Dietary Betaine Attenuates High-Carbohydrate-Diet-Induced Oxidative Stress, Endoplasmic Reticulum Stress, and Apoptosis in Mandarin Fish (Siniperca chuatsi)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Diets
2.2. Fish and Feeding Trial
2.3. Sample Collection
2.4. Enzyme Activities
2.5. Histological Analysis
2.6. Quantitative Real-Time PCR
2.7. Statistical Analysis
3. Results
3.1. Growth Performance, Feed Utilization, and Morphological Indices
3.2. Hepatic Antioxidant Enzyme Activities
3.3. Antioxidant-Related Gene Expression in the Liver
3.4. ER-Stress-Related Gene Expression in the Liver
3.5. Autophagy-Related Gene Expression in the Liver
3.6. Apoptosis-Related Gene Expression and TUNEL Observations in the Liver
4. Discussion
4.1. Betaine Promoted Growth of Mandarin Fish Regardless of Dietary Carbohydrate Levels
4.2. Betaine Mitigated HC-Diet-Induced Oxidative Stress in Mandarin Fish
4.3. Betaine Alleviated HC-Diet-Induced Apoptosis by Attenuating ER Stress and Autophagy
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hatlen, B.; Grisdale-Helland, B.; Helland, S.J. Growth, feed utilization and body composition in two size groups of Atlantic halibut (Hippoglossus hippoglossus) fed diets differing in protein and carbohydrate content. Aquaculture 2005, 249, 401–408. [Google Scholar] [CrossRef]
- Asaduzzaman, M.; Wahab, M.A.; Verdegem, M.C.J.; Adhikary, R.K.; Rahman, S.M.S.; Azim, M.E.; Verreth, J.A.J. Effects of carbohydrate source for maintaining a high C:N ratio and fish driven re-suspension on pond ecology and production in periphyton-based freshwater prawn culture systems. Aquaculture 2010, 301, 37–46. [Google Scholar] [CrossRef]
- Zhang, Y.; Qin, C.; Yang, L.; Lu, R.; Zhao, X.; Nie, G. A comparative genomics study of carbohydrate/glucose metabolic genes: From fish to mammals. BMC Genom. 2018, 19, 246. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Li, P.; Peng, K.; Chen, B.; Hu, J.; Huang, W.; Cao, J.; Sun, Y. The positive effects of dietary arginine on juvenile hybrid snakehead (Channa maculate ♀ × Channa argus ♂) fed high-carbohydrate diets: Liver inflammation antioxidant response, and glucose metabolism. Aquacult. Rep. 2023, 30, 101602. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, N.; Wang, A.; Chen, N.; Li, S. Resveratrol inclusion alleviated high-dietary-carbohydrate-induced glycogen deposition and immune response of largemouth bass, Micropterus salmoides. Br. J. Nutr. 2022, 127, 165–176. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Wu, K.; Hogstrand, C.; Xu, Y.H.; Chen, G.H.; Wei, C.C.; Luo, Z. Lipophagy mediated carbohydrate-induced changes of lipid metabolism via oxidative stress, endoplasmic reticulum (ER) stress and ChREBP/PPARγ pathways. Cell. Mol. Life Sci. 2020, 77, 1987–2003. [Google Scholar] [CrossRef] [PubMed]
- Stone, D.A. Dietary carbohydrate utilization by fish. Rev. Fish. Sci. 2003, 11, 337–369. [Google Scholar] [CrossRef]
- Xiao, Q.; Li, J.; Liang, X.F.; Tang, S.; Zhang, Y.; Zhang, Z.; Kuang, Y.; Dou, Y.; He, S. Programming of high-glucose diet acceptance in Chinese perch (Siniperca Chuatsi) following an early exposure. Aquacult. Rep. 2020, 18, 100534. [Google Scholar] [CrossRef]
