Next Article in Journal
Demonstration of SARS-CoV-2 Exposure in Korean Native Cattle and Korean Native Black Goats in Korea
Next Article in Special Issue
Fermented Chinese Herbs Improve the Growth and Immunity of Growing Pigs through Regulating Colon Microbiota and Metabolites
Previous Article in Journal
Impacts of Different Processes on the Nutritional and Antinutritional Contents of White and Blue Lupin Seeds and Usage Possibilities for Sustainable Poultry Production
Previous Article in Special Issue
Effect of Particle Size of Wheat and Barley Grain on the Digestibility and Fermentation of Carbohydrates in the Small and Large Intestines of Growing Pigs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 22
10.3390/ani13223497
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli

by
Zhezhe Tian
1,†,
Jiaming Chen
1,†,
Tongbin Lin
1,
Junhua Zhu
1,
Haoyang Gan
1,
Fang Chen
1,2,3,
Shihai Zhang
1,2,3,* and
Wutai Guan
1,2,3,*
1
Guangdong Province Key Laboratory of Animal Nutrition Control, College of Animal Science, South China Agricultural University, Guangzhou 510642, China
2
College of Animal Science and National Engineering Research Center for Breeding Swine Industry, South China Agricultural University, Guangzhou 510642, China
3
Guangdong Laboratory for Lingnan Modern Agriculture, South China Agricultural University, Guangzhou 510642, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2023, 13(22), 3497; https://doi.org/10.3390/ani13223497
Submission received: 25 September 2023 / Revised: 17 October 2023 / Accepted: 8 November 2023 / Published: 13 November 2023
(This article belongs to the Special Issue Swine Intestinal Physiology and Microbiota Affected by Nutrition Management)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Intestinal health is an important indicator of the healthy growth of piglets. As the agricultural industry eliminates the use of antibiotics in animal feed, alternatives to antibiotics will be needed. This study aims to evaluate the efficacy of lysozyme–cinnamaldehyde conjugates (LC) as a potential alternative to antibiotics in treating piglets infected with enterotoxigenic Escherichia coli (ETEC). The result shows that the LC-supplemented diet effectively mitigated the adverse effects of E. coli K88, including intestinal barrier damage and inflammation. Furthermore, it improved the structure of the intestinal flora, ultimately contributing to better growth performance in piglets. LC could be a useful, safe, and natural anti-inflammatory feed additive to prevent the decline in piglets’ intestinal health.

Abstract

This study aims to evaluate the efficacy of lysozyme–cinnamaldehyde conjugates (LC) as a potential alternative to antibiotics in treating piglets infected with enterotoxigenic Escherichia coli (ETEC). The results demonstrated that piglets fed with the LC diet exhibited lower rectal temperature and fecal scores at 9 h, 24 h, and 48 h post-ETEC challenge. Furthermore, LC supplementation led to significant improvements in the mechanical and immune barriers of the jejunum and ileum, as indicated by an increased villi-height-to-crypt-depth ratio (VCR) and the expression of tight junction proteins, mucin, and β-defensins. Furthermore, the LC diet lowered the levels of pro-inflammatory cytokines TNF-α and IL-1β in the plasma. Further analyses showed that the LC diet downregulated genes (specifically TLR4 and MyD88) linked to the TLRs/MyD88/NF-κB signaling pathway in the small intestine. Additionally, 16SrDNA sequencing data revealed that LC supplementation increased the α diversity of intestinal microorganisms and the relative abundance of Lactobacillus. In summary, the LC-supplemented diet effectively mitigated the adverse effects of E. coli K88, including intestinal barrier damage and inflammation. Furthermore, it improved the structure of the intestinal flora, ultimately contributing to better growth performance in piglets.

1. Introduction

Enterotoxigenic Escherichia coli (ETEC) is the primary cause of piglet post-weaning diarrhea (PPWD), a condition that results in high mortality rates. PPWD can result in decreased production performance, leading to high mortality rates [1]. Traditionally, antibiotics have been used in the diet to prevent PPWD and improve growth performance [2]. However, the overuse of antibiotics has led to the spread of drug-resistant bacteria [3,4]. Research has also shown the worldwide emergence of pathogens that are resistant to colistin and methicillin-resistant Staphylococcus aureus, posing a considerable threat to public health [5]. To address this issue, many countries have enacted laws restricting the use of antibiotics in animal feed [6]. As a result, there is an urgent need to explore alternatives to antibiotics in the form of functional feed additives.
Lysozyme, also known as N-acetyl cell wall glycan hydrolase or cell wall enzyme, is a natural anti-inflammatory, antibacterial, antiviral, and immune-enhancing agent [7]. In animal husbandry, lysozyme is a common feed additive due to its beneficial effects on growth and feed efficiency [8]. Research indicates that lysozyme supplementation significantly improves the apparent total tract digestibility of dry matter and gross energy [9], increases the villus height/crypt depth ratio [10], and reduces the serum levels of IL-1 and IL-6 in ETEC-infected weaned piglets [11]. However, the practical application of lysozyme is limited due to its instability and relatively narrow spectrum of antibacterial activity [12]. As a result, it is often combined with other antimicrobial agents to enhance its effectiveness [13].
Cinnamaldehyde, a bioactive compound found in Cinnamomum plants, is known for its distinctive aromatic odor. Pharmacological studies have demonstrated that Cinnamomum exhibits numerous beneficial activities, including antioxidant, antiviral, anti-inflammatory, antibacterial, and immunomodulatory effects [14]. Furthermore, recent research has revealed that the dietary inclusion of cinnamaldehyde effectively inhibits the NF-κB signaling pathway, thereby enhancing intestinal health in early weaned rats [15].
Lysozyme–cinnamaldehyde conjugates (LC) are formed through the reduction coupling effect of cinnamaldehyde on lysozyme. This process involves the combination of the aldehyde group in cinnamaldehyde with the amino acid residue of lysozyme, resulting in the formation of an imine bond. The conjugate has the potential to enhance the antibacterial capability of lysozyme and improve its stability. Therefore, the objective of this study was to investigate the effects of dietary LC on protecting weaning piglets challenged with ETEC, and to investigate the underlying mechanisms involved.

2. Materials and Methods

2.1. Animal Experimental Design

The animal test programs in this study strictly comply with the Protection and Use of Experimental Animals guidelines issued by the Animal Protection and Use Committee of South China Agricultural University (2022g028, Guangzhou, China). Thirty weaned piglets (Duroc × Landrace × Yorkshire, half male and half female, 24 ± 1 d, 7 ± 0.5 kg) were selected and divided into five groups based on similar body weight, with six replications in each group. The experimental groups were designed as follows: (1) basal diet (CON); (2) basic diet with ETEC (CON + ETEC); (3) basal diet with antibiotics and ETEC (50 mg/kg of quinenone, 75 mg/kg of chlortetracycline, 50 mg/kg of kitasamycin; ATB + ETEC); (4) basal diet with 0.05% LC (lysozyme/cinnamaldehyde = 1:3; Beijing Agrobeta Biotech Co., Ltd. (Beijing, China); effective content of 50,000 U/g; LC); (5) basal diet with 0.05% LC and ETEC (LC + ETEC). The basic diet formula of the experiment was prepared according to the recommendations of the National Research Council (NRC, 2012). The basal diets were mash, and the diet composition and nutrition level were shown in Table 1. Prior to the experiment, the pig house and the metabolic cage underwent thorough cleaning and disinfection using 20% concentrated glutaraldehyde. The piglets were placed in a metabolic cage, provided with free access to food and water, and the temperature was maintained at 30 ± 2 °C with a humidity level below 80%. The design of the animal experiment is shown in Figure S1.

