Enhancing Adoptive Cell Transfer with Combination BRAF-MEK and CDK4/6 Inhibitors in Melanoma
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Drugs
2.2. Cell Proliferation Assays
2.3. Gene Expression Analysis
- B2M-Forward: TTCACCCCCACTGAG
- B2M-Reverse: GTCTTGGGCTCGGCC
- NONO-Forward: TATCAGGGGGAAGATTGCCC
- NONO-Reverse: GCCAGAATGAAGGCTTGACT
2.4. Animal Work
2.5. T Cell Expansion and Adoptive Cell Transfer
2.6. Flow Cytometry
2.7. IFN-γ Release Assay
2.8. Chromium Release Assay
2.9. Statistical Analysis
3. Results
3.1. YOVAL1.1 but Not SM1WT1 Mouse Melanoma Cells Are Highly Sensitive to Combination BRAF-MEKi and the Addition of Palbociclib Enhances Inhibition of SM1WT1 Proliferation
3.2. Combination BRAF-MEK-CDK4/6i ± OT1 Is Highly Efficacious against YOVAL1.1
3.3. In the Therapy Resistant SM1WT1 Model, ACT Does Not Enhance Response to Combination BRAF-MEKi ± CDK4/6i
3.4. Pmel-1 T Cells Kills SM1WT1 In Vitro Only with gp100 Stimulation
3.5. BRAF-MEKi Upregulates MHC Class I and PD-L1 in SM1WT1 and YOVAL1.1 In Vitro
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Larkin, J.; Chiarion-Sileni, V.; Gonzalez, R.; Grob, J.-J.; Rutkowski, P.; Lao, C.D.; Cowey, C.L.; Schadendorf, D.; Wagstaff, J.; Dummer, R.; et al. Five-year survival with combined nivolumab and ipilimumab in advanced melanoma. N. Engl. J. Med. 2019, 381, 1535–1546. [Google Scholar] [CrossRef] [Green Version]
- Robert, C.; Grob, J.J.; Stroyakovskiy, D.; Karaszewska, B.; Hauschild, A.; Levchenko, E.; Sileni, V.C.; Schachter, J.; Garbe, C.; Bondarenko, I.; et al. Five-year outcomes with dabrafenib plus trametinib in metastatic melanoma. N. Engl. J. Med. 2019, 381, 626–636. [Google Scholar] [CrossRef]
- Rosenberg, S.A.; Yang, J.C.; Sherry, R.M.; Kammula, U.S.; Hughes, M.S.; Phan, G.Q.; Citrin, D.; Restifo, N.P.; Robbins, P.F.; Wunderlich, J.R.; et al. Durable complete responses in heavily pretreated patients with metastatic melanoma using T-cell transfer immunotherapy. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2011, 17, 4550–4557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosenberg, S.A.; Packard, B.S.; Aebersold, P.M.; Solomon, D.; Topalian, S.L.; Toy, S.T.; Simon, P.; Lotze, M.T.; Yang, J.C.-H.; Seipp, C.A.; et al. Use of tumor-infiltrating lymphocytes and interleukin-2 in the immunotherapy of patients with metastatic melanoma. A preliminary report. N. Engl. J. Med. 1988, 319, 1676–1680. [Google Scholar] [CrossRef] [PubMed]
- Sarnaik, A.A.; Hamid, O.; Khushalani, N.I.; Lewis, K.D.; Medina, T.; Kluger, H.M.; Thomas, S.S.; Domingo-Musibay, E.; Pavlick, A.C.; Whitman, E.D.; et al. Lifileucel, a tumor-infiltrating lymphocyte therapy, in metastatic melanoma. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 2021, 39, 2656–2666. [Google Scholar] [CrossRef]
- Koya, R.C.; Mok, S.; Otte, N.; Blacketor, K.J.; Comin-Anduix, B.; Tumeh, P.C.; Minasyan, A.; Graham, N.A.; Graeber, T.; Chodon, T.; et al. braf inhibitor vemurafenib improves the antitumor activity of adoptive cell immunotherapy. Cancer Res. 2012, 72, 3928–3937. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu-Lieskovan, S.; Mok, S.; Moreno, B.H.; Tsoi, J.; Robert, L.; Goedert, L.; Pinheiro, E.M.; Koya, R.C.; Graeber, T.G.; Comin-Anduix, B.; et al. Improved antitumor activity of immunotherapy with BRAF and MEK inhibitors in BRAF V600E melanoma. Sci. Transl. Med. 2015, 7, 279ra241. [Google Scholar] [CrossRef] [Green Version]
