miR-34a and miR-200c Have an Additive Tumor-Suppressive Effect on Breast Cancer Cells and Patient Prognosis
Abstract
:1. Background
2. Methods
2.1. Clinical Samples
2.2. Bioinformatics Analyses
2.3. Cell Culture and Transfection
2.4. Quantitative Reverse-Transcription PCR
2.5. Apoptosis Assays
2.6. Cell Cycle Profiling
2.7. Invasion Assays
2.8. Migration Assays
2.9. Proliferation Assays
2.10. Western Blot Analysis
2.11. Colony Formation Assays
2.12. CD44 and CD133 Evaluation Assays
2.13. Animal Experiments
2.14. In Vivo Colonization and Metastasis Assays
2.15. Immunohistochemistry
2.16. TUNEL Assays
2.17. Statistical Analyses
3. Results
3.1. MiR-34a and miR-200c Are Downregulated in Breast Cancer Tissues and Invasive Cell Lines and This Predicts Poor Patient Survival
3.2. Restoration of miR-200c and miR-34a Expression in Breast Cancer Cell Lines Additionally Induces Apoptosis and G2/M Cell Cycle Arrest
3.3. MiR-200c and miR-34a Additionally Inhibit Breast Cancer Cell Invasion, Migration, Proliferation and Expression of EMT Markers
3.4. MiR-34a and miR-200c Additionally Decrease Breast Cancer Stemness Properties
3.5. MiR-34a and miR-200c Inhibit Cancer Development In Vivo
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- De Santis, C.E.; Ma, J.; Sauer, A.G.; Newman, L.A.; Jemal, A. Breast cancer statistics, 2017, racial disparity in mortality by state. CA A Cancer J. Clin. 2017, 67, 439–448. [Google Scholar] [CrossRef] [Green Version]
- Lorusso, V.; Manzione, L.; Silvestris, N. Role of liposomal anthracyclines in breast cancer. Ann. Oncol. 2007, 18 (Suppl. 6), vi70–vi73. [Google Scholar] [CrossRef] [PubMed]
- Makdissi, F.B.; Leite, F.P.M.; Peres, S.V.; Silva, D.R.M.E.; de Oliveira, M.M.; Lopez, R.V.M.; Sanches, S.M.; Gondim, G.; Iyeyasu, H.; Calsavara, V.F.; et al. Breast cancer survival in a Brazilian cancer center: A cohort study of 5095 patients. Mastology 2019, 29, 37–46. [Google Scholar] [CrossRef]
- Mansoori, B.; Mohammadi, A.; Asadzadeh, Z.; Shirjang, S.; Minouei, M.; Abedi-Gaballu, F.; Shajari, N.; Kazemi, T.; Gjerstorff, M.F.; Duijf, P.H.G.; et al. HMGA2 and Bach-1 cooperate to promote breast cancer cell malignancy. J. Cell. Physiol. 2019, 234, 17714–17726. [Google Scholar] [CrossRef]
- Esmailzadeh, S.; Mansoori, B.; Mohammadi, A.; Shanehbandi, D.; Baradaran, B. siRNA-Mediated Silencing of HMGA2 Induces Apoptosis and Cell Cycle Arrest in Human Colorectal Carcinoma. J. Gastrointest. Cancer 2017, 48, 156–163. [Google Scholar] [CrossRef]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved Seed Pairing, Often Flanked by Adenosines, Indicates that Thousands of Human Genes are MicroRNA Targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [Green Version]
- Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from Repression to Activation: MicroRNAs Can Up-Regulate Translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef] [Green Version]
- Si, W.; Li, Y.; Shao, H.; Hu, R.; Wang, W.; Zhang, K.; Yang, Q. MiR-34a Inhibits Breast Cancer Proliferation and Progression by Targeting Wnt1 in Wnt/β-Catenin Signaling Pathway. Am. J. Med. Sci. 2016, 352, 191–199. [Google Scholar] [CrossRef]
- Adams, B.D.; Wali, V.; Cheng, C.; Inukai, S.; Rimm, D.; Pusztai, L.; Saltzman, M.; Slack, F. Abstract LB-300: Reintroduction of tumor-suppressor miR-34a shows therapeutic efficacy in triple-negative breast cancer. Mol. Cell. Biol. 2015, 75, LB-300. [Google Scholar] [CrossRef]