2.2. Bacteria Preparation and Oral Challenge

Enterotoxigenic Escherichia coli (CVCC225, serotype O149: K91: K88ac; toxin LT and ST) was purchased from the China Veterinary Preservation Center. The ETEC was cultured overnight in a nutrient broth (NB, Huankai, Guangzhou, China) and subsequently diluted to a final concentration of 5 × 109 CFU/mL for the challenge piglets. After a three-day adaptation period, each group of piglets was fed with corresponding diets for seven days. On the eighth day, the CON + ETEC group, ATB + ETEC group, and LC + ETEC group were fed with 10 mL (5 × 109 CFU/mL) of the E. coli K88 solution. The CON group and LC group were fed with the same amount of liquid medium and continued to feed for seven days.

2.3. Fecal Score and Rectal Temperature

All piglets’ rectal temperatures and fecal scores were measured using an electronic rectal thermometer (Omron MC-347, Omron, Dalian, China) before and 9 h, 24 h, 48 h, 96 h, and 168 h after the challenge with ETEC according to the fecal scoring system reported by Marquardt et al. [16]. (0: normal, hard form; 1: soft feces, soft form; 2: mild diarrhea, no form, loose, puddles; 3: severe diarrhea, watery).

2.4. Production Performance

The piglets were weighed on days 0, 8, and 15, and their daily feed intake was consistently recorded throughout the trial. These measurements were used to calculate the average daily gain (ADG), average daily feed intake (ADFI), and feed conversion rate (F/G) of the piglets.

2.5. Sample Collection

Blood samples were collected from each piglet’s anterior vena cava on the morning of the 15th day of the trial period. A volume of 5 mL of blood was collected from each piglet using an EDTA anticoagulant tube. The collected blood samples were centrifuged at 1000× g for 15 min to obtain plasma samples. Simultaneously, fresh feces from all piglets were collected and stored at −80 °C in a 5 mL aseptic EP tube for testing. Well-shaped areas (2 cm) of the duodenum, jejunum, and ileum were cut off, washed with normal saline, and placed in transparent plastic bottles containing 4% paraformaldehyde at room temperature. Additionally, 2 cm tissue samples from the duodenum, jejunum, and ileum were carefully washed with normal saline. The mucous membrane was then scraped off with a glass plate and placed in a 5 mL cryopreservation tube. The samples were quickly frozen using liquid nitrogen and stored at −80 °C. It is important to note that all samples were taken from the same part of each piglet.

2.6. Measurement of Inflammatory Factor

The concentrations of IL-1β (CSB-E06782p, Jiancheng, Nanjing, China), TNF-α (CSB-E16980p, Jiancheng, Nanjing, China), IL-6 (CSB-E06786p, Jiancheng, Nanjing, China), and IL-10 (CSB-E06779p, Jiancheng, Nanjing, China) in plasma were measured using an ELISA kit. The measurements were conducted following the instructions provided by the kit manufacturer.

2.7. Intestinal Section

The fixed intestinal tissue samples were extracted from a 4% paraformaldehyde solution. They were then graded, dehydrated in a specific order, embedded, and sliced to a thickness of 5 μm. The slices were stained with hematoxylin–eosin staining solution, dehydrated, and sealed. For each sample, two slices were prepared, and three typical visual fields (40 times magnification) were selected. The height of the intestinal villi and the depth of the crypt were determined using image processing software.

2.8. Real-Time Fluorescence Quantitative PCR Detection

RNA extraction from the intestinal tissue was performed using the tissue RNA purification kit (EZB-RN001-plus, EZBioscience, Roseville, MN, USA). The concentration and quality of the extracted RNA were determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, NC, USA). The RNA was then reverse transcribed into cDNA using a reverse transcriptase kit (A0010CGQ, EZBioscience, Roseville, MN, USA). Finally, the expression of the target gene was analyzed using the 2 × Color SYBR Green qPCR Master Mix (ROX2 plus) kit (A0012-R2, EZBioscience, Roseville, MN, USA). Real-time quantitative PCR detection was carried out using the 7500 fast real-time PCR system with a reaction condition of 95 °C for 5 min. The qPCR reaction system consisted of a 20 μL volume with 9.2 μL of the cDNA and ddH2O premixture, 2× Color SYBR Green qPCR Master Mix, and primer pair premixture, and 10.8 μL for each reaction well. The amplification was performed for 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. The primer sequences we used for the real-time PCR are listed in Table 2.

2.9. Western Blotting Analysis

The level of protein expression of the tight junction proteins (Claudin-1, Occludin, and ZO-1) was measured using Western blotting. The total protein was isolated using RIPA lysate buffer (Beyotime, Shanghai, China). A total of 10 μg of protein was separated using a 10% SDS-PAGE (P0012AC, Beyotime, Shanghai, China) and transferred to a PVDF membrane for Western blotting. The membrane was then incubated with a specific antibody for 12 h at 4 °C, followed by incubation with a secondary antibody for 1 h at room temperature. Protein bands were detected using an ECL chemiluminescence reagent (P1020 ApplyGen, Beijing, China). The test antibody information is shown in Table 3.

2.10. 16S rDNA Sequencing

The intestinal microflora of the piglet feces was analyzed using a high-throughput 16s rDNA sequencing technique. The sequencing was conducted by Novogene Denovo in Guangzhou, China. Genomic DNA was extracted from the samples, and the V3 + V4 region of 16s rDNA was amplified using specific primers with a barcode. The primer sequence used was 341F: CCTACGGGNGGCWGCAGTATCTAAT. The purified amplified products were then connected to the sequencing connector, and the sequencing library was constructed and sequenced using Illumina. Finally, the 16s rDNA sequencing data were analyzed using Omicsmart, an online tool provided by Gene Denovo in Guangzhou, China.

2.11. Statistical Analysis

By using the SPSS 26.0 software (IBM Inc., Armonk, NY, USA) to analyze the one-way ANOVA variance of all data and using Duncan’s method to make multiple comparisons, the results were expressed as means ± SEM, and the statistical significance standard was p < 0.05, It was considered as a trend when 0.05 < p < 0.10. Graphs were drawn and analyzed using the GraphPad Prism 8.0 software.

