Gene Polymorphism in Non-Small Cell Lung Cancer. BioMed Res. Int. 2014, 2014, 530381. [Google Scholar] [CrossRef]
- Yin, J.; Yin, M.; Vogel, U.; Wu, Y.; Yao, T.; Cheng, Y.; Sun, Z.; Hou, W.; Wang, C. NFKB1 common variants and PPP1R13L and CD3EAP in relation to lung cancer risk in a Chinese population. Gene 2015, 567, 31–35. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, L.; Pan, L.; Xue, J.; Yu, H. The association between NFKB1-94ins/del ATTG polymorphism and non-small cell lung cancer risk in a Chinese Han population. Int. J. Clin. Exp. Med. 2015, 8, 8153–8157. [Google Scholar]
- Amador, M.A.T.; Cavalcante, G.C.; Santos, N.P.C.; Gusmão, L.; Guerreiro, J.F.; Ribeiro-Dos-Santos, Â.; Santos, S. Distribution of allelic and genotypic frequencies of IL1A, IL4, NFKB1 and PAR1 variants in Native American, African, European and Brazilian populations. BMC Res. Notes 2016, 9, 101. [Google Scholar] [CrossRef]
- Castaño-Rodríguez, N.; Kaakoush, N.O.; Goh, K.L.; Fock, K.M.; Chionh, Y.T.; Sutton, P.; Mitchell, H.M. PAR-1 polymorphisms and risk of Helicobacter pylori-related gastric cancer in a Chinese population. Anticancer Res. 2012, 32, 3715–3721. [Google Scholar]
- Darmoul, D.; Gratio, V.; Devaud, H.; Lehy, T.; Laburthe, M. Aberrant Expression and Activation of the Thrombin Receptor Protease-Activated Receptor-1 Induces Cell Proliferation and Motility in Human Colon Cancer Cells. Am. J. Pathol. 2003, 162, 1503–1513. [Google Scholar] [CrossRef]
- Lurje, G.; Husain, H.; Power, D.; Yang, D.; Groshen, S.; Pohl, A.; Zhang, W.; Ning, Y.; Manegold, P.; El-Khoueiry, A.; et al. Genetic variations in angiogenesis pathway genes associated with clinical outcome in localized gastric adenocarcinoma. Ann. Oncol. 2010, 21, 78–86. [Google Scholar] [CrossRef]
- Eroğlu, A.; Karabıyık, A.; Akar, N. The Association of Protease Activated Receptor 1 gene −506 I/D Polymorphism with Disease-Free Survival in Breast Cancer Patients. Ann. Surg. Oncol. 2012, 19, 1365–1369. [Google Scholar] [CrossRef] [PubMed]
- Ajaz, S.; Muneer, R.; Siddiqa, A.; Memon, M.A. Frequencies of TP53 Germline Variations and Identification of Two Novel 3′UTR Variants in a Series of Head and Neck Cancer Cases. medRxiv 2021. [Google Scholar] [CrossRef]
- Denisov, E.V.; Cherdyntseva, N.V.; Litviakov, N.V.; Malinovskaya, E.A.; Babyshkina, N.N.; Belyavskaya, V.A.; Voevoda, M.I. TP53 Gene Polymorphisms in Cancer Risk: The Modulating Effect of Ageing, Ethnicity and TP53 Somatic Abnormalities. In Tumor Suppressor Genes; IntechOpen: London, UK, 2012. [Google Scholar] [CrossRef]
- Ma, L.; Zhou, N. Association between an insertion/deletion polymorphism in IL-1A gene and cancer risk: A meta-analysis. OncoTargets Ther. 2016, 9, 1–6. [Google Scholar] [CrossRef]
- Ma, Q.; Mao, Z.; Du, J.; Liao, S.; Zheng, Y.; Zhi, M.; Zhang, J.; Wang, Y. Association between an insertion/deletion polymorphism in the interleukin-1α gene and the risk of colorectal cancer in a Chinese population. Int. J. Biol. Markers 2018, 33, 401–406. [Google Scholar] [CrossRef]