- Staessen, T.W.O.; Verdegem, M.C.J.; Weththasinghe, P.; Schrama, J.W. The effect of dietary non-starch polysaccharide level and bile acid supplementation on fat digestibility and the bile acid balance in rainbow trout (Oncorhynchus mykiss). Aquaculture 2020, 523, 735174. [Google Scholar] [CrossRef]
- Bhattarai, K.R.; Riaz, T.A.; Kim, H.R.; Chae, H.J. The aftermath of the interplay between the endoplasmic reticulum stress response and redox signaling. Exp. Mol. Med. 2021, 53, 151–167. [Google Scholar] [CrossRef]
- Li, H.; Xu, W.; Wu, L.; Dong, B.; Jin, J.; Han, D.; Zhu, X.; Yang, Y.; Liu, H.; Xie, S. Differential regulation of endoplasmic reticulum stress-induced autophagy and apoptosis in two strains of gibel carp (Carassius gibelio) exposed to acute waterborne cadmium. Aquat. Toxicol. 2021, 231, 105721. [Google Scholar] [CrossRef] [PubMed]
- Gorman, A.M.; Healy, S.J.M.; Jäger, R.; Samali, A. Stress management at the ER: Regulators of ER stress-induced apoptosis. Pharmacol. Ther. 2012, 134, 306–316. [Google Scholar] [CrossRef] [PubMed]
- Qi, Z.; Chen, L. Autophagy: Biology and Diseases; Qin, Z.H., Ed.; Springer: Singapore, 2019; Volume 1206, pp. 167–177. [Google Scholar]
- Zhao, L.; Liang, J.; Chen, F.; Tang, X.; Liao, L.; Liu, Q.; Luo, J.; Du, Z.; Li, Z.; Luo, W.; et al. High carbohydrate diet induced endoplasmic reticulum stress and oxidative stress, promoted inflammation and apoptosis, impaired intestinal barrier of juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2021, 119, 308–317. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Huang, Z.; Lin, H.; Ma, Z.; Wang, J.; Wang, Y.; Yu, W. Rhizoma curcumae Longae ameliorates high dietary carbohydrate-induced hepatic oxidative stress, inflammation in golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 2022, 130, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Liu, W.B.; Shi, H.J.; Mi, H.F.; Li, X.F. Benfotiamine ameliorates high-carbohydrate diet-induced hepatic oxidative stress, inflammation and apoptosis in Megalobrama amblycephala. Aquac. Res. 2021, 52, 3174–3185. [Google Scholar] [CrossRef]
- Qian, J.; Yin, B.; Liu, H.; Tan, B.; Dong, X.; Chi, S.; Yang, Q.; Zhang, S. Effects of taurine supplementation in a high-carbohydrate diet on growth performance, plasma biochemical, digestive and glucose metabolism enzymes in hybrid grouper (♀ Epinephelus fuscoguttatus × ♂ E. lanceolatus). Aquac. Rep. 2021, 21, 100820. [Google Scholar] [CrossRef]
- Zhang, Y.; Wei, Z.; Yang, M.; Liu, D.; Pan, M.; Wu, C.; Zhang, W.; Mai, K. Dietary taurine modulates hepatic oxidative status, ER stress and inflammation in juvenile turbot (Scophthalmus maximus L.) fed high carbohydrate diets. Fish Shellfish Immunol. 2021, 109, 1–11. [Google Scholar] [CrossRef]
- Shi, Y.; Zhong, L.; Fan, Y.; Zhang, J.; Zhong, H.; Liu, X.; Shao, C.; Hu, Y. The protective effect of mulberry leaf flavonoids on high-carbohydrate-induced liver oxidative stress, inflammatory response and intestinal microbiota disturbance in Monopterus albus. Antioxidants 2022, 11, 976. [Google Scholar] [CrossRef]