3. Results

3.1. Production Performance, Fecal Scores, and Rectal Temperature

As illustrated in Table 4, the CON + ETEC group showed a significant decrease in average daily gain (ADG) and an increase in the feed-to-gain ratio (F/G) when compared to the CON group (p < 0.05). No significant difference was observed among the other groups. As depicted in Figure 1A, the fecal score of the CON + ETEC group rose significantly at 9 h, 24 h, 48 h, and 96 h post-challenge in comparison to the CON group (p < 0.05). At 24 h post-challenge, piglets in the ATB + ETEC, LC + ETEC, and LC treatments had lower fecal scores compared with those from the CON + ETEC (p < 0.05) (Figure 1A). Furthermore, Figure 1B indicates that the rectal temperature of the CON + ETEC group significantly increased at 9 h, 24 h, and 48 h post-challenge relative to the CON group (p < 0.05). Compared with the CON + ETEC group, the rectal temperature of the ATB + ETEC group and LC + ETEC group decreased significantly at 24 h after the challenge (p < 0.05) (Figure 1B). And there was no significant change between the LC + ETEC group and the ATB + ETEC group.

3.2. Inflammatory Cytokines

As depicted in Figure 2, compared to the CON group, the plasma levels of TNF-α, IL-1β, and IL-6 in the CON + ETEC group increased significantly post-challenge (p < 0.05). Conversely, no significant changes were observed in the ATB + ETEC group or LC + ETEC group. Importantly, Figure 2D indicates that the TNF-α levels in the LC group decreased significantly relative to other groups (p < 0.05).

3.3. Gut Morphology

Intestinal morphology was examined using H&E staining in the weaned piglets (Figure 3A). Compared to the CON group, the depth of the duodenal recess increased in the CON + ETEC group, while the villus height of the jejunum and ileum, as well as the VCR of each intestinal segment, decreased significantly (p < 0.05) (Figure 3B–D). Additionally, the duodenal VCR increased significantly in the ATB + ETEC group compared to the CON + ETEC group (p < 0.05) (Figure 3D). And the duodenal VCR of the LC + ETEC group showed an upward trend compared to the CON + ETEC group (p = 0.061) (Figure 3D). Furthermore, the jejunum and ileum VCR increased significantly in both the ATB + ETEC group and the LC + ETEC group (p < 0.05) (Figure 3D).

3.4. Intestinal Tight Junctions

Similarly, the CON + ETEC group showed a significant decrease in tight junctions across all intestinal segments compared to the CON group (p < 0.05) (Figure 4A–F). Notably, the supplementation of LC into the diet led to an increase in Occludin expression throughout the intestinal tract relative to the CON treatment (p < 0.05) (Figure 4A–F). In addition, the protein expressions of Occludin, Claudin-1, and ZO-1 in the duodenum, Occludin and Claudin-1 in the jejunum, and Occludin in the ileum were significantly higher in the ATB + ETEC and LC + ETEC groups compared to the CON + ETEC group (p < 0.05) (Figure 4A–F). And there were no significant differences in intestinal tight junction protein expression between the ATB + ETEC and the LC + ETEC groups. Full original Western blot (WB) images of Figure 4 are shown in Figure S2.

3.5. Mucin and β-Defensin

Compared to the CON group, the CON + ETEC group exhibited a significant reduction in the expression levels of pBD2 in the duodenum, as well as MUC-1, MUC-2, pBD1, and pBD2 in the jejunum, and MUC-2, pBD1, pBD2, and pBD3 mRNA in the ileum (p < 0.05) (Figure 5A–F). In contrast, the ATB + ETEC and LC + ETEC groups showed no significant down-regulation in the expression of mucin and β-defensin genes (Figure 5A–F). Furthermore, the LC group displayed a marked increase in the mRNA expression levels of pBD2 in the jejunum, as well as MUC-2, pBD1, and pBD2 in the ileum, when compared to the CON group (p < 0.05) (Figure 5E,F).

3.6. Abundance of Genes Related to NF-κB/MAPK Signal Pathway

As illustrated in Figure 6, the CON + ETEC group showed a significant up-regulation in the mRNA expression of TLR4 and MyD88 in the duodenum, jejunum, and ileum when compared with the CON group (p < 0.05) (Figure 6A–C). Furthermore, the mRNA expression of IKKα and TAK1 in the duodenum, TAK1 in the jejunum, and TRAF6 in the ileum were also significantly up-regulated in the CON + ETEC group (p < 0.05) (Figure 6A–C). In contrast, the ATB + ETEC and LC + ETEC groups did not display a significant increase in the expression of NF-κB pathway-related genes. However, the mRNA expression of SIGTRR was significantly up-regulated (p < 0.05) in both of these groups (Figure 6A–C). Simultaneously, the LC group showed a significant down-regulation in the mRNA levels of TLR4, IκB, and TRAF6 in the duodenum, as well as TLR4 and TAK1 in the jejunum, and MyD88, TAK1, and TRAF6 in the ileum (p < 0.05) (Figure 6A–C). No significant difference in gene expression was observed between the ATB + ETEC and LC + ETEC groups.

3.7. Gut Microbiome

A total of 3,672,934 high-quality sequences were generated from 30 fecal samples (five treatments; n = 6); with an average of 122,431 sequences per sample. After removing the noise sequence, 2,956,668 valid tags remained for further analysis. These tags were clustered into operational taxons (OTUs) with 97% sequence similarity. These OTUs were then classified to 22 phyla; 29 classes; 47 orders; 68 families; 170 genera; and 1395 OTUs (97% similarity) for further analysis. The alpha diversity of the ileal microbiota, as indicated by Sob, Chao1, ACE, Shannon, Simpson, and Pielou, is presented in Figure 7A–F. Notably, the CON + ETEC treatment group showed a significant reduction in Chao1 and ACE indices compared to the other groups (p < 0.05). Furthermore, no significant differences were found in the beta diversity of ileal microbiota among the treatment groups (Figure 7G,H). The microbial composition of the piglets’ ileal contents predominantly consisted of five major bacterial phyla—Firmicutes; Bacteroidetes; Proteobacteria; Cyanobacteria; and Epsilonbacteraeota—which collectively made up over 95% of the total ileal bacterial community (Figure 8A). However; the proportions of these phyla varied among the different treatments. At the genus level, the relative abundance of Lactobacillus in piglets was observed to decrease following the ETEC challenge. Conversely, piglets supplemented with LC and ATB exhibited an increase in Lactobacillus abundance (p < 0.05) (Figure 8B).