- Slabáková, E.; Culig, Z.; Remšík, J.; Souček, K. Alternative mechanisms of miR-34a regulation in cancer. Cell Death Dis. 2017, 8, e3100. [Google Scholar] [CrossRef] [PubMed]
- Mansoori, B.; Mohammadi, A.; Shirjang, S.; Baghbani, E.; Baradaran, B. Micro RNA 34a and let-7a expression in human breast cancers is associated with apoptotic expression genes. Asian Pac. J. Cancer Prev. 2016, 17, 1887–1890. [Google Scholar]
- Wu, M.-Y.; Fu, J.; Xiao, X.; Wu, J.; Wu, R.-C. MiR-34a regulates therapy resistance by targeting HDAC1 and HDAC7 in breast cancer. Cancer Lett. 2014, 354, 311–319. [Google Scholar] [CrossRef]
- Liu, C.; Kelnar, K.; Liu, B.; Chen, X.; Calhoun-Davis, T.; Li, H.; Patrawala, L.; Yan, H.; Jeter, C.R.; Honorio, S.; et al. The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat. Med. 2011, 17, 211–215. [Google Scholar] [CrossRef] [Green Version]
- Shirjang, S.; Mansoori, B.; Asghari, S.; Duijf, P.H.; Mohammadi, A.; Gjerstorff, M.; Baradaran, B. MicroRNAs in cancer cell death pathways: Apoptosis and necroptosis. Free Radic. Biol. Med. 2019, 139, 1–15. [Google Scholar] [CrossRef]
- Asadzadeh, Z.; Mansoori, B.; Mohammadi, A.; Aghajani, M.; Hajiasgharzadeh, K.; Safarzadeh, E.; Mokhtarzadeh, A.; Duijf, P.H.G.; Baradaran, B. microRNAs in cancer stem cells: Biology, pathways, and therapeutic opportunities. J. Cell. Physiol. 2019, 234, 10002–10017. [Google Scholar] [CrossRef]
- Li, L.; Yuan, L.; Luo, J.; Gao, J.; Guo, J.; Xie, X. MiR-34a inhibits proliferation and migration of breast cancer through down-regulation of Bcl-2 and SIRT1. Clin. Exp. Med. 2013, 13, 109–117. [Google Scholar] [CrossRef]
- Kang, L.; Mao, J.; Tao, Y.; Song, B.; Ma, W.; Lu, Y.; Zhao, L.; Li, J.; Yang, B.; Li, L. MicroRNA-34a suppresses the breast cancer stem cell-like characteristics by downregulating Notch1 pathway. Cancer Sci. 2015, 106, 700–708. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Song, X.; Zhu, J.; Li, M.; Ji, Y.; Wu, F.; Chen, Y.; Cui, X.; Hu, J.; Wang, L. Tumor suppressor microRNA-34a inhibits cell migration and invasion by targeting MMP-2/MMP-9/FNDC3B in esophageal squamous cell carcinoma. Int. J. Oncol. 2017, 51, 378–388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mizuno, S.; Gomez-Arroyo, J.; Alhussaini, A.; Kraskauskas, D.; Cool, C.; Bogaard, H.; Voelkel, N. microRNA-34a and microRNA 199a-5p in COPD and their control of HIF-1α expression in pulmonary vasucular endothelial cells. Eur. Respir. Soc. 2011, 38, 47–49. [Google Scholar]
- Zuberi, M.; Mir, A.R.; Das, J.; Ahmad, I.; Javid, J.; Yadav, P.; Masroor, M.; Ahmad, S.; Ray, P.C.; Saxena, A. Expression of serum miR-200a, miR-200b, and miR-200c as candidate biomarkers in epithelial ovarian cancer and their association with clinicopathological features. Clin. Transl. Oncol. 2015, 17, 779–787. [Google Scholar] [CrossRef] [PubMed]