- Kaabi, Y.A.; Mansor, A.S.; Alfagih, A.S.; Hakami, A.M.; Summ, M.A.; Mjery, Y.A.; Alzughbi, M.N.; Habibullah, M.M. Frequency of UCP2 45-bp Ins/Del polymorphism in Saudi population from Jazan area and its association with autoimmune hypothyroidism UCP2 45-bp Ins/Del frequency in hypothyroidism. Int. J. Health Sci. (Qassim) 2020, 14, 11–16. [Google Scholar] [PubMed]
- Rezapour, S.; Khosroshahi, S.A.; Farajnia, H.; Mohseni, F.; Khoshbaten, M.; Farajnia, S. Association of 45-bp ins/del polymorphism of uncoupling protein 2 (UCP2) and susceptibility to nonalcoholic fatty liver and type 2 diabetes mellitus in North-west of Iran. BMC Res. Notes 2021, 14, 169. [Google Scholar] [CrossRef] [PubMed]
- Say, Y.-H. The association of insertions/deletions (INDELs) and variable number tandem repeats (VNTRs) with obesity and its related traits and complications. J. Physiol. Anthr. 2017, 36, 25. [Google Scholar] [CrossRef]
- Yu, J.; Shi, L.; Lin, W.; Lu, B.; Zhao, Y. UCP2 promotes proliferation and chemoresistance through regulating the NF-κB/β-catenin axis and mitochondrial ROS in gallbladder cancer. Biochem. Pharmacol. 2020, 172, 113745. [Google Scholar] [CrossRef] [PubMed]
- Esterbauer, H.; Schneitler, C.; Oberkofler, H.; Ebenbichler, C.; Paulweber, B.; Sandhofer, F.; Ladurner, G.; Hell, E.; Strosberg, A.D.; Patsch, J.R.; et al. A common polymorphism in the promoter of UCP2 is associated with decreased risk of obesity in middle-aged humans. Nat. Genet. 2001, 28, 178–183. [Google Scholar] [CrossRef]
- Lee, J.H.; Cho, Y.S.; Jung, K.-H.; Park, J.W.; Lee, K.-H. Genipin enhances the antitumor effect of elesclomol in A549 lung cancer cells by blocking uncoupling protein-2 and stimulating reactive oxygen species production. Oncol. Lett. 2020, 20, 374. [Google Scholar] [CrossRef] [PubMed]
- Su, W.-P.; Lo, Y.-C.; Yan, J.-J.; Liao, I.-C.; Tsai, P.-J.; Wang, H.-C.; Yeh, H.-H.; Lin, C.-C.; Chen, H.H.; Lai, W.-W.; et al. Mitochondrial uncoupling protein 2 regulates the effects of paclitaxel on Stat3 activation and cellular survival in lung cancer cells. Carcinogenesis 2012, 33, 2065–2075. [Google Scholar] [CrossRef] [PubMed]
Gene | ID | Type | Length | Primers | Amplicon |
---|---|---|---|---|---|
IL-1A | rs3783553 | INDEL | 4 bp | F-5′TGGTCCAAGTTGTGCTTATCC3′ | 230–234 bp |
R-5′ACAGTGGTCTCATGGTTGTCA3′ | |||||
NFKB1 | rs28362491 | INDEL | 4 bp | F-5′TATGGACCGCATGACTCTATCA3′ | 366–370 bp |
R-5′GGCTCTGGCATCCTAGCAG3′ | |||||
PAR1 | rs11267092 | INDEL | 13 bp | F-5′AAAACTGAACTTTGCCGGTGT3′ | 265–277 bp |
R-5′GGGCCTAGAAGTCCAAATGAG3′ | |||||
TP53 | rs17878362 | INDEL | 16 bp | F-5′GGGACTGACTTTCTGCTCTTGT3′ | 148–164 bp |
R-5′GGGACTGTAGATGGGTGAAAAG3′ | |||||
UCP2 | INDEL 45-bp | INDEL | 45 bp | F-5′CCCACACTGTCAAATGTCAACT3′ | 119–164 bp |
R-5′CCATGCTTTCCTTTTCTTCCT3′ |
Gene | ID | Genotype | Frequency | Hardy-Weinberg Equilibrium (p-Value) |
---|---|---|---|---|
IL-1A | rs3783553 | Del/Del | 37 (14.1%) | 0.095 |
Ins/Del | 140 (53.2%) | |||
Ins/Ins | 86 (32.7%) | |||
NFKB1 | rs28362491 | Del/Del | 59 (22.4%) | 0.919 |
Ins/Del | 132 (50.2%) | |||
Ins/Ins | 72 (27.4%) | |||
PAR1 | rs11267092 | Del/Del | 131 (49.8%) | 0.644 |
Ins/Del | 107 (40.7%) | |||
Ins/Ins | 25 (9.5%) | |||
TP53 | rs17878362 | Del/Del | 163 (62.0%) | 0.575 |
Ins/Del | 90 (34.2%) | |||
Ins/Ins | 10 (3.8%) | |||
UCP2 | INDEL 45-bp | Del/Del | 127 (48.3%) | 0.922 |