4. Discussion

ETEC is a major contributor to diarrhea and intestinal injury in weaned piglets, as mentioned in previous studies [17]. Specifically, the heat instability (LT) and heat-stable (ST) enterotoxins produced by ETEC increase the levels of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP). This leads to an increased secretion of water and electrolytes into the intestinal cavity, culminating in diarrhea in piglets [18]. In this study, we observed a significant rise in both rectal temperature and fecal score in piglets 9 h post-ETEC challenge, followed by a gradual decline. These observations highlight the successful establishment of the ETEC challenge model.
The present study demonstrates that piglets in the dietary LC group displayed lower rectal temperatures and fecal scores, mimicking the beneficial effects observed in the ATB group. These results suggest that LC effectively mitigates ETEC-induced diarrhea in piglets. Previous studies have shown that cinnamaldehyde and lysozyme are known to exert potent bactericidal effects against both Gram-negative and Gram-positive bacteria [19]. Additionally, lysozyme–ZnO nanoparticle coupling [20] and cinnamaldehyde [21] have been found to possess significant antibacterial properties against E. coli. These findings strongly suggest that LC has the capacity to inhibit E. coli colonization in the intestinal tract. Furthermore, it was observed that the feed-to-gain ratio (F/G) of piglets significantly increased after the challenge, but LC was able to effectively alleviate this result. There is growing evidence that the improvement in the F/G in piglets by LC is closely related to their intestinal health. Garas observed that feeding goat milk rich in lysozyme to pigs infected with ETEC F4 can reduce the incidence of diarrhea and improve their production performance [22].
To investigate the impact of LC on the intestinal health of piglets, we initially assessed the intestinal morphology across all treatment groups. The investigation revealed that different intestinal segments suffered varying degrees of damage after the ETEC challenge, with the jejunum and ileum exhibiting more severe damage. This could be attributed to the fact that ETEC primarily colonizes the posterior intestinal segment [23]. Both LC and ATB were found to effectively alleviate the damage caused by ETEC. As previous research mentioned, lysozyme has been identified as a viable alternative to antibiotics for improving small intestine morphology in pigs, which aligns with the results of our study. Notably, our results suggest an even greater protective effect provided by lysozyme when modified with cinnamaldehyde. It is important to note that intestinal morphology serves as the foundation for intestinal structure and function. Any damage to it not only leads to reduced nutrient absorption in piglets but also serves as an indicator of inflammation and impairment of the intestinal barrier [24].
In this study, we observed a marked down-regulation in the protein expression levels of Occludin, Claudin-1, and ZO-1, as well as in the mRNA expression levels of mucin and defensin genes, in various intestinal segments of ETEC-challenged piglets. Importantly, supplementation with LC mitigated these adverse effects. Several studies have also demonstrated the beneficial effects of lysozyme and cinnamaldehyde in improving the function of the intestinal physical barrier in weaned piglets. For example, Huang et al. reported that human lysozyme positively influenced intestinal morphology and preserved the integrity of tight junctions, especially in the jejunum and ileum [13]. Similarly, Mo demonstrated that daily supplementation with microencapsulated compounds of thymol, carvol, and cinnamaldehyde improved tight junction protein mRNA expression and thereby enhanced intestinal barrier function in weaned piglets [25]. Consistent with these studies, our results also show that LC significantly increased the mRNA expression of pBD-2 in the duodenum, jejunum, and ileum of piglets. pBD-2 possesses a broad antibacterial spectrum that is effective against E. coli, Salmonella typhimurium, and Staphylococcus aureus. Additionally, the expression of pBD-2 contributes to elevating the levels of intestinal tight junction proteins and mucin genes or proteins [26].
In order to further clarify the molecular mechanisms underlying LC’s mitigating effects on intestinal inflammation, we examined the TLRs/MyD88/NF-κB signal pathway [27], a classical inflammatory cascade. We also assessed its negative regulatory factors, specifically the Toll-interacting protein and Single Ig IL-1-related receptor (TOLLIP and SIGIRR) [28]. The activation of the TLRs pathway is known to be linked to multi-layered inflammatory intestinal diseases [29]. Our study observed a significant increase in the levels of IL-1β and TNF-α in plasma, as well as the expression of certain genes related to the TLRs/MyD88/NF-κB inflammatory pathway, and the mRNA expression of SIGIRR in the small intestine after the challenge. However, in piglets supplemented with either ATB or LC, these inflammatory pathway genes remained largely unaltered. These observations indicate LC’s potential in attenuating intestinal inflammation.
It is widely recognized that the intestinal tracts of animals contain a high density and diverse range of microorganisms [30]. These microorganisms play a crucial role in various aspects such as intestinal development, immune defense, and the maintenance of the intestinal mucosal barrier. These microbial communities substantially shape the production performance and intestinal well-being of weaned piglets [31]. In this study, the analysis of 16S rDNA sequencing revealed a significant decrease in fecal microbial alpha diversity in piglets infected with ETEC. In contrast, no such shift was detected in the microbial diversity of piglets subjected to diets enriched with LC and ATB. This suggests that dietary LC potentially mirrors the microbial diversity-protective effect of antibiotics. Crucially, we identified a decrease in the relative abundance of Lactobacillus in piglets after the ETEC challenge, but this increased in those supplemented with LC and ATB. Lactobacillus, which constitutes the largest number of beneficial bacteria in the intestine, plays a crucial role in fermenting carbohydrates to produce lactic acid. This helps to reduce the intestinal pH and effectively prevent the reproduction of harmful bacteria [32]. Previous research has also shown that Lactobacillus can fine-tune the composition of gut flora [33], boost the expression of intestinal tight junction proteins and mucins [34,35], modulate the intestinal immune responses [36], and trigger the expression of pBD [37]. These findings Fprovide significant evidence that LC not only decreases intestinal inflammation but also fortifies the intestinal barrier function.

5. Conclusions

Dietary LC could alleviate the inflammatory reaction and intestinal villus damage caused by E. coli K88 in weaned piglets. These benefits are conferred through multiple mechanisms, including the inhibition of the NF-κB signaling pathway, the upregulation of β-defensin gene expression, and the enhancement of the structure and growth performance of the intestinal microbiota. These findings strongly suggest that LC could enhance the growth performance and intestinal health of weaned piglets and serve as an effective alternative to antibiotics in the future.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/2076-2615/13/22/3497/s1, Figure S1. The animal experiment design. Figure S2. Full original Western blot (WB) images.

Author Contributions

S.Z., F.C. and W.G. conceived and designed the experiments. Z.T., T.L. and J.C. participated in the animal experiment. Z.T., J.C., J.Z. and H.G. analyzed the data and conducted the research. Z.T. and J.C. discussed the results and wrote the paper. S.Z. and W.G. conducted the final editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key R&D Program of China (No. 2021YFD1300700), the Guangdong Basic and Applied Basic Research Foundation (No. 2021A1515010440), the Science and Technology Program of Guangzhou (No. 202102020056), the National Natural Science Foundation of China (Nos. 31802067 and 31872364), and project of Swine Innovation Team in Guangdong Modern Agricultural Research System (No. 2023KJ126).

Institutional Review Board Statement

This study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of South China Agricultural University.

Informed Consent Statement

Not Applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials; The datasets generated for this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

Correction Statement

This article has been republished with a minor correction to resolve spelling errors. In "2.1. Animal Experimental Design" section, "Amber Technology" is not correct and it should be "Agrobeta Biotech". This change does not affect the scientific content of the article.