- Jin, M.; Shen, Y.; Pan, T.; Zhu, T.; Li, X.; Xu, F.; Betancor, M.B.; Jiao, L.; Tocher, D.R.; Zhou, Q. Dietary betaine mitigates hepatic steatosis and inflammation induced by a high-fat-diet by modulating the Sirt1/Srebp-1/Pparɑ pathway in juvenile black seabream (Acanthopagrus schlegelii). Front. Immunol. 2021, 12, 694720. [Google Scholar] [CrossRef]
- Ismail, T.; Hegazi, E.; Dawood, M.A.O.; Nassef, E.; Bakr, A.; Paray, B.A.; Van Doan, H. Using of betaine to replace fish meal with soybean or/and corn gluten meal in nile tilapia (Oreochromis niloticus) diets: Histomorphology, growth, fatty acid, and glucose-related gene expression traits. Aquac. Rep. 2020, 17, 100376. [Google Scholar] [CrossRef]
- Chen, X.; Luo, J.; Yang, L.; Guo, Y.; Fan, Y.; Liu, J.; Sun, J.; Zhang, Y.; Jiang, Q.; Chen, T.; et al. miR-143-mediated responses to betaine supplement repress lipogenesis and hepatic gluconeogenesis by targeting MAT1a and MAPK11. J. Agric. Food Chem. 2022, 70, 7981–7992. [Google Scholar] [CrossRef] [PubMed]
- Adjoumani, J.J.Y.; Wang, K.; Zhou, M.; Liu, W.; Zhang, D. Effect of dietary betaine on growth performance, antioxidant capacity and lipid metabolism in blunt snout bream fed a high-fat diet. Fish Physiol. Biochem. 2017, 43, 1733–1745. [Google Scholar] [CrossRef] [PubMed]
- Mohseni, M.; Saltanat, N.L.; Rastravan, M.E.; Golalipour, Y. Effects of betaine supplementation in plant-protein-based diets on growth performance, haemato-immunological parameters, antioxidant status and digestive enzyme activities of juvenile Caspian trout (Salmo trutta, Kessler, 1877). Aquac. Nutr. 2021, 27, 2132–2141. [Google Scholar] [CrossRef]
- Zhao, G.; He, F.; Wu, C.; Li, P.; Li, N.; Deng, J.; Zhu, G.; Ren, W.; Peng, Y. Betaine in inflammation: Mechanistic aspects and applications. Front. Immunol. 2018, 9, 1070. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Oku, H.; Ogata, H.; Liu, J.; He, X. Weaning Chinese perch Siniperca chuatsi (Basilewsky) onto artificial diets based upon its specific sensory modality in feeding. Aquac. Res. 2001, 32, 76–82. [Google Scholar] [CrossRef]
- Li, H.; Niu, S.; Pan, H.; Wang, G.; Xie, J.; Tian, J.; Zhang, K.; Xia, Y.; Li, Z.; Yu, E.; et al. Integrated miRNA-mRNA analysis reveals the molecular mechanism in mandarin fish (Siniperca chuatsi) in response to fresh baits and artificial diets feeding. Aquac. Rep. 2023, 30, 101554. [Google Scholar] [CrossRef]
- You, J.J.; Ren, P.; He, S.; Liang, X.F.; Xiao, Q.Q.; Zhang, Y.P. Histone methylation of h3k4 involved in the anorexia of carnivorous mandarin fish (Siniperca chuatsi) after feeding on a carbohydrate-rich diet. Front. Endocrinol. 2020, 11, 323. [Google Scholar] [CrossRef]
- Zhang, Y.; Liang, X.F.; He, S.; Wang, J.; Li, L.; Zhang, Z.; Li, J.; Chen, X.; Li, L.; Alam, M.S.; et al. Metabolic responses of Chinese perch (Siniperca chuatsi) to different levels of dietary carbohydrate. Fish Physiol. Biochem. 2021, 47, 1449–1465. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists, 17th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 2003. [Google Scholar]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Arnesen, P.; Krogdahl, Å. Crude and pre-extruded products of wheat as nutrient sources in extruded diets for Atlantic salmon (Salmo salar, L) grown in sea water. Aquaculture 1993, 118, 105–117. [Google Scholar] [CrossRef]