Ins/Del | 112 (42.6%) | |||
Ins/Ins | 24 (9.1%) |
Characteristics | Case (n = 67) | Control (n = 196) | p-Value |
---|---|---|---|
Gender | |||
Male | 47 (70.1%) | 62 (31.6%) | <0.001 a* |
Female | 20 (29.9%) | 134 (68.4%) | |
Ages (years) | |||
Mean (±sd) | 60.4 (±12.3) | 70.5 (±8.2) | <0.001 b* |
Smoking | |||
Never smoked | 13 (19.4%) | 93 (47.4%) | <0.001 a* |
Smoker | 54 (80.6%) | 97 (49.5%) | |
Ancestry | |||
European | 47.1 (±16.9) | 45.2 (±17.0) | 0.521 b |
Amerindian | 30.3 (±13.6) | 30.6 (±14.8) | 0.912 b |
African | 22.6 (±12.1) | 24.2 (±13.8) | 0.498 b |
Polymorphisms | Case (n = 67) | Control (n = 196) | p-Value a | OR (95% CI) |
---|---|---|---|---|
IL-1A (rs3783553) | ||||
Del/Del | 5 (7.5%) | 32 (16.3%) | 0.033 * | Ins/Ins vs. Others |
Ins/Del | 33 (49.3%) | 107 (54.6%) | ||
Ins/Ins | 29 (43.2%) | 57 (29.1%) | 2.002 (1.059–3.546) | |
Allele Del | 43 (32.1%) | 171 (43.6%) | 0.033 * | 0.499 (0.264–0.944) |
Allele Ins | 91 (67.9%) | 221 (56.4%) | 2.002 (1.059–3.546) | |
NFKB1 (rs28362491) | ||||
Del/Del | 13 (19.4%) | 46 (23.5%) | 0.018 * | Del/Del vs. Others |
Ins/Del | 35 (52.2%) | 97 (49.5%) | ||
Ins/Ins | 19 (28.4%) | 53 (27.0%) | 0.332 (0.133–0.825) | |
Allele Del | 61 (45.5%) | 189 (48.2%) | 0.981 | 1.009 (0.500–2.033) |
Allele Ins | 73 (54.5%) | 203 (51.8%) | 0.992 (0.492–1.999) | |
PAR1 (rs11267092) | ||||
Del/Del | 23 (34.3%) | 108 (55.1%) | 0.023 * | Del/Del vs. Others |
Ins/Del | 32 (47.8%) | 75 (38.3%) | 0.471 (0.247–0.971) | |
Ins/Ins | 12 (17.9%) | 13 (6.6%) | ||
Allele Del | 78 (58.2%) | 291 (74.2%) | 0.130 | 0.477 (0.183–1.244) |
Allele Ins | 56 (41.8%) | 101 (25.8%) | ||
TP53 (rs17878362) | ||||
Del/Del | 34 (50.7%) | 129 (65.8%) | 0.041 * | Del/Del vs. Others |
Ins/Del | 29 (43.3%) | 61 (31.1%) | 0.510 (0.267–0.974) | |
Ins/Ins | 4 (6.0%) | 6 (3.1%) | ||
Allele Del | 97 (72.4%) | 319 (81.4%) | 0.568 | 0.655 (0.153–2.789) |
Allele Ins | 37 (27.6%) | 73 (18.6%) | ||
UCP2(INDEL 45-bp) | ||||
Del/Del | 39 (58.2%) | 88 (44.9%) | 0.031 * | Del/Del vs. Others |
Ins/Del | 22 (32.8%) | 90 (45.9%) | ||
Ins/Ins | 6 (9.0%) | 18 (9.2%) | 2.031 (1.067–3.868) | |
Allele Del | 100 (74.6%) | 266 (67.9%) | 0.617 | 1.367 (0.401–4.663) |
Allele Ins | 34 (25.4%) | 126 (32.1%) | 0.731 (0.214–2.495) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pereira, E.E.B.; Modesto, A.A.C.; Fernandes, B.M.; Burbano, R.M.R.; Assumpção, P.P.; Fernandes, M.R.; Guerreiro, J.F.; Santos, S.E.B.d.; Santos, N.P.C.d. Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon. Genes 2023, 14, 461. https://doi.org/10.3390/genes14020461
Pereira EEB, Modesto AAC, Fernandes BM, Burbano RMR, Assumpção PP, Fernandes MR, Guerreiro JF, Santos SEBd, Santos NPCd. Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon. Genes. 2023; 14(2):461. https://doi.org/10.3390/genes14020461
Chicago/Turabian StylePereira, Esdras E. B., Antônio A. C. Modesto, Bruno M. Fernandes, Rommel M. R. Burbano, Paulo P. Assumpção, Marianne R. Fernandes, João F. Guerreiro, Sidney E. B. dos Santos, and Ney P. C. dos Santos. 2023. "Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon" Genes 14, no. 2: 461. https://doi.org/10.3390/genes14020461