References

  1. Gan, Z.; Wei, W.; Li, Y.; Wu, J.; Zhao, Y.; Zhang, L.; Wang, T.; Zhong, X. Curcumin and Resveratrol Regulate Intestinal Bacteria and Alleviate Intestinal Inflammation in Weaned Piglets. Molecules 2019, 24, 1220. [Google Scholar] [CrossRef]
  2. Zhang, R.; Huang, G.; Ren, Y.; Wang, H.; Ye, Y.; Guo, J.; Wang, M.; Zhu, W.; Yu, K. Effects of Dietary Indole-3-carboxaldehyde Supplementation on Growth Performance, Intestinal Epithelial Function, and Intestinal Microbial Composition in Weaned Piglets. Front. Nutr. 2022, 9, 896815. [Google Scholar] [CrossRef] [PubMed]
  3. Liu, N.; Ma, X.; Jiang, X. Effects of Immobilized Antimicrobial Peptides on Growth Performance, Serum Biochemical Index, Inflammatory Factors, Intestinal Morphology, and Microbial Community in Weaning Pigs. Front. Immunol. 2022, 13, 872990. [Google Scholar] [CrossRef]
  4. Xu, L.; Wan, F.; Fu, H.; Tang, B.; Ruan, Z.; Xiao, Y.; Luo, Q. Emergence of Colistin Resistance Gene mcr-10 in Enterobacterales Isolates Recovered from Fecal Samples of Chickens, Slaughterhouse Workers, and a Nearby Resident. Microbiol. Spectr. 2022, 10, 599. [Google Scholar] [CrossRef]
  5. Morris, D.O.; Loeffler, A.; Davis, M.F.; Guardabassi, L.; Weese, J.S. Recommendations for approaches to meticillin-resistant staphylococcal infections of small animals: Diagnosis, therapeutic considerations and preventative measures. Vet. Dermatol. 2017, 28, 304. [Google Scholar] [CrossRef] [PubMed]
  6. Huo, Y.; Liu, Z.; Xuan, H.; Lu, C.; Yu, L.; Bao, W.; Zhao, G. Effects of bamboo vinegar powder on growth performance and mRNA expression levels of interleukin-10, interleukin-22, and interleukin-25 in immune organs of weaned piglets. Anim. Nutr. 2016, 2, 111–118. [Google Scholar] [CrossRef]
  7. Callewaert, L.; Michiels, C.W. Lysozymes in the animal kingdom. J. Biosci. 2010, 35, 127–160. [Google Scholar] [CrossRef] [PubMed]
  8. Oliver, W.T.; Wells, J.E. Lysozyme as an alternative to growth promoting antibiotics in swine production. J. Anim. Sci. Biotechnol. 2015, 6, 35. [Google Scholar] [CrossRef]
  9. Park, J.H.; Sureshkumar, S.; Kim, I.H. Effects of dietary lysozyme supplementation on growth performance, nutrient digestibility, intestinal microbiota, and blood profiles of weanling pigs challenged with Escherichia coli. J. Anim. Sci. Technol. 2021, 63, 501–509. [Google Scholar] [CrossRef]
  10. Long, Y.; Lin, S.; Zhu, J.; Pang, X.; Fang, Z.; Lin, Y.; Che, L.; Xu, S.; Li, J.; Huang, Y.; et al. Effects of dietary lysozyme levels on growth performance, intestinal morphology, non-specific immunity and mRNA expression in weanling piglets. Anim. Sci. J. 2016, 87, 411–418. [Google Scholar] [CrossRef]
  11. Deng, B.; Pan, H.; Wu, J.; Hua, W.; Li, Y.; Pan, H.; Xu, Z. Effects of dietary lysozyme on immune response and fecal microflora in both sows and their offspring. Rev. Bras. Zootec. 2021, 50. [Google Scholar] [CrossRef]
  12. Wu, T.; Huang, J.; Jiang, Y.; Hu, Y.; Ye, X.; Liu, D.; Chen, J. Formation of hydrogels based on chitosan/alginate for the delivery of lysozyme and their antibacterial activity. Food Chem. 2018, 240, 361–369. [Google Scholar] [CrossRef] [PubMed]
  13. Huang, G.; Li, X.; Lu, D.; Liu, S.; Suo, X.; Li, Q.; Li, N. Lysozyme improves gut performance and protects against enterotoxigenic Escherichia coli infection in neonatal piglets. Vet. Res. 2018, 49, 20. [Google Scholar] [CrossRef] [PubMed]
  14. Fedyn, J.; Piska, K.; Gunia-Krzyżak, A.; Pękala, E. Animal Enterotoxigenic Escherichia coli. Farm Policy 2020, 7, 619–627. [Google Scholar]
  15. Qi, L.; Mao, H.; Lu, X.; Shi, T.; Wang, J. Cinnamaldehyde Promotes the Intestinal Barrier Functions and Reshapes Gut Microbiome in Early Weaned Rats. Front. Nutr. 2021, 8, 748503. [Google Scholar] [CrossRef] [PubMed]
  16. Marquardt, R.R.; Jin, L.Z.; Kim, J.W.; Fang, L.; Frohlich, A.A.; Baidoo, S.K. Passive protective effect of egg-yolk antibodies against enterotoxigenic Escherichia coli K88+ infection in neonatal and early-weaned piglets. Fems. Immunol. Med. Microbiol. 1999, 4, 283–288. [Google Scholar] [CrossRef]
  17. Rodas, C.; Mamani, R.; Blanco, J.; Blanco, J.E.; Wiklund, G.; Svennerholm, A.-M.; Sjöling, A.; Iniguez, V. Enterotoxins, colonization factors, serotypes and antimicrobial resistance of enterotoxigenic Escherichia coli (ETEC) strains isolated from hospitalized children with diarrhea in Bolivia. Braz. J. Infect. Dis. 2011, 15, 132–137. [Google Scholar]
  18. Zhang, Y.; Tan, P.; Zhao, Y.; Ma, X. Enterotoxigenic Escherichia coli: Intestinal pathogenesis mechanisms and colonization resistance by gut microbiota. Gut Microbes 2022, 14, 2055943. [Google Scholar] [CrossRef]
  19. Valenta, C.; Bernkop-Schnürch, A.; Schwartz, M. Modification of lysozyme with cinnamaldehyde: A strategy for constructing novel preservatives for dermatics. Int. J. Pharm. 1997, 148, 131–137. [Google Scholar] [CrossRef]
  20. Tripathy, N.; Ahmad, R.; Bang, S.H.; Min, J.; Hahn, Y. Tailored lysozyme–ZnO nanoparticle conjugates as nanoantibiotics. Chem. Commun. 2014, 50, 9298–9301. [Google Scholar] [CrossRef]
  21. Shen, S.; Zhang, T.; Yuan, Y.; Lin, S.; Xu, J.; Ye, H. Effects of cinnamaldehyde on Escherichia coli and Staphylococcus aureus membrane. Food Control 2015, 47, 196–202. [Google Scholar] [CrossRef]
  22. Garas, L.C.; Cooper, C.A.; Dawson, M.W.; Wang, J.; Murray, J.D.; Maga, E.A. Young Pigs Consuming Lysozyme Transgenic Goat Milk Are Protected from Clinical Symptoms of Enterotoxigenic Escherichia coli Infection. J. Nutr. 2017, 147, 2050–2059. [Google Scholar] [CrossRef] [PubMed]