- Shi, Y.; Zhong, L.; Zhong, H.; Zhang, J.; Liu, X.; Peng, M.; Fu, G.; Hu, Y. Taurine supplements in high-carbohydrate diets increase growth performance of Monopterus albus by improving carbohydrate and lipid metabolism, reducing liver damage, and regulating intestinal microbiota. Aquaculture 2022, 554, 738150. [Google Scholar] [CrossRef]
- Singh, R.K.; Balange, A.K.; Ghughuskar, M.M. Protein sparing effect of carbohydrates in the diet of Cirrhinus mrigala (Hamilton, 1822) fry. Aquaculture 2006, 258, 680–684. [Google Scholar] [CrossRef]
- Brauge, C.; Medale, F.; Corraze, G. Effect of dietary carbohydrate levels on growth, body composition and glycaemia in rainbow trout, Oncorhynchus mykiss, reared in seawater. Aquaculture 1994, 123, 109–120. [Google Scholar] [CrossRef]
- Kamalam, B.S.; Medale, F.; Panserat, S. Utilisation of dietary carbohydrates in farmed fishes: New insights on influencing factors, biological limitations and future strategies. Aquaculture 2017, 467, 3–27. [Google Scholar] [CrossRef]
- Dong, X.; Xue, W.; Hua, J.; Hang, Y.; Sun, L.; Miao, S.; Wei, W.; Wu, X.; Du, X. Effects of dietary betaine in allogynogenetic gibel carp (Carassius auratus gibelio): Enhanced growth, reduced lipid deposition and depressed lipogenic gene expression. Aquac. Res. 2018, 49, 1967–1972. [Google Scholar] [CrossRef]
- Dong, X.; Wang, J.; Ji, P.; Gao, X.; Sun, L.; Miao, S.; Lei, Y.; Du, X.; Zhang, X. Dietary betaine supplementation promotes growth, n-3 LC-PUFA content and innate immunity in Macrobrachium rosenbergii. Aquaculture 2020, 525, 735308. [Google Scholar] [CrossRef]
- Saha, S.K.; Lee, S.B.; Won, J.; Choi, H.Y.; Kim, K.; Yang, G.M.; Abdal Dayem, A.; Cho, S.G. Correlation between oxidative stress, nutrition, and cancer initiation. Int. J. Mol. Sci. 2017, 18, 1544. [Google Scholar] [CrossRef]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef]
- Xu, C.; Liu, W.B.; Remø, S.C.; Wang, B.K.; Shi, H.J.; Zhang, L.; Liu, J.D.; Li, X.F. Feeding restriction alleviates high carbohydrate diet-induced oxidative stress and inflammation of Megalobrama amblycephala by activating the AMPK-SIRT1 pathway. Fish Shellfish Immunol. 2019, 92, 637–648. [Google Scholar] [CrossRef]
- Ma, H.J.; Mou, M.M.; Pu, D.C.; Lin, S.M.; Chen, Y.J.; Luo, L. Effect of dietary starch level on growth, metabolism enzyme and oxidative status of juvenile largemouth bass, Micropterus salmoides. Aquaculture 2019, 498, 482–487. [Google Scholar] [CrossRef]
- Zhou, C.P.; Ge, X.P.; Liu, B.; Xie, J.; Miao, L.H. Effect of high dietary carbohydrate on the growth performance and physiological responses of juvenile Wuchang Bream, Megalobrama amblycephala. Asian Australas. J. Anim. Sci. 2013, 26, 1598–1608. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Sun, R.Q.; Zeng, X.Y.; Zhou, X.; Li, S.; Jo, E.; Molero, J.C.; Ye, J.M. Restoration of autophagy alleviates hepatic ER stress and impaired insulin signalling transduction in high fructose-fed male mice. Endocrinology 2015, 156, 169–181. [Google Scholar] [CrossRef] [PubMed]