- Antolín, S.; Calvo, L.; Blanco-Calvo, M.; Santiago, M.P.; Lorenzo-Patiño, M.J.; Haz-Conde, M.; Santamarina, I.; Figueroa, A.; Antón-Aparicio, L.M.; Valladares-Ayerbes, M. Circulating miR-200c and miR-141 and outcomes in patients with breast cancer. BMC Cancer 2015, 15, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, D.; Zhang, Y.; Wang, J.; Chen, J.; Yang, C.; Cai, K.; Wang, X.; Shi, F.; Dou, J. MicroRNA-200c overexpression inhibits tumorigenicity and metastasis of CD117+CD44+ ovarian cancer stem cells by regulating epithelial-mesenchymal transition. J. Ovarian Res. 2013, 6, 50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cochrane, D.R.; Spoelstra, N.S.; Howe, E.N.; Nordeen, S.K.; Richer, J.K. MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents. Mol. Cancer Ther. 2009, 8, 1055–1066. [Google Scholar] [CrossRef] [Green Version]
- Kopp, F.; Wagner, E.; Roidl, A. The proto-oncogene KRAS is targeted by miR-200c. Oncotarget 2013, 5, 185–195. [Google Scholar] [CrossRef]
- Koo, T.; Cho, B.J.; Kim, D.H.; Park, J.M.; Choi, E.J.; Kim, H.H.; Lee, D.J.; Kim, I.A. MicroRNA-200c increases radiosensitivity of human cancer cells with activated EGFR-associated signaling. Oncotarget 2017, 8, 65457–65468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haybar, H.; Shahrabi, S.; Zayeri, Z.D.; Pezeshki, S. Strategies to increase cardioprotection through cardioprotective chemokines in chemotherapy-induced cardiotoxicity. Int. J. Cardiol. 2018, 269, 276–282. [Google Scholar] [CrossRef]
- Koboldt, D.C.; Fulton, R.S.; McLellan, M.D.; Schmidt, H.; Kalicki-Veizer, J.; McMichael, J.F.; Fulton, L.L.; Dooling, D.J.; Ding, L.; Mardis, E.R.; et al. Comprehensive molecular portraits of human breast tumours. Nature 2012, 490, 61–70. [Google Scholar]
- Mansoori, B.; Mohammadi, A.; Shanehbandi, D.; Gjerstorff, M.; Shanehbandi, D.; Shirjang, S.; Najafi, S.; Holmskov, U.; Khaze, V.; Duijf, P.H.G.; et al. miR-330 suppresses EMT and induces apoptosis by downregulating HMGA2 in human colorectal cancer. J. Cell. Physiol. 2020, 235, 920–931. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.-Y.; Beattie, A.; Baradaran, B.; Dray, E.; Duijf, P.H.G. Contradictory mRNA and protein misexpression of EEF1A1 in ductal breast carcinoma due to cell cycle regulation and cellular stress. Sci. Rep. 2018, 8, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Thangavelu, P.U.; Krenács, T.; Dray, E.; Duijf, P.H.G. In epithelial cancers, aberrant COL17A1 promoter methylation predicts its misexpression and increased invasion. Clin. Epigenetics 2016, 8, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Vaidyanathan, S.; Thangavelu, P.U.; Duijf, P.H.G. Overexpression of Ran GTPase Components Regulating Nuclear Export, but not Mitotic Spindle Assembly, Marks Chromosome Instability and Poor Prognosis in Breast Cancer. Target. Oncol. 2016, 11, 677–686. [Google Scholar] [CrossRef] [PubMed]
- Hoadley, K.A.; Yau, C.; Wolf, D.M.; Cherniack, A.D.; Tamborero, D.; Chang, K.; Leiserson, M.D.; Niu, B.; McLellan, M.D.; Uzunangelov, V.; et al. Multiplatform Analysis of 12 Cancer Types Reveals Molecular Classification within and across Tissues of Origin. Cell 2014, 158, 929–944. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, C.; Liu, L.-Z.; Pei, X.-Q.; Liu, X.; Yang, L.; Ye, F.; Xie, X.; Chen, J.; Tang, H.; Xie, X. miR-200c inhibits breast cancer proliferation by targeting KRAS. Oncotarget 2015, 6, 34968–34978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shan, W.; Zhang, X.; Li, M.; Deng, F.; Zhang, J. Over expression of miR-200c suppresses invasion and restores methotrexate sensitivity in lung cancer A549 cells. Gene 2016, 593, 265–271. [Google Scholar] [CrossRef] [PubMed]
- He, C.; Xiong, J.; Xu, X.; Lu, W.; Liu, L.; Xiao, D.; Wang, D. Functional elucidation of MiR-34 in osteosarcoma cells and primary tumor samples. Biochem. Biophys. Res. Commun. 2009, 388, 35–40. [Google Scholar] [CrossRef]
- Majidinia, M.; Yousefi, B. DNA damage response regulation by microRNAs as a therapeutic target in cancer. DNA Repair 2016, 47, 1–11. [Google Scholar] [CrossRef]
- Song, C.; Lu, P.; Sun, G.; Yang, L.; Wang, Z.; Wang, Z. miR-34a sensitizes lung cancer cells to cisplatin via p53/miR-34a/MYCN axis. Biochem. Biophys. Res. Commun. 2017, 482, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Swartling, F.J.; Bolin, S.; Phillips, J.J.; Persson, A.I. Signals that regulate the oncogenic fate of neural stem cells and progenitors. Exp. Neurol. 2014, 260, 56–68. [Google Scholar] [CrossRef] [Green Version]
- Park, Y.-A.; Lee, J.-W.; Choi, J.-J.; Jeon, H.-K.; Cho, Y.; Choi, C.; Kim, T.-J.; Lee, N.W.; Kim, B.G.; Bae, D.-S. The interactions between MicroRNA-200c and BRD7 in endometrial carcinoma. Gynecol. Oncol. 2012, 124, 125–133. [Google Scholar] [CrossRef]
- Zheng, R.; Liu, Y.; Zhang, X.; Zhao, P.; Deng, Q. miRNA-200c enhances radiosensitivity of esophageal cancer by cell cycle arrest and targeting P21. Biomed. Pharmacother. 2017, 90, 517–523. [Google Scholar] [CrossRef]
- Zheng, Q.; Zhang, D.; Yang, Y.U.; Cui, X.; Sun, J.; Liang, C.; Qin, H.; Yang, X.; Liu, S.; Yan, Q. MicroRNA-200c impairs uterine receptivity formation by targeting FUT4 and α1,3-fucosylation. Cell Death Differ. 2017, 24, 2161–2172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ito, T.; Yagi, S.; Yamakuchi, M. MicroRNA-34a regulation of endothelial senescence. Biochem. Biophys. Res. Commun. 2010, 398, 735–740. [Google Scholar] [CrossRef] [PubMed]
- Bai, T.; Dong, D.-S.; Pei, L. Synergistic antitumor activity of resveratrol and miR-200c in human lung cancer. Oncol. Rep. 2014, 31, 2293–2297. [Google Scholar] [CrossRef]
- Sinha, D.; Duijf, P.H.; Khanna, K.K. Mitotic slippage: An old tale with a new twist. Cell Cycle 2019, 18, 7–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amundson, S.A.; Myers, T.G.; Fornace, A.J., Jr. Roles for p53 in growth arrest and apoptosis: Putting on the brakes after genotoxic stress. Oncogene 1998, 17, 3287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hafner, A.; Bulyk, M.L.; Jambhekar, A.; Lahav, G. The multiple mechanisms that regulate p53 activity and cell fate. Nat. Rev. Mol. Cell Biol. 2019, 20, 199–210. [Google Scholar] [CrossRef]
- Liu, C.; Tang, D.G. MicroRNA Regulation of Cancer Stem Cells: Figure 1. Cancer Res. 2011, 71, 5950–5954. [Google Scholar] [CrossRef] [Green Version]
- Aghajani, M.; Mansoori, B.; Mohammadi, A.; Asadzadeh, Z.; Baradaran, B. New emerging roles of CD133 in cancer stem cell: Signaling pathway and miRNA regulation. J. Cell. Physiol. 2019, 234, 21642–21661. [Google Scholar] [CrossRef] [PubMed]
- Atala, A. Re: The MicroRNA miR-34a Inhibits Prostate Cancer Stem Cells and Metastasis by Directly Repressing CD44. J. Urol. 2011, 186, 1555. [Google Scholar] [CrossRef]
- Jia, L.-F.; Wei, S.-B.; Mitchelson, K.; Gao, Y.; Zheng, Y.-F.; Meng, Z.; Gan, Y.-H.; Yu, G.-Y. miR-34a Inhibits Migration and Invasion of Tongue Squamous Cell Carcinoma via Targeting MMP9 and MMP14. PLoS ONE 2014, 9, e108435. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.; Zhang, M.; Saad, Y.; Kolattukudy, P.E. Antidicer RNAse activity of monocyte chemotactic protein-induced protein-1 is critical for inducing angiogenesis. Am. J. Physiol. Physiol. 2013, 305, C1021–C1032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Booton, R.; Lindsay, M.A. Emerging Role of MicroRNAs and Long Noncoding RNAs in Respiratory Disease. Chest 2014, 146, 193–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghasabi, M.; Majidi, J.; Mansoori, B.; Mohammadi, A.; Shomali, N.; Shirafkan, N.; Baghbani, E.; Kazemi, T.; Baradaran, B. The effect of combined miR-200c replacement and cisplatin on apoptosis induction and inhibition of gastric cancer cell line migration. J. Cell. Physiol. 2019, 234, 22581–22592. [Google Scholar] [CrossRef] [PubMed]
- Beji, S.; Milano, G.; Scopece, A.; Cicchillitti, L.; Cencioni, C.; Picozza, M.; D’Alessandra, Y.; Pizzolato, S.; Bertolotti, M.; Spaltro, G.; et al. Doxorubicin upregulates CXCR4 via miR-200c/ZEB1-dependent mechanism in human cardiac mesenchymal progenitor cells. Cell Death Dis. 2017, 8, e3020. [Google Scholar] [CrossRef]
- Byun, Y.; Choi, Y.-C.; Jeong, Y.; Lee, G.; Yoon, S.; Jeong, Y.; Yoon, J.; Baek, A.K. MiR-200c downregulates HIF-1α and inhibits migration of lung cancer cells. Cell. Mol. Biol. Lett. 2019, 24, 1–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eliceiri, B.P.; Paul, R.; Schwartzberg, P.L.; Hood, J.D.; Leng, J.; Cheresh, D.A. Selective Requirement for Src Kinases during VEGF-Induced Angiogenesis and Vascular Permeability. Mol. Cell 1999, 4, 915–924. [Google Scholar] [CrossRef]
- Choi, J.Y.; Jang, Y.S.; Min, S.Y.; Song, J.-Y. Overexpression of MMP-9 and HIF-1α in Breast Cancer Cells under Hypoxic Conditions. J. Breast Cancer 2011, 14, 88–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishikawa, T.; Nakashiro, K.-I.; Klosek, S.K.; Goda, H.; Hara, S.; Uchida, D.; Hamakawa, H. Hypoxia enhances CXCR4 expression by activating HIF-1 in oral squamous cell carcinoma. Oncol. Rep. 2009, 21, 707–712. [Google Scholar] [CrossRef] [Green Version]
Target Sequence (5′-3′) | |
---|---|
miR-34a | UGGCAGUGUCUUAGCUGGUUGU |
miR-200c | CGUCUUACCCAGCAGUGUUUGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mansoori, B.; Silvestris, N.; Mohammadi, A.; Khaze, V.; Baghbani, E.; Mokhtarzadeh, A.; Shanehbandi, D.; Derakhshani, A.; Duijf, P.H.G.; Baradaran, B. miR-34a and miR-200c Have an Additive Tumor-Suppressive Effect on Breast Cancer Cells and Patient Prognosis. Genes 2021, 12, 267. https://doi.org/10.3390/genes12020267
Mansoori B, Silvestris N, Mohammadi A, Khaze V, Baghbani E, Mokhtarzadeh A, Shanehbandi D, Derakhshani A, Duijf PHG, Baradaran B. miR-34a and miR-200c Have an Additive Tumor-Suppressive Effect on Breast Cancer Cells and Patient Prognosis. Genes. 2021; 12(2):267. https://doi.org/10.3390/genes12020267
Chicago/Turabian StyleMansoori, Behzad, Nicola Silvestris, Ali Mohammadi, Vahid Khaze, Elham Baghbani, Ahad Mokhtarzadeh, Dariush Shanehbandi, Afshin Derakhshani, Pascal H. G. Duijf, and Behzad Baradaran. 2021. "miR-34a and miR-200c Have an Additive Tumor-Suppressive Effect on Breast Cancer Cells and Patient Prognosis" Genes 12, no. 2: 267. https://doi.org/10.3390/genes12020267