  23. Zhou, Y.; Luo, Y.; Yu, B.; Zheng, P.; Yu, J.; Huang, Z.; Mao, X.; Luo, J.; Yan, H.; He, J. Agrobacterium sp. ZX09 β-Glucan Attenuates Enterotoxigenic Escherichia coli-Induced Disruption of Intestinal Epithelium in Weaned Pigs. Int. J. Mol. Sci. 2022, 23, 10290. [Google Scholar] [CrossRef]
  24. Boudry, G.L.; Ron, V.P.; Le Hue Rou-Luron, I.; Lallès, J.P.; Sève, B. Weaning Induces Both Transient and Long-Lasting Modifications of Absorptive, Secretory, and Barrier Properties of Piglet Intestine. J. Nutr. 2004, 134, 2256–2262. [Google Scholar] [CrossRef]
  25. Mo, K.; Yu, W.; Li, J.; Zhang, Y.; Xu, Y.; Huang, X.; Ni, H. Dietary supplementation with a microencapsulated complex of thymol, carvacrol, and cinnamaldehyde improves intestinal barrier function in weaning piglets. J. Sci. Food Agr. 2023, 103, 1994–2003. [Google Scholar] [CrossRef]
  26. Han, F.; Zhang, H.; Xia, X.; Xiong, H.; Song, D.; Zong, A.Y.W.X. Porcine β-Defensin 2 Attenuates Inammation and Mucosal Lesions in Dextran Sodium Sulfate—Induced Colitis. J. Immunol. 2015, 194, 1882–1893. [Google Scholar] [CrossRef]
  27. Al-Sayeqh, A.F.; Loughlin, M.F.; Dillon, E.; Mellits, K.H.; Connerton, I.F. Campylobacter jejuni activates NF-κB independently of TLR2, TLR4, Nod1 and Nod2 receptors. Microb. Pathog. 2010, 49, 294–304. [Google Scholar] [CrossRef] [PubMed]
  28. Wu, W.; Wang, Y.; Zou, J.; Long, F.; Yan, H.; Zeng, L.; Chen, Y. Bifidobacterium adolescentis protects against necrotizing enterocolitis and upregulates TOLLIP and SIGIRR in premature neonatal rats. BMC Pediatr. 2017, 17, 1. [Google Scholar] [CrossRef]
  29. Lorenz, I.; Vogt, S. Investigations on the Association of D-lactate Blood Concentrations with the Outcome of Therapy of Acidosis, and with Posture and Demeanour in Young Calves with Diarrhoea. J. Vet. Med. Ser. A 2006, 53, 490–494. [Google Scholar] [CrossRef]
  30. Tamburini, S.; Shen, N.; Wu, H.C.; Clemente, J.C. The microbiome in early life: Implications for health outcomes. Nat. Med. 2016, 22, 713–722. [Google Scholar] [CrossRef]
  31. Wang, T.; Yao, W.; Li, J.; Shao, Y.; He, Q.; Xia, J.; Huang, F. Dietary garcinol supplementation improves diarrhea and intestinal barrier function associated with its modulation of gut microbiota in weaned piglets. J. Anim. Sci. Biotechnol. 2020, 11, 12. [Google Scholar] [CrossRef] [PubMed]
  32. Tan, F.H.P.; Liu, G.; Lau, S.Y.A.; Jaafar, M.H.; Park, Y.-H.; Azzam, G.; Li, Y.; Liong, M.-T. Lactobacillus probiotics improved the gut microbiota profile of a Drosophila melanogaster Alzheimer’s disease model and alleviated neurodegeneration in the eye. Benef. Microbes 2020, 11, 79–89. [Google Scholar] [CrossRef] [PubMed]
  33. Toscano, M.; De Grandi, R.; Miniello, V.L.; Mattina, R.; Drago, L. Ability of Lactobacillus kefiri LKF01 (DSM32079) to colonize the intestinal environment and modify the gut microbiota composition of healthy individuals. Digest Liver Dis. 2017, 49, 261–267. [Google Scholar] [CrossRef]
  34. Anderson, R.C.; Cookson, A.L.; McNabb, W.C.; Park, Z.; McCann, M.J.; Kelly, W.J.; Roy, N.C. Lactobacillus plantarum MB452 enhances the function of the intestinal barrier by increasing the expression levels of genes involved in tight junction formation. Bmc. Microbiol. 2010, 10, 316. [Google Scholar] [CrossRef]
  35. Cario, E.; Gerken, G.; Podolsky, D.K. Toll-like receptor 2 enhances ZO-1-associated intestinal epithelial barrier integrity via protein kinase C. Gastroenterology 2004, 127, 224–238. [Google Scholar] [CrossRef] [PubMed]
  36. Foysal, M.J.; Fotedar, R.; Siddik, M.; Tay, A. Lactobacillus acidophilus and L. plantarum improve health status, modulate gut microbiota and innate immune response of marron (Cherax cainii). Sci. Rep. 2020, 10, 5916. [Google Scholar] [CrossRef]
  37. Liu, H.; Hou, C.; Wang, G.; Jia, H.; Yu, H.; Zeng, X.; Thacker, P.A.; Zhang, G.; Qiao, S. Lactobacillus reuteri I5007 Modulates Intestinal Host Defense Peptide Expression in the Model of IPEC-J2 Cells and Neonatal Piglets. Nutrients 2017, 9, 559. [Google Scholar] [CrossRef]
Animals 13 03497 g001
Figure 1. Effects of dietary LC on the fecal scores and rectal temperature in ETEC-challenged piglets. (A) The fecal scores were evaluated at 0 h, 9 h, 24 h, 48 h, 96 h, and 168 h after challenge with ETEC according to the fecal scoring system reported by Marquardt et al. (0: normal, hard form; 1: soft feces, soft form; 2: mild diarrhea, no form, loose, puddles; 3: severe diarrhea, watery). (B) Rectal temperatures were measured using an electronic rectal thermometer (Omron MC-347) at 0 h, 9 h, 24 h, 48 h, 96 h, and 168 h in ETEC-challenged piglets. Data are expressed as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Figure 1. Effects of dietary LC on the fecal scores and rectal temperature in ETEC-challenged piglets. (A) The fecal scores were evaluated at 0 h, 9 h, 24 h, 48 h, 96 h, and 168 h after challenge with ETEC according to the fecal scoring system reported by Marquardt et al. (0: normal, hard form; 1: soft feces, soft form; 2: mild diarrhea, no form, loose, puddles; 3: severe diarrhea, watery). (B) Rectal temperatures were measured using an electronic rectal thermometer (Omron MC-347) at 0 h, 9 h, 24 h, 48 h, 96 h, and 168 h in ETEC-challenged piglets. Data are expressed as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Animals 13 03497 g001
Animals 13 03497 g002