- Mukhopadhyay, S.; Panda, P.K.; Sinha, N.; Das, D.N.; Bhutia, S.K. Autophagy and apoptosis: Where do they meet? Apoptosis 2014, 19, 555–566. [Google Scholar] [CrossRef] [PubMed]
- Redza Dutordoir, M.; Averill-Bates, D.A. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta Mol. Cell Res. 2016, 1863, 2977–2992. [Google Scholar] [CrossRef] [PubMed]
- Ohoka, N.; Yoshii, S.; Hattori, T.; Onozaki, K.; Hayashi, H. TRB3, a novel ER stress-inducible gene, is induced via ATF4–CHOP pathway and is involved in cell death. EMBO J. 2005, 24, 1243–1255. [Google Scholar] [CrossRef]
- Tobiume, K.; Matsuzawa, A.; Takahashi, T.; Nishitoh, H.; Morita, K.I.; Takeda, K.; Minowa, O.; Miyazono, K.; Noda, T.; Ichijo, H. ASK1 is required for sustained activations of JNK/p38 MAP kinases and apoptosis. EMBO Rep. 2001, 2, 222–228. [Google Scholar] [CrossRef]
Ingredient (%) | Diets | |||
---|---|---|---|---|
NC | BET | HC | HC + BET | |
Fish meal | 70 | 70 | 70 | 70 |
Corn starch | 0 | 0 | 20 | 19 |
Fish oil | 3 | 3 | 3 | 3 |
Vitamin mix 1 | 2 | 2 | 2 | 2 |
Mineral mix 2 | 2 | 2 | 2 | 2 |
Microcrystalline cellulose | 20 | 19 | 0 | 0 |
Carboxymethylcellulose sodium | 3 | 3 | 3 | 3 |
Betaine 3 | 0 | 1 | 0 | 1 |
Proximate composition | ||||
Crude protein (%) | 45.08 | 45.98 | 45.48 | 45.69 |
Crude lipid (%) | 8.02 | 7.84 | 8.10 | 8.05 |
Moisture (%) | 6.30 | 6.88 | 5.30 | 8.29 |
Ash (%) | 16.11 | 15.83 | 16.09 | 15.59 |
Energy (kJ/g) | 15.66 | 15.60 | 18.96 | 18.78 |
Genes | Sequence (5′-3′) | Amplicon Size (bp) | Amplification Efficiency | Accession No. |
---|---|---|---|---|
Beta-actin (β-actin) | F: TGCGTGACATCAAGGAGAAGC | 176 | 1.92 | XM_044169301.1 |
R: GAGGAAGGAAGGCTGGAAGAG | ||||
Ribosomal protein L13a (rpl13a) | F: CACCCTATGACAAGAGGAAGC | 100 | 2.01 | MK770673 |
R: TGTGCCAGACGCCCAAG | ||||
Nuclear factor erythroid 2-related factor (nrf2) | F: ACGAAAGCGAAAGCTCCTCA | 90 | 1.89 | MT270449.1 |
R: GCTCTCTTCCAGAATGGCGT | ||||
Kelch-like ECH-associated protein 1 (keap1) | F: GTGGCAACCCAGGAGGAG | 187 | 1.82 | XM_044189604.1 |
R: GGGAATGGCAACGGACA | ||||
Glutathione reductase (gr) | F: CAGGCATCCTTTCCACCC | 178 | 2.11 | XM_044204922.1 |
R: TCCAGTCCTCTGTCCGTTTTA | ||||
Superoxide dismutase (sod) | F: CACGCTCCCTGACCTGACA | 176 | 1.83 | XM_044168059.1 |
R: GGAGGGCAACCTGTGCTG | ||||
Catalase (cat) | F: GCGTTTGGCTACTTTGAGGT | 108 | 1.82 | XM_044194118.1 |
R: CACAGTGGAGAAGCGGACA | ||||
Glutathione peroxidase (gpx) | F: GCCCATCCCCTGTTTGTG | 185 | 1.92 | XM_044172415.1 |
R: AACTTCCTGCTGTAACGCTTG | ||||
GRP78 immunoglobulin heavy chain-binding protein (bip) | F: GGCCACTAAGGATGCTGGAA | 136 | 1.84 | XM_044173053.1 |
R: ACCACCCAAATCGAACACGA | ||||
Inositol-requiring protein-1 (ire1) | F: CATACAGGTCAGTTTCTGCTACAC | 106 | 1.81 | XM_044184760.1 |
R: AAATCAACATCCCTGCCACCT | ||||
Eukaryotic translation initiation factor 2-alpha kinase 3 (perk) | F: TGCTGGAGTCATCCTACCGA | 113 | 1.83 | XM_044166231.1 |
R: CGCAGAGCAGATGTACCGAA | ||||
Activating transcription factor 6 (atf6) | F: AGATGAGTTGCTTGAGGCCC | 150 | 1.86 | XM_044198830.1 |
R: GCAGGTGACAGAGAGTCCAC | ||||
X-box-binding protein 1 (xbp1) | F: AAACAGGGTGCTTCGGGAAA | 125 | 1.9 | XM_044196969.1 |
R: CATTCCCGGTGGACAACAGA | ||||