- Lau, P.K.H.; Ascierto, P.A.; McArthur, G. Melanoma: The intersection of molecular targeted therapy and immune checkpoint inhibition. Curr. Opin. Immunol. 2016, 39, 30–38. [Google Scholar] [CrossRef] [PubMed]
- Boni, A.; Cogdill, A.; Dang, P.; Udayakumar, D.; Njauw, C.-N.J.; Sloss, C.M.; Ferrone, C.R.; Flaherty, K.T.; Lawrence, D.P.; Fisher, D.E.; et al. Selective BRAFV600E inhibition enhances T-cell recognition of melanoma without affecting lymphocyte function. Cancer Res. 2010, 70, 5213–5219. [Google Scholar] [CrossRef] [Green Version]
- Bradley, S.; Chen, Z.; Melendez, B.; Talukder, A.; Khalili, J.S.; Rodriguez-Cruz, T.; Liu, S.; Whittington, M.; Deng, W.; Li, F.; et al. BRAFV600E co-opts a conserved MHC class I internalization pathway to diminish antigen presentation and CD8+ T-cell recognition of melanoma. Cancer Immunol. Res. 2015, 3, 602–609. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frederick, D.T.; Piris, A.; Cogdill, A.; Cooper, Z.; Lezcano, C.; Ferrone, C.R.; Mitra, D.; Boni, A.; Newton, L.P.; Liu, C.; et al. BRAF inhibition is associated with enhanced melanoma antigen expression and a more favorable tumor microenvironment in patients with metastatic melanoma. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2013, 19, 1225–1231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Finn, R.S.; Crown, J.P.; Ettl, J.; Schmidt, M.; Bondarenko, I.; Lang, I.; Pinter, T.; Boer, K.; Patel, R.; Randolph, S.; et al. Efficacy and safety of palbociclib in combination with letrozole as first-line treatment of ER-positive, HER2-negative, advanced breast cancer: Expanded analyses of subgroups from the randomized pivotal trial PALOMA-1/TRIO-18. Breast Cancer Res. 2016, 18, 67. [Google Scholar] [CrossRef] [Green Version]
- Hortobagyi, G.N.; Stemmer, S.M.; Burris, H.A.; Yap, Y.-S.; Sonke, G.S.; Paluch-Shimon, S.; Campone, M.; Blackwell, K.L.; Andre, F.; Winer, E.P.; et al. Ribociclib as first-line therapy for HR-positive, advanced breast cancer. N. Engl. J. Med. 2016, 375, 1738–1748. [Google Scholar] [CrossRef] [PubMed]
- Young, R.J.; Waldeck, K.; Martin, C.; Foo, J.H.; Cameron, D.P.; Kirby, L.; Do, H.; Mitchell, C.; Cullinane, C.; Liu, W.; et al. Loss ofCDKN2A expression is a frequent event in primary invasive melanoma and correlates with sensitivity to the CDK4/6 inhibitor PD0332991 in melanoma cell lines. Pigment. Cell Melanoma Res. 2014, 27, 590–600. [Google Scholar] [CrossRef]
- Martin, C.A.; Cullinane, C.; Kirby, L.; Abuhammad, S.; Lelliott, E.J.; Waldeck, K.; Young, R.J.; Brajanovski, N.; Cameron, D.P.; Walker, R.; et al. Palbociclib synergizes with BRAF and MEK inhibitors in treatment naïve melanoma but not after the development of BRAF inhibitor resistance. Int. J. Cancer 2018, 142, 2139–2152. [Google Scholar] [CrossRef] [Green Version]
- Lelliott, E.J.; Mangiola, S.; Ramsbottom, K.M.; Zethoven, M.; Lim, L.; Lau, P.K.H.; Oliver, A.J.; Martelotto, L.G.; Kirby, L.; Martin, C.; et al. Combined BRAF, MEK, and CDK4/6 inhibition depletes intratumoral immune-potentiating myeloid populations in melanoma. Cancer Immunol. Res. 2021, 9, 136–146. [Google Scholar] [CrossRef]