Figure 2. Effects of dietary LC on plasma inflammatory factors in ETEC-challenged piglets. Concentrations of IL-10 (A), IL-6 (B), TNF-α (C), and IL-1β (D) were assessed. Data are expressed as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Figure 2. Effects of dietary LC on plasma inflammatory factors in ETEC-challenged piglets. Concentrations of IL-10 (A), IL-6 (B), TNF-α (C), and IL-1β (D) were assessed. Data are expressed as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Animals 13 03497 g002
Animals 13 03497 g003
Figure 3. Effects of dietary LC supplementation on the intestinal morphology in ETEC-challenged piglets. (A) The hematoxylin and eosin (H&E)-stained intestinal cross-sections in piglets are shown. The scale bar represents 100 μm. (B) Villi height, (C) crypt depth, (D) ratio of villous height to crypt depth (VCR). Data are expressed as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Figure 3. Effects of dietary LC supplementation on the intestinal morphology in ETEC-challenged piglets. (A) The hematoxylin and eosin (H&E)-stained intestinal cross-sections in piglets are shown. The scale bar represents 100 μm. (B) Villi height, (C) crypt depth, (D) ratio of villous height to crypt depth (VCR). Data are expressed as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Animals 13 03497 g003
Animals 13 03497 g004
Figure 4. Effects of dietary LC supplementation on the expression of intestinal tight junction proteins in ETEC-challenged piglets. The expression and abundance of tight junction proteins (Occludin, Claudin-1, and ZO-1) and β-actin in the duodenum (A,B), jejunum (C,D), and ileum (E,F) of piglets were analyzed. Data are expressed as the mean ± SE (n = 3). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Figure 4. Effects of dietary LC supplementation on the expression of intestinal tight junction proteins in ETEC-challenged piglets. The expression and abundance of tight junction proteins (Occludin, Claudin-1, and ZO-1) and β-actin in the duodenum (A,B), jejunum (C,D), and ileum (E,F) of piglets were analyzed. Data are expressed as the mean ± SE (n = 3). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05).
Animals 13 03497 g004
Animals 13 03497 g005
Figure 5. Effects of dietary LC supplementation on mRNA expression levels of mucin and β-defensin of piglets challenged with ETEC. The mRNA expression levels of mucin in the duodenum are presented in (A), while the expression levels of β-defensin are shown in (B). Similarly, (C) represents the expression of mucin mRNA in the jejunum, and (D) represents β-defensin expression. Additionally, (E,F) display the expression levels of mucin and β-defensin mRNA in the ileum. The data is presented as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05). MUC, mucin; pBD, porcine beta-defensin.
Figure 5. Effects of dietary LC supplementation on mRNA expression levels of mucin and β-defensin of piglets challenged with ETEC. The mRNA expression levels of mucin in the duodenum are presented in (A), while the expression levels of β-defensin are shown in (B). Similarly, (C) represents the expression of mucin mRNA in the jejunum, and (D) represents β-defensin expression. Additionally, (E,F) display the expression levels of mucin and β-defensin mRNA in the ileum. The data is presented as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05). MUC, mucin; pBD, porcine beta-defensin.
Animals 13 03497 g005
Animals 13 03497 g006
Figure 6. Effects of dietary LC supplementation on the concentration of relative mRNA expression of genes related to inflammation in ETEC-challenged piglets. (A) Duodenum, (B) jejunum, (C) ileum. The data are presented as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05). TLR4, Toll-like receptor 4; NF-κB, nuclear factor kappa B; MyD88, myeloid differentiation factor 88; IKKα, inhibitor of NF-κB kinase α; IKKβ, inhibitor of NF-κB kinase β; TAK1, transforming growth factor β (TGF-β)-activated kinase 1; TRAF6, TNF receptor-associated factor 6; SIGTRR, Single Ig IL-1-related receptor; TOLLP, Toll-interacting protein.
Figure 6. Effects of dietary LC supplementation on the concentration of relative mRNA expression of genes related to inflammation in ETEC-challenged piglets. (A) Duodenum, (B) jejunum, (C) ileum. The data are presented as the mean ± SE (n = 6). Different letters (a, b, and c) indicate a significant difference among the different groups (p < 0.05). TLR4, Toll-like receptor 4; NF-κB, nuclear factor kappa B; MyD88, myeloid differentiation factor 88; IKKα, inhibitor of NF-κB kinase α; IKKβ, inhibitor of NF-κB kinase β; TAK1, transforming growth factor β (TGF-β)-activated kinase 1; TRAF6, TNF receptor-associated factor 6; SIGTRR, Single Ig IL-1-related receptor; TOLLP, Toll-interacting protein.
Animals 13 03497 g006
Animals 13 03497 g007
Figure 7. Effects of dietary on alpha diversity and beta diversity of ileal microbiota in ETEC−challenged piglets. (A–F) Alpha diversity index: Sob, Chao1, ACE, Shannon, Simpson, and Pielou. (G) Principal coordinates analysis based on Bray−Curtis distance. (H) Plot of NMDS analysis of Bray. Data are expressed as the mean ± SE (n = 6). Different letters (a, and b indicate a significant difference among the different groups (p < 0.05).
Figure 7. Effects of dietary on alpha diversity and beta diversity of ileal microbiota in ETEC−challenged piglets. (A–F) Alpha diversity index: Sob, Chao1, ACE, Shannon, Simpson, and Pielou. (G) Principal coordinates analysis based on Bray−Curtis distance. (H) Plot of NMDS analysis of Bray. Data are expressed as the mean ± SE (n = 6). Different letters (a, and b indicate a significant difference among the different groups (p < 0.05).
Animals 13 03497 g007
Animals 13 03497 g008