Eukaryotic translation initiation factor 2A (eif2a) | F: CTGTGCACACCCCCTTATGT | 241 | 1.79 | XM_044178962.1 |
R: CGTGGATGGACGGGTAATGT | ||||
Activating transcription factor 4 (atf4) | F: TGCACTGGCTATTTCTGGCAA | 131 | 1.92 | XM_044187002.1 |
R: ATTTGGTCATGCTTTGGCCG | ||||
DNA-damage-inducible transcript 3 (chop) | F: AACGGTGCCTTGTCCACTTT | 122 | 1.77 | XM_044216843.1 |
R: TCCGTCAGCTCCTGTACCTT | ||||
Caspase 9 (casp9) | F: ACACAGGCTTTGAGGTGTCC | 157 | 1.81 | XM_044210980.1 |
R: AGAATGTCACATGGGGTGGG | ||||
Caspase 3 (casp3) | F: ACAGGTGCTACGCCTCATTC | 172 | 1.82 | GU178032 |
R: CCTCTGCAAGCCTGGATGAA | ||||
B-cell lymphoma-2 (bcl2) | F: CCAGAAAACATTCCACCAAAG | 148 | 1.8 | XM_044197230.1 |
R: GGGAGATGAGTAAGGAAGGGA | ||||
Bcl2-associated X protein (bax) | F: TCCTACTTTGGCACACCCAC | 108 | 2.07 | XM_044180218.1 |
R: TGTCTGCTCTTCACGAACCC | ||||
Unc-51 like kinase 1 (ulk1) | F: GTGCCTGCCCAGTTTCCC | 268 | 1.76 | XM_044195569.1 |
R: GCAGGTTCTGTTCCATACGCT | ||||
Beclin 1 (becn1) | F: AGGAGGTGAAGAGCGATAAGG | 123 | 2.06 | XM_044167873.1 |
R: CCAGGCGACGGTTGTGA | ||||
Microtubule-associated protein 1 light chain 3b (lc3b) | F: AGAGCAGCACCCCAGCAA | 182 | 1.9 | XM_044194970.1 |
R: CGTTGACCAGCAGGAAGAAA | ||||
Autophagy related 4c cysteine peptidase (atg4c) | F: TCAGCACCAGCGATTTCCC | 181 | 2.15 | XM_044200084.1 |
R: GCGGGGTATTTCTCCTTCG |
Parameter | Diets | NC vs. BET | NC vs. HC | HC vs. HC + BET | |||
---|---|---|---|---|---|---|---|
NC | BET | HC | HC + BET | ||||
IBW 1 (g) | 23.58 ± 0.02 | 23.94 ± 0.14 | 23.75 ± 0.04 | 23.68 ± 0.10 | ns | ns | ns |
FBW 2 (g) | 64.93 ± 4.71 | 87.67 ± 0.70 | 80.71 ± 3.12 | 100.43 ± 7.48 | * | ns | * |
SGR 3 (%/d) | 1.81 ± 0.13 | 2.32 ± 0.02 | 2.18 ± 0.07 | 2.57 ± 0.13 | * | * | * |
FE 4 (%) | 40.66 ± 3.37 | 48.32 ± 1.54 | 53.62 ± 3.89 | 68.33 ± 7.03 | ns | ns | ns |
FR 5 (%BW/d) | 3.02 ± 0.28 | 2.80 ± 0.08 | 2.89 ± 0.29 | 2.61 ± 0.09 | ns | ns | ns |
CF 6 (g/cm3) | 2.33 ± 0.13 | 2.52 ± 0.02 | 2.67 ± 0.07 | 2.64 ± 0.14 | ns | * | ns |
HIS 7 (%) | 1.18 ± 0.06 | 1.30 ± 0.04 | 1.27 ± 0.02 | 1.33 ± 0.13 | ns | ns | ns |
VSI 8 (%) | 8.49 ± 0.16 | 7.89 ± 0.46 | 8.36 ± 0.75 | 8.62 ± 0.62 | ns | ns | ns |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Zeng, Y.; Zheng, X.; Wang, G.; Tian, J.; Gong, W.; Xia, Y.; Zhang, K.; Li, Z.; Xie, W.; et al. Dietary Betaine Attenuates High-Carbohydrate-Diet-Induced Oxidative Stress, Endoplasmic Reticulum Stress, and Apoptosis in Mandarin Fish (Siniperca chuatsi). Antioxidants 2023, 12, 1860. https://doi.org/10.3390/antiox12101860
Li H, Zeng Y, Zheng X, Wang G, Tian J, Gong W, Xia Y, Zhang K, Li Z, Xie W, et al. Dietary Betaine Attenuates High-Carbohydrate-Diet-Induced Oxidative Stress, Endoplasmic Reticulum Stress, and Apoptosis in Mandarin Fish (Siniperca chuatsi). Antioxidants. 2023; 12(10):1860. https://doi.org/10.3390/antiox12101860
Chicago/Turabian StyleLi, Hongyan, Yanzhi Zeng, Xinyu Zheng, Guangjun Wang, Jingjing Tian, Wangbao Gong, Yun Xia, Kai Zhang, Zhifei Li, Wenping Xie, and et al. 2023. "Dietary Betaine Attenuates High-Carbohydrate-Diet-Induced Oxidative Stress, Endoplasmic Reticulum Stress, and Apoptosis in Mandarin Fish (Siniperca chuatsi)" Antioxidants 12, no. 10: 1860. https://doi.org/10.3390/antiox12101860