- Goel, S.; DeCristo, M.J.; Watt, A.C.; BrinJones, H.; Sceneay, J.; Li, B.B.; Khan, N.; Ubellacker, J.M.; Xie, S.; Metzger-Filho, O.; et al. CDK4/6 inhibition triggers anti-tumour immunity. Nature 2017, 548, 471–475. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Wang, E.S.; Jenkins, R.W.; Li, S.; Dries, R.; Yates, K.; Chhabra, S.; Huang, W.; Liu, H.; Aref, A.R.; et al. CDK4/6 inhibition augments antitumor immunity by enhancing T-cell activation. Cancer Discov. 2017, 8, 216–233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, X.; Ding, D.; Yan, Y.; Li, H.; Wang, B.; Ma, L.; Ye, Z.; Ma, T.; Wu, Q.; Rodrigues, D.N.; et al. Phosphorylated RB promotes cancer immunity by inhibiting NF-kappaB activation and PD-L1 expression. Mol. Cell 2019, 73, 22–35.e6. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Bu, X.; Wang, H.; Zhu, Y.; Geng, Y.; Nihira, N.T.; Tan, Y.; Ci, Y.; Wu, F.; Dai, X.; et al. Cyclin D–CDK4 kinase destabilizes PD-L1 via cullin 3–SPOP to control cancer immune surveillance. Nature 2018, 553, 91–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lelliott, E.J.; Kong, I.Y.; Zethoven, M.; Ramsbottom, K.M.; Martelotto, L.G.; Meyran, D.; Jiang Zhu, J.; Costacurta, M.; Kirby, L.; Sandow, J.J.; et al. CDK4/6 inhibition promotes anti-tumor immunity through the induction of T cell memory. Cancer Discov. 2021, 11, 2582–2601. [Google Scholar] [CrossRef]
- Knight, D.A.; Ngiow, S.F.; Li, M.; Parmenter, T.J.; Mok, S.; Cass, A.; Haynes, N.M.; Kinross, K.M.; Yagita, H.; Koya, R.C.; et al. Host immunity contributes to the anti-melanoma activity of BRAF inhibitors. J. Clin. Investig. 2013, 123, 1371–1381. [Google Scholar] [CrossRef] [PubMed]
- Lelliott, E.J.; Cullinane, C.; Martin, C.A.; Walker, R.; Ramsbottom, K.M.; Souza-Fonseca-Guimaraes, F.; AbuHammad, S.; Michie, J.; Kirby, L.; Young, R.J.; et al. A novel immunogenic mouse model of melanoma for the preclinical assessment of combination targeted and immune-based therapy. Sci. Rep. 2019, 9, 1225. [Google Scholar] [CrossRef] [Green Version]
- Overwijk, W.W.; Theoret, M.R.; Finkelstein, S.E.; Surman, D.R.; De Jong, L.A.; Vyth-Dreese, F.A.; Dellemijn, T.A.; Antony, P.A.; Spiess, P.J.; Palmer, D.; et al. Tumor regression and autoimmunity after reversal of a functionally tolerant state of self-reactive CD8+ T cells. J. Exp. Med. 2003, 198, 569–580. [Google Scholar] [CrossRef]
- Von Scheidt, B.; Wang, M.; Oliver, A.J.; Chan, J.D.; Jana, M.K.; Ali, A.I.; Clow, F.; Fraser, J.D.; Quinn, K.; Darcy, P.K.; et al. Enterotoxins can support CAR T cells against solid tumors. Proc. Natl. Acad. Sci. USA 2019, 116, 25229–25235. [Google Scholar] [CrossRef]
- Kirtane, K.; Elmariah, H.; Chung, C.H.; Abate-Daga, D. Adoptive cellular therapy in solid tumor malignancies: Review of the literature and challenges ahead. J. Immunother. Cancer 2021, 9, e002723. [Google Scholar] [CrossRef]
- Lee, J.; Shklovskaya, E.; Lim, S.Y.; Carlino, M.S.; Menzies, A.M.; Stewart, A.; Pedersen, B.; Irvine, M.; Alavi, S.; Yang, J.Y.H.; et al. Transcriptional downregulation of MHC class I and melanoma de- differentiation in resistance to PD-1 inhibition. Nat. Commun. 2020, 11, 1897. [Google Scholar] [CrossRef] [Green Version]
- Zaretsky, J.M.; Garcia-Diaz, A.; Shin, D.S.; Escuin-Ordinas, H.; Hugo, W.; Hu-Lieskovan, S.; Torrejon, D.Y.; Abril-Rodriguez, G.; Sandoval, S.; Barthly, L.; et al. Mutations associated with acquired resistance to PD-1 blockade in melanoma. N. Engl. J. Med. 2016, 375, 819–829. [Google Scholar] [CrossRef]
- Sapkota, B.; Hill, C.E.; Pollack, B.P. Vemurafenib enhances MHC induction inBRAFV600E homozygous melanoma cells. OncoImmunology 2013, 2, e22890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sumimoto, H.; Imabayashi, F.; Iwata, T.; Kawakami, Y. The BRAF–MAPK signaling pathway is essential for cancer-immune evasion in human melanoma cells. J. Exp. Med. 2006, 203, 1651–1656. [Google Scholar] [CrossRef] [Green Version]
- Borch, T.H.; Harbst, K.; Rana, A.H.; Andersen, R.; Martinenaite, E.; Kongsted, P.; Pedersen, M.; Nielsen, M.; Kjeldsen, J.W.; Kverneland, A.H.; et al. Clinical efficacy of T-cell therapy after short-term BRAF-inhibitor priming in patients with checkpoint inhibitor-resistant metastatic melanoma. J. Immunother. Cancer 2021, 9, e002703. [Google Scholar] [CrossRef] [PubMed]
- Atay, C.; Kwak, T.; Lavilla-Alonso, S.; Donthireddy, L.; Richards, A.D.; Moberg, V.; Pilon-Thomas, S.; Schell, M.J.; Messina, J.L.; Rebecca, V.W.; et al. BRAF targeting sensitizes resistant melanoma to cytotoxic T cells. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2019, 25, 2783–2794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deniger, D.C.; Kwong, M.L.M.; Pasetto, A.; Dudley, M.E.; Wunderlich, J.R.; Langhan, M.M.; Lee, C.-C.; Rosenberg, S.A. A pilot trial of the combination of vemurafenib with adoptive cell therapy in patients with metastatic melanoma. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2017, 23, 351–362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schadendorf, D.; Long, G.; Stroyakovskiy, D.; Karaszewska, B.; Hauschild, A.; Levchenko, E.; Sileni, V.C.; Schachter, J.; Garbe, C.; Dutriaux, C.; et al. Three-year pooled analysis of factors associated with clinical outcomes across dabrafenib and trametinib combination therapy phase 3 randomised trials. Eur. J. Cancer 2017, 82, 45–55. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lau, P.K.H.; Cullinane, C.; Jackson, S.; Walker, R.; Smith, L.K.; Slater, A.; Kirby, L.; Patel, R.P.; von Scheidt, B.; Slaney, C.Y.; et al. Enhancing Adoptive Cell Transfer with Combination BRAF-MEK and CDK4/6 Inhibitors in Melanoma. Cancers 2021, 13, 6342. https://doi.org/10.3390/cancers13246342
Lau PKH, Cullinane C, Jackson S, Walker R, Smith LK, Slater A, Kirby L, Patel RP, von Scheidt B, Slaney CY, et al. Enhancing Adoptive Cell Transfer with Combination BRAF-MEK and CDK4/6 Inhibitors in Melanoma. Cancers. 2021; 13(24):6342. https://doi.org/10.3390/cancers13246342
Chicago/Turabian StyleLau, Peter Kar Han, Carleen Cullinane, Susan Jackson, Rachael Walker, Lorey K. Smith, Alison Slater, Laura Kirby, Riyaben P. Patel, Bianca von Scheidt, Clare Y. Slaney, and et al. 2021. "Enhancing Adoptive Cell Transfer with Combination BRAF-MEK and CDK4/6 Inhibitors in Melanoma" Cancers 13, no. 24: 6342. https://doi.org/10.3390/cancers13246342