Figure 8. Effects of dietary LC supplementation on the microbial composition of ileal microbiota in ETEC-challenged Piglets. (A) Relative abundance in genus. (B) Relative abundance in species. Data are expressed as the mean ± SE (n = 6).
Figure 8. Effects of dietary LC supplementation on the microbial composition of ileal microbiota in ETEC-challenged Piglets. (A) Relative abundance in genus. (B) Relative abundance in species. Data are expressed as the mean ± SE (n = 6).
Animals 13 03497 g008
Table 1. Compositions of basal diet and nutrient profile.
Table 1. Compositions of basal diet and nutrient profile.
Ingredient CompositionContent (%)Calculated Nutrient Profile bContent
corn (7.4%, CP)22.16Digestible energy (MJ/kg)14.83
broken rice (7.6%, CP)31.09Crude protein (%) c17.98
soybean meal (43%, CP)16.0Crude fat (%) c5.18
extruded soybean (35%, CP)3.00Dry matter (%) c89.51
fermented soybean (50%, CP)5.00Crude fiber (%) c2.17
Peruvian fish meal (65%, CP)3.50Ash (%) c5.55
whey (3%, CP)7.50Calcium (%) c0.80
glucose1.25Phosphorus (%) c0.68
sucrose3.50Available phosphorus (%) c0.48
soybean oil2.60Lysine (%) c1.39
calcium hydrophosphate1.20Digestible lysine (%) c1.25
acidifier0.20Digestible methionine + Cystine (%) c0.69
limestone0.60Digestible threonine (%) c0.74
salt0.30Digestible tryptophan (%) c0.21
zinc oxide (78%, Zn)0.20
choline chloride (50%)0.10
L-lysine HCl (98.5%)0.25
DL-methionine (99%)0.28
L-threonine (98.5%)0.22
L-tryptophan (98.5%)0.05
premix a1.00
a Supplied per kilogram of diet: 12,000 IU of vitamin A, 3500 IU of vitamin D3, 40 IU of vitamin E, 3.5 mg of vitamin K3, 18 mg of vitamin B, 10 mg of vitamin B2, 12.8 mg of vitamin B6, 0.034 mg of vitamin B12, 60 mg of nicotinic acid, 25 mg of D-pantothenic acid, 2.0 mg of folic acid, 0.26 mg of D-biotin, 180 mg of iron, 75.0 mg of copper, 1500 mg of zinc, 50.0 mg of manganese, 0.64 mg of iodine, and 0.3 mg of Selenium. b Calculated nutrient profiles were the calculated values. c Analyzed values.
Table 2. Primers used for q-PCR analysis.
Table 2. Primers used for q-PCR analysis.
GenesAccessionDirectionSequences (5′–3′)
TLR4NM_001113039.1ForwardGCCATCGCTGCTAACATCATC
ReverseCTCATACTCAAAGATACACCATCGG
MyD88NM_001099923.1Forward
Reverse		TGGTAGTGGTTGTCTCTGATGA
TGGAGAGAGGCTGAGTGCAA
IKKαNM_001114279.1Forward
Reverse		TCTTGATCCTCGGAAACCAG
TGCTTCGGCCCATACTTTAC
IKKβNM_001099935.1Forward
Reverse		CCTCACCTTGCTGAGTGACA
TCCCCACAAAGGAGGTACAG
IκBEU399817.1Forward
Reverse		CTGCTCGGCAATAACACTGA
GAGAGGAGACCGTTGGTGAG
TRAF-6XM_013990069.2Forward
Reverse		GCTGCATCTATGGCATTTGAAG
CCACAGATAACATTTGCCAAAGG
TAK1NM_001114280.1Forward
Reverse		CATGTGGGCTGTTCATAACG
GAGTTGCTCTGGCCTTCATC
SIGIRRNM_001315689.1Forward
Reverse		ACCTGGGCTCCCGAAACTAC
GTCATCTTCTGACACCAGGCAAT
TOLLIPNM_001315800.1Forward
Reverse		CCCGCGCTGGAATAAGG
CATCAAAGATCTCCAGGTAGAAGGA
PBD-1NM_213838.1Forward
Reverse		ACCGCCTCCTCCTTGTATTC
CACAGGTGCCGATCTGTTTC
pBD-2NM_214442.2Forward
Reverse		ATTAACCTGCTTACGGGTCTTGGC
CCACTGTAACAGGTCCCTTCAATCC
pBD-3XM_021074698.1Forward
Reverse		TCTTCTTGTTCCTGATGCCTCTTCC
GCCACTCACAGAACAGCTACCTATC
MUC1XM_021089730.1Forward
Reverse		TTCTTCGGGCTGTTGCTACT
ACTGTCTTGGAAGGCCAGAA
MUC2NM_010843.1Forward
Reverse		CTCCATCCGCTTCAGAAAAG
ACTACCTGGGGCCTCTGAAT
MUC4XM_021068274.1Forward
Reverse		CCTCCCAAGCAGATGTCAAT
CTGGGATAAGAATGCCTCCA
β-ActinXM_021086047.1Forward
Reverse		GATCTGGCACCACACCTTCTACAAC
TCATCTTCTCACGGTTGGCTTTGG
TLR4, Toll-like receptor 4; MyD88, myeloid differentiation factor 88; IKKα, inhibitor of NF-κB kinase α; IKKβ, inhibitor of NF-κB kinase β; IκB, Inhibitor of κ light chain gene; TRAF-6, TNF receptor associated factor 6; TAK1, transforming growth factor β activated kinase 1; SIGIRR, Single Ig IL-1-related receptor; TOLLIP, Toll-interacting protein; pBD, porcine beta-defensin; and MUC, mucin.
Table 3. Antibodies used for Western blotting analysis.
Table 3. Antibodies used for Western blotting analysis.
NamesCompanyCat. No.Dilution Multiple
Claudin-1Abcam (Cambridge, UK)ab150981:1000
OccludinAbcam (Cambridge, UK)ab317211:1000
ZO-1Abcam (Cambridge, UK)ab317211:1000
β-actinBioss (Beijing, China)bs-0061R1:5000
Second antibody
(Goat anti-rabbit)		ZenBio (Chengdu, China)5112031:5000
Table 4. Effect of LC on the growth performance of weaned piglets.
Table 4. Effect of LC on the growth performance of weaned piglets.
ItemsTreatmentsSEMp-Value
CONCON +
ETEC		ATB +
ETEC		LCLC +
ETEC
Average body weight (kg)
0 d7.107.097.087.067.110.061.00
7 d8.758.718.818.808.850.050.91
14 d10.9710.5810.8511.0510.860.100.40
Pre-challenge (0–7 d)
ADFI (g)322.27318.19339.28339.17341.747.480.81
ADG (g)235.24231.43246.43248.57248.335.420.80
F/G1.371.381.381.361.380.030.44
Post-challenge (7–14 d)
ADFI (g)481.97460.28452.41486.27444.6911.240.74
ADG (g)319.24267.03290.95321.91284.127.750.06
F/G1.51 b1.72 a1.55 b1.50 b1.57 b0.020.00
n = 6. Different letters mean a statistically significant difference among the groups (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tian, Z.; Chen, J.; Lin, T.; Zhu, J.; Gan, H.; Chen, F.; Zhang, S.; Guan, W. Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli. Animals 2023, 13, 3497. https://doi.org/10.3390/ani13223497

AMA Style

Tian Z, Chen J, Lin T, Zhu J, Gan H, Chen F, Zhang S, Guan W. Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli. Animals. 2023; 13(22):3497. https://doi.org/10.3390/ani13223497

Chicago/Turabian Style

Tian, Zhezhe, Jiaming Chen, Tongbin Lin, Junhua Zhu, Haoyang Gan, Fang Chen, Shihai Zhang, and Wutai Guan. 2023. "Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli" Animals 13, no. 22: 3497. https://doi.org/10.3390/ani13223497

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop