Next Article in Journal
A Detailed Analysis of the Effect of Different Environmental Factors on Fish Phototactic Behavior: Directional Fish Guiding and Expelling Technique
Next Article in Special Issue
Study of the Mandibular Bone Microstructure and Blood Minerals Bioavailability in Rainbow Trout (Oncorhynchus mykiss, Walbaum 1792) from Freshwater
Previous Article in Journal
A Survey on the Use of Spirometry in Small Animal Anaesthesia and Critical Care
Previous Article in Special Issue
Effects of Probiotics on Growth, Survival, Water Quality and Disease Resistance of Red Hybrid Tilapia (Oreochromis spp.) Fingerlings in a Biofloc System
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 3
10.3390/ani12030234
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization, Tissue Distribution and Differential Nutritional Regulation of Three n-3 LC-PUFA Biosynthesis-Related Genes in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂)

by
Qingjun Wu
,
Zhi Zheng
,
Chuijin Wang
,
Yao Wang
,
Yuejia Sun
and
Yujie Gao
*
College of Marine Science, Hainan University, Haikou 570228, China
*
Author to whom correspondence should be addressed.
Animals 2022, 12(3), 234; https://doi.org/10.3390/ani12030234
Submission received: 2 December 2021 / Revised: 29 December 2021 / Accepted: 5 January 2022 / Published: 19 January 2022
(This article belongs to the Special Issue The Future of Aquaculture Research)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Polyunsaturated fatty acids, especially DHA and EPA, play crucial roles in fish growth performance, brain and eye development, reproduction and non-specific immune responses. However, considering the environmental unsustainability and the increasing price of fisheries’ by-products, alternative aquafeed ingredients are needed as a source of unsaturated fatty acids for farming marine fish. Here, we isolated and characterized three genes participating in the biosynthesis of n-3 LC-PUFA in hybrid groupers. We found that these genes were expressed in the liver of hybrid groupers in response to dietary fatty acid levels. Our findings contribute to a better understanding of the n-3 LC-PUFA biosynthesis process in this marine fish species.

Abstract

Elongases of very long-chain fatty acids (Elovls) and fatty acid desaturases (Fads) are crucial enzymes involved in the biosynthesis of long-chain polyunsaturated fatty acids (LC-PUFAs). In this paper, we report the molecular cloning and characterization of three genes from the marine teleost Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂, and analyzed tissue distribution and their expression in response to dietary n-3 LC-PUFA levels after a 42-day feeding experiment. The elovl5, elovl8 and fads2 genes encoded 294, 263 and 445 amino acids, respectively, which exhibited all the characteristics of the Elovl and Fads family. Tissue distribution analysis revealed that elovl5, elovl8 and fads2 were widely transcribed in various tissues, with the highest level in the brain, as described in other carnivorous marine teleosts. The transcript levels of elovl5, elovl8 and fads2 in the liver were significantly affected by dietary n-3 LC-PUFA, and higher LC-PUFA levels repressed their expression. These results demonstrated, for the first time, the presence and nutritional modulation of elovl5, elovl8 and fads2 cDNA in the juvenile hybrid grouper. Further studies are needed to determine the functional characterization of these genes and explore the mechanism of these genes when regulated by dietary fatty lipid profiles in this species.

1. Introduction

Long-chain polyunsaturated fatty acids (LC-PUFA, ≥C20 and ≥2 double bonds) are widely present in organisms and play vital roles in maintaining cell membrane fluidity, regulating fat metabolism, enhancing immunity and reducing inflammation [1]. Among these, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are the most critical LC-PUFAs, with beneficial effects on human health particularly in the prevention of cardiovascular and neuro developmental disorders [2]. At present, fish, particularly marine species, represent a rich source of EPA and DHA for human consumers, due to the high content of LC-PUFAs acquired from the feed [3]. However, the raw materials for aquaculture feed have reached a sustainable limit, and there is a rapid and continuous growth in aquaculture activities; it is estimated that 75% of the world’s fish oil supplies are used for aquaculture production [4]. Thus, aquaculture nutritionists and aqua-feed companies are seeking sustainable alternatives to replace marine fish oil. However, the other issue is that the alternatives, primarily plant oils rich in C18 PUFA but devoid of LC-PUFA significantly decreased n-3 LC-PUFA in the filet of farmed fish [5,6]. Therefore, there is considerable interest in understanding the n-3 LC-PUFA biosynthesis pathway and nutritional regulation mechanism in the cultured fish species.
LC-PUFA biosynthesis depends on the specific gene repertoire and each enzyme’s respective functional capabilities, which may vary from species to species [7]. Elovls are the initial and rate-limiting enzymes responsible for the elongation reaction required for the de novo biosynthesis of LC-PUFA. At present, the Elovls family was found to have Elovl1-8, in which Elovl2, Elovl4, Elovl5 and Elovl8 are involved in the elongation of LC-PUFA [8,9,10]. Elovl2 is preferentially responsible for the elongation step from C22 to C24 LC-PUFA. It has been found in freshwater and anadromous species such as zebrafish (Danio rerio), African catfish (Clarias gariepinus), and Atlantic salmon (Salmo salar), as well in chordates such as sea lamprey (Petromyzon marinus, agnathan) and the elephant shark (Callorhinchus milii, basal gnathostome) [11,12,13,14]. Thus, the variation between marine and freshwater fish species in the presence or absence of Elovl2, a critical enzyme for DHA synthesis, was hypothesized to contribute to the low ability of most farmed marine fish to biosynthesize DHA [15].
Elovl4 and Elovl5 have been isolated from several marine fish species [16]. Elovl5 can preferentially elongate C18 (18:3n-6 and 18:4n-3) and C20 (20:4n-6 and EPA) fatty acids but has low activity toward C22 fatty acids [17]. Elovl4 can effectively extend C18 PUFAs and participate in the synthesis of DHA. Accordingly, it is expected that this enzyme could compensate for Elovl2 activity in some marine fish species, such as rabbitfish (Siganus canaliculatus) [18]. Recently, two Elovl8 isoforms, “Elovl8a” and “Elovl8b”, have been found in zebrafish [9] and rabbitfish [19]. Further functional characterization by heterologous expression in yeast showed that Elovl8b could elongate C18 (18:2n-6, 18:3n-3 and 18:4n-3) and C20 (20:4n-6 and 20:5n-3) polyunsaturated fatty acids (PUFAs) to longer-chain polyunsaturated fatty acids (LC-PUFAs), whereas Elovl8a lacked this ability in rabbitfish. However, studies in CRISPR/Cas9 Elovl8a−/− and Elovl8b−/− zebrafish revealed that Elovl8a activity was specific to C18-C20 PUFAs and Elovl8b activity was specific to C18:0 and C20:1 MUFAs. Fatty acid desaturase enzymes introduce double bonds into specific positions on the carbon chain to produce desaturation and are crucial to the synthesis of DHA and 22:5n-6 from EPA and 22:4n-6, respectively, via the “Sprecher pathway” [20]. The Fads gene family was found to have Fads1-3 [21]. However, in most of the teleost species, only Fads2 was present, and this enzyme was more similar to mammalian Δ6 desaturase in most fish species [22]. Therefore, to compensate for the loss of Fads1, some teleost Fads2 have exhibited additional desaturase activity, such as Δ5 in rainbow trout [23], Δ6/Δ5 and ∆4 in rabbitfish [24], and ∆4 in Senegalese sole (Solea senegalensis, 1858) [25].
Grouper aquaculture is an important sector of marine fish production in China, with about 190,000 t being produced yearly [26]. Among these, a hybrid grouper of tiger grouper (Epinephelus fuscoguttatus ♀) and giant grouper (Epinephelus lanceolatus ♂) have become the dominant cultivated species due to their rapid growth and high disease resistance characters [27]. However, to our knowledge, little information is available regarding the genes involved in LC-PUFA biosynthesis in this fish species. Previous studies in a similar species, the orange-spotted grouper (Epinephelus coioides), have suggested that it has a limited ability to synthesize n-3 LC-PUFA, especially DHA [28,29]. Thus, to fully understand the LC-PUFA biosynthetic abilities of this new hybrid grouper, we reported the molecular cloning, phylogenetic analysis and nutritional regulation of elovl5, elovl8 and fads2 under different dietary LC-PUFA levels in this fish.

2. Materials and Methods

2.1. Fish and Sampling

Juvenile hybrid groupers (4 months old, approximate 20 g) were selected in our trial as the first few months of life are the most vulnerable period and crucial for fish growth. They were obtained from a local commercial hatchery (Wenchang, Hainan province, China), and were acclimated in circular tanks at room temperature (28 °C) for two days. The fish were provided a natural photoperiod and adequate dissolved oxygen (>6.0 mg L−1). Four fish were collected and anesthetized with MS-222 (Sigma, St. Louis, MO, USA); then, tissues including liver, heart, intestine, muscle, kidney, stomach, pyloric cease and brain were snap-frozen by liquid nitrogen and then stored at −80 °C until use.

2.2. Gene Cloning

2.2.1. Primers Design

According to the highly conserved domains of the elovl5, elovl8 and fads2 gene sequence obtained by DNAssist software (Version 1.0) from other species, including cobia (Rachycentron canadum), Atlantic salmon, golden pompano (Trachinotus ovatus), orange-spotted grouper and giant grouper in the GenBank database (http://www.ncbi.nlm.nih.gov/genbank/ (accessed on 4 January 2022)), specific PCR primers were designed using Primer 5.0 based on the consensus sequences to amplify and confirm the full length of these cDNAs (Table 1) (Figure S1).

2.2.2. RNA Extraction and cDNA Synthesis

Total RNA was extracted from the liver, heart, intestine, muscle, kidney, stomach, pyloric cease and brain using Trizol Reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. Quantification of RNA was performed using NanoDrop ND-1000 spectrophotometer (Wilmington, DE, USA), and the quality was measured by electrophoresis on a 1.0% denaturing agarose gel. The RNA (1 μg) from all the above tissues was reverse-transcribed into cDNA by PrimeScript™ RT kit and gDNA Eraser (Perfect Real Time) (Takara, Japan) according to the manufacturer’s instructions. To obtain the first partial fragment of gene cloning, RNA (1 μg) from liver samples was reverse-transcribed into cDNA using SMARTer® RACE5′/3′ kit (Takara, Japan) and GoScript™ Reverse Transcription System kit (Promega, USA), according to the manufacturer’s instructions. The first partial fragment was sequenced by Sangon Biotech Co., Ltd (Shanghai, China), and was verified by NCBI BlastN.

2.2.3. RACE Amplification

The 5′ and 3′ rapid amplification of cDNA ends (RACE) PCR template were obtained according to the manufacturer’s instructions (SMARTer™ RACE cDNA Amplification Kit, Clontech, San Jose, CA USA). For 3′ and 5′ RACE of elovl8, gene-specific primers, Elovl8-3F and Elovl8-5R, and Universal Primer (provided in the kit) were used in gradient PCR. Amplification was performed in a total volume of 20 μL, containing 10 μL 2×Taq PCR Master Mix II, 0.5 μL of each primer (10 μM), 7 μL nuclease-free water, and 2 μL cDNA (50 ng/μL). For 3′ and 5′ RACE of elovl5, Elovl5-3F and Elovl5-5R, and Universal Primer were used in gradient PCR. For 3′ and 5′ RACE of fads2, Fads2-3F1 and Fads2-5R1, and Universal Primer were used in gradient PCR. The PCR product was purified, cloned into a pMD19-T vector (Takara, Japan), then transformed and sequenced. The full lengths of the grouper elovl5, elovl8 and fads2 cDNA were obtained by aligning the first partial sequence with the corresponding RACE PCR products using DNAssist software (Version 1.0). The cloned PCR fragments were then sequenced by Sangon Biotech Co. Ltd. (Shanghai, China).

2.2.4. Sequence and Phylogenetic Analysis

The nucleotide sequence and the amino acid sequence of Elovl5, Elovl8 and Fads2 were analyzed by the NCBI blast program (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi (accessed on 4 January 2022)). The conserved domains of Elovl5, Elovl8, and Fads2 sequences were predicted by the SMART and CDD programs. The molecular weight, isoelectric point, and amino acid content were identified by online software ExPASy (http://web.expasy.org/protparam/ (accessed on 4 January 2022)). The Elovl5, Elovl8 and Fads2 amino acids’ multiple sequence alignments were found using the CLUSTALX software (Version 1.8.1). The sequences alignment of Elovl4, Elovl5 and Elovl8 were uploaded into MEGA 10.0 and all columns containing 75% gaps were stripped from the alignment, leaving a total of 232 positions for phylogenetic analysis. The sequences alignment of Fads2 were uploaded into MEGA 10.0 and all columns containing 4.3% gaps were stripped from the alignment, leaving a total of 438 positions for phylogenetic analysis. The evolutionary model was determined using the MODELS option in MEGA 10.0 resulting in a LG + G, and branch support was calculated using maximum likelihood (Figure S2). The number of booststrap replications for phylogeny test are 1000.2.2. Feeding trial with different n-3 LC-PUFA levels
Three isoenergetic (339 kcal/100 g), isonitrogenous (53%) and isolipidic (7%) experimental diets (Table 2) were formulated containing graded levels of n-3 LC-PUFA (0.53%, 1.19% and 2.69%) based on our previous study (Table 3) (Figure S3). Juvenile hybrid groupers were obtained from a local commercial hatchery (Wenchang, Hainan province, China). Fish were acclimated with commercial diets for 2 weeks before the experiment. A total of 108 fish (average initial weight, 20.8 ± 0.03 g) were selected and randomly distributed into 9 glass tanks (L 60 cm × W 45 cm × H 50 cm) connected to a water-recycling system. The water was oxygenated through air stones at the bottom of each tank. Triplicate groups of fish were fed to apparent satiation by hand twice daily (8:00 am and 4:30 pm). Water temperature (29 ± 0.5 °C), total ammonia (0–0.15 mg/L) and dissolved oxygen (5.9 ± 0.1 mg/L) were monitored daily. Fish were exposed to a 12 h: 12 h light: dark cycle. The feeding trial lasted 42 days. At the end of the experiment, fish were counted and weighed after being subjected to 16 h fasting. Two fish per tank were randomly collected and anesthetized with MS-222 at 80 mg L-1 (Sigma, St. Louis, MO, USA): Liver was sampled and snap-frozen by liquid nitrogen and then stored at −80 °C for the RNA extraction.

2.3. Quantitative Real-Time PCR

RT-PCR was carried out in a quantitative thermal cycler (Roche Light Cycler® 480, Switzerland). The amplification was performed in a total volume of 20 μL containing 10 μL power SYBR® Green PCR Master Mix (Takara, Japan), 0.8 μL of each primer (10 μM), 6.4 μL nuclease-free water and 2 μL of cDNA (50 ng/μL). The real-time RT-PCR program was as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 20 s, and 65 °C for 15 s. After the amplification phase, a melt curve of 0.5 °C increments from 65 °C to 90 °C was performed, enabling the confirmation of the amplification of a single product in each reaction for the melting curve. Standard curves were made with five different dilutions (in triplicate) of the cDNA samples and the amplification efficiency was analyzed according to the following equation E = 10(−1/slope)−1. Real-time PCR efficiencies of elovl8, elovl5, fads2 and elongation factor 1 (ef1alpha) ranged between 96.2% and 104.7%, 96.5% and 105.5%, 97.1% and 106.1%, 95.6% and 106.2%, respectively. Ef1alpha was used as the housekeeping gene to normalize of the results (as our previous study). The expression levels of the target genes were calculated followed by the 2−∆∆Ct method.

2.4. Statistical Analysis

The normality and homogeneity of the data were explored using Hartley’s test. Then, data were subjected to one-way analysis of variance (ANOVA) and Duncan’s multiple range test (SPSS 22.0 for Windows, Chicago IL, USA) to determine if significant differences occurred between different treatments. Differences were considered significant at p < 0.05. All data are presented as mean ± S.E.M.

3. Results

3.1. Gene Cloning and Sequence Analysis of elovl5, elovl8 and fads2

The cloned elovl5 cDNA from the hybrid grouper (uploaded under GenBank Accession Number MZ713365) was 1226 bp, which contained an 885 bp ORF that encoded a polypeptide of 294 amino acids, a 41 bp 5′ UTR and a 300 bp 3′ UTR (Figure S4). The hybrid grouper Elovl5 protein has a calculated molecular mass of 35.10 kDa and an isoelectric point of 9.25 amino acid sequence deduced by SMART analysis, which has 7 transmembrane domain located at residues 32–50, 63–85, 111–132, 139–161, 176–198, 205-227 and 231–250 respectively, a highly conserved redox center histidine cluster (143–147), 3 conserved motifs (120–127, 173–184 and 203–209), and an endoplasmic reticulum retention signal (288–294). The NCBI-CDD program showed that Elovl5 included a conservative region of LC-PUFA elongases located at residues 28–256.
The cloned elovl8 cDNA from a hybrid grouper (uploaded GenBank Accession Number MZ713364) was 1228 bp, which contained a 792 bp ORF that encoded a polypeptide of 263 amino acids with a 111 bp 5′ UTR and a 325 bp 3′ UTR (Figure S5). The encoded Elovl8 protein has a calculated molecular mass of 30.8 kDa and an isoelectric point of 9.21 amino acid sequence, deduced by SMART analysis. Meanwhile, the Elovl8 protein possessed 7 transmembrane domains located at residues 25–50, 63–85, 111–113, 140–159, 169–191, 203–225 and 105–127, respectively, a highly conserved redox center histidine cluster (259-–263), 4 conserved motifs (121–128, 139–148, 174–185 and 205–211), and an endoplasmic reticulum retention signal (259–263). The NCBI-CDD program showed that the newly cloned Elovl8 possessed a conservative region of LC-PUFA elongases located at residues 28–262.
The cloned fads2 cDNA from the hybrid grouper (uploaded under GenBank Accession Number MZ713366) was 2006 bp, which contained a 1338 bp ORF that encoded a polypeptide of 445 amino acids, a 238 bp 5′ UTR and a 430 bp 3′ UTR (Figure S6). The encoded Fads2 protein has a calculated molecular mass of 52.04 kDa and isoelectric point of 8.41 amino acid sequence deduced by SMART analysis, which had 3 transmembrane domain located at residues 148–170, 267–289 and 304–326, respectively, 3 highly conserved redox center histidine cluster (181-185, 218-222 and 383-387), 3 conserved motifs (120–127, 173–184 and 203–209), and an N-terminal Cyt-b5 domain with typical heme-binding motif (288–294). The NCBI-CDD program showed that Fad2 included a conservative region located at residues 163–413.

3.2. Multiple Sequence Alignment and Phylogenetic Analysis

A multiple sequence alignment and phylogenetic analysis were conducted to investigate the homology of genes elovl5, elovl8 and fads2 between hybrid grouper and other species. The results showed that most of the amino acid residues in fish, including hybrid grouper, were highly aligned with Elovl5 and Elovl8 (Figure 1 and Figure 2). They possessed all the characteristic features of Elovl family members, including multiple transmembrane regions, a single-histidine dideoxy-binding motif HXXHH, the putative endoplasmic reticulum (ER) retrieval signal KKKQK and KKLRVD, respectively, at the carboxyl terminus and multiple regions, containing similar motifs, such as (1) KXXEXXDT, (2) QXXFLHXXHH, (3) NXXXHXXMYXYY, (4) and TXXQXXQ.Fads2 possessed all the characteristic features of Fads family members, including multiple transmembrane regions, and three single-histidine dideoxy-binding motifs: HXXHH, HDXGH and QXXHH (Figure 3).
Phylogenetic analysis by the maximum likelihood method showed three clusters for elovl8, elovl4 and elovl5, with elovl8 cluster showing closest relationship to the elovl4 cluster (Figure 4). Amino acid sequence of hybrid grouper Elovl8 exhibited high identity with Siganus_canaliculatus Elovl8b (86%), Salmo salar Elovl8b (83%) and Danio rerio Elovl8b (80%). Elovl5 was closest to Perciformes, such as Epinephelus coioides (99%), Epinephelus lanceolatus (99%), Acanthopagrus schlegelii (95%) and Larimichthys crocea (95%).
Phylogenetic analysis of Fads2 showed that the hybrid grouper clustered in the Fads2 group rather than Fads1 (Figure 5). Moreover, Fads2 in hybrid grouper shared high sequence identity with Fads2 of Perciformes, such as Epinephelus coioides (99%), Epinephelus lanceolatus (99%), Lateolabrax japonicus (88%), Larimichthys crocea (82%), and Lepisosteus oculatus (74%) and less similar to Fads1 such as Anguilla japonica (60%), Polypterus senegalus (59%) and Lepisosteus oculatus (56%).

3.3. Tissue Distribution of elovl5, elovl8 and fads2 mRNA Hybrid Grouper

As shown in Figure 6, the elovl5, elovl8 and fads2 genes were widely expressed in all the detected tissues of the hybrid grouper, including intestine, liver, muscle, brain, kidney, stomach, heart and pyloric caeca, with the highest expression in the brain (p < 0.05). Furthermore, moderate expression of elovl5 and elovl8 genes was found in the liver and stomach, while the fads2 gene most highly expressed in liver and muscle. The results also showed that the heart and kidney were the tissues with the lowest gene expression of elovl5 and fads2 (p < 0.05), while the lowest value for elovl8 gene expression was found in the kidney (p < 0.05).

3.4. Nutritional Regulation of Hybrid Grouper elovl5, elovl8 and fads2 Genes Expression

The gene expression of elovl8, elovl5 and fads2 in the liver of hybrid grouper were significantly affected by the dietary n-3 LC-PUFA levels (p < 0.05) (Figure 7). Elovl5 and elovl8 relative mRNA expressions were significantly decreased at 1.19 and 2.69 of dietary n-3 LC-PUFA levels compared with group 0.53 (p < 0.05). In contrast, a significantly downregulated gene expression of fads2 was recorded in group 2.69 compared with other treatments (p < 0.05).

4. Discussion

Similar to other cultured marine fish species, fish oil is the primary lipid source for hybrid groupers. Considering the non-sustainable reliance on fish oil to farm this species, several trials have investigated the impact of the dietary replacement of fish oil with alternatives [30,31,32,33]. However, studies related to the molecular basis of LC-PUFA biosynthesis and regulation, which could optimize the pathway to the efficient use of alternatives, are still limited in hybrid groupers. Thus, we first cloned and characterized the main enzymes participating in the LC-PUFA biosynthesis in the present study, including Elovl5, Elovl8 and Fads2, from this fish species. To date, elovl5 cDNA has been identified in numerous marine fish species, including Epinephelinae, and has been demonstrated to effectively elongate C18 and C20 PUFA [34]. In the present study, the isolated hybrid grouper elovl5 cDNA sequence had 294 amino acids and showed high identity with other teleost elovl5, particularly Perciformes including Epinephelus coioides (99%), Epinephelus lanceolatus (99%), Acanthopagrus schlegelii (95%) and Larimichthys crocea (95%). The hybrid grouper Elovl5 possessed standard features for Elovl protein family members, including the so-called histidine box (HXXHH), the canonical C-terminal ER retention signal, several predicted transmembrane regions and other highly conserved motifs [35].
Elovl8a and elovl8b were first identified and functionally characterizated in rabbitfish from Li’s lab. Multiple sequences alignment showed that elovl8 shared a closer relationship with elovl4 [18]. Afterwards, Sun et al. conducted a phylogenetic analysis to establish the orthology of the newly identified elovl8 gene and revealed that the similar orthologs from some fish species which were all annotated as elovl4 or elovl4-like could be misidentified due to the sequence similarity to elovl4 genes [9]. Thus, the previously similar elovl genes that have been annotated as “elovl4” (or “elovl4-like”) in many fish species were considered to be elovl8 [9]. Similarly, amino acid sequence alignment with elovl4, elovl5 and elovl8 from other species showed that the new isolated “elovl4” gene from hybrid grouper was highly similar to those of elovl8b, and exhibited high identity with other teleost elovl8b, particularly Perciformes, including Siganus canaliculatus Elovl8b (86%), Salmo salar Elovl8b (83%), Oncorhynchus mykiss Elovl8b (83%), Ictalurus punctatus Elovl8b (81%) and Danio rerio Elovl8b (80%). Hybrid grouper Elovl8 possessed all the features of Elovl8 protein family members, including motifs (KXXEXXDT, QXXFLHXYHH, NXXXHXXMYXYY and TXXQXXQ), endoplasmic reticulum (ER) retention signal, multiple membrane-spanning regions and a histidine box (HXXHH), which is involved in the coordination of electron reception during fatty acid elongation [36]. It has been shown that the two Elovl8 isoforms may play various roles during the n-3 PUFA synthesis in different species. For instance, Elovl8b could elongate C18 (18:2n-6, 18:3n-3 and 18:4n-3) and C20 (20:4n-6 and 20:5n-3) polyunsaturated fatty acids (PUFAs) to longer-chain polyunsaturated fatty acids (LC-PUFAs), whereas Elovl8a lacked this ability in rabbitfish. However, in the study of zebrafish, Elovl8a activity was specific to C18-C20 PUFAs, just as Elovl4, Elovl5 and Elovl8b activity was specific to C18:0 and C20:1 MUFAs similar to Elovl1, Elovl3, and Elovl7 [9,19]. Thus, further studies need to explore Elovl8 functions in LC-PUFA synthesis in this hybrid grouper.
Fads2 (Δ6 desaturase) catalyzes the first desaturation step in LC-PUFA synthesis and has been widely studied as the rate-limiting enzyme in the classical “Δ6 desaturation-Elovl5-Δ5 desaturation” LC-PUFA biosynthetic pathway [37]. Like all teleost fish species, phylogenetic analysis confirmed that the identified hybrid grouper cDNA was fads2 rather than fads1, while both Fads1 and Fads2 desaturases were found in Elopomorpha species such as Japanese eel (Anguilla japonica), and it was considered that Fads1 was retained in Chondrichthyes and early ray-finned fish before its subsequent loss in Osteoglossomorpha and Clupeocephala [38]. As it is compensating for the lack of Fads1 in teleost genomes, Fads2 have functionally diversified during their evolution, such that Δ6, Δ4, Δ5, Δ8, or bifunctional desaturation abilities have been recorded in different fish species. Moreover, it has been demonstrated that the low expression of the fads2 gene in carnivorous marine species was due to the lack of a binding site for stimulatory protein 1 (Sp1) [39].
The analysis of tissue distribution patterns for genes is helpful to better understand their physiological roles. Our study showed that the gene expression of elovl5, elovl8, and fads2 was detected in all the examined tissues, which was consistent with the ubiquitous expression previously reported in fish [18,19,28]. Furthermore, these three genes were predominantly expressed in the brains of hybrid groupers, as reported in other carnivorous marine fish species, including groupers and other species, such as cobia [40], Asian seabass (Lates calcarifer) [41], Nibe croaker (Nibea mitsukurii) [22], and Northern pike (Esox lucius) [42]. However, inconsistently with the elovl8b distribution pattern in the tissues, the elovl8a was highly expressed in the heart and spleen of rabbitfish, which demonstrates their various roles in the LC-PUFA synthesis process. DHA is one of the most abundant LC-PUFA in the brain and is vital for brain function and development; this is the likely reason for elovl5, elovl8 and fads2 being highly expressed, to supply the high requirements for this tissue. However, studies in freshwater and marine herbivorous species such as rabbitfish and Atlantic salmon [11,18] showed that the liver and intestine, as the significant metabolic sites for LC-PUFA biosynthesis, exhibited the highest expression of elovl5 and fads2 genes. In addition, our study also showed that relatively higher gene expressions of elovl5 were found in pyloric ceca compared with intestine and muscle, which indicated that it could be an important site of LC-PUFA, as reported in rainbow trout [43]. However, the gene expression in the kidney was the lowest among all the measured tissue, which was inconsistent with the orange-spotted grouper findings [44]. These results suggest that the diversification of fish LC-PUFA synthesis in different tissues could be associated with factors such as feeding habits, ecological habits, and species-specific evolutionary history [45].
Marine fish species’ requirement for LC-PUFA firstly depends on daily intake from the diet. As alternative oil sources lacking in LC-PUFA are gradually being used in the diet, it is essential to clarify the patterns of dietary fatty acids in regulating genes encoding desaturases and elongases in farmed fish. As the liver serves as the primary site for FA metabolism, including de novo synthesis of FA, we evaluated the gene expression of elovl5, elovl8 and fads2 in the liver of hybrid groupers, and they were down-regulated by higher dietary n-3 LC-PUFA levels, which was consistent with the findings in the orange-spotted grouper [28,29,44] and other fish species such as the large yellow croaker [46]. These observations reflect the negative feedback regulation of the LC-PUFA synthetic pathway. Atlantic salmon elovl5 reporter activities were induced by the overexpression of LXRα, but not by the overexpression of sterol regulatory element-binding protein 1 (SREBP-1) [47]. In a study of Japanese seabass, CpG methylation of the fads2 promoter was observed as hepatic fads2 expression decreased in response to high dietary n-3 LC-PUFA, but a similar result was not recorded in European seabass [48]. Thus, further investigation is required to explore the regulation mechanism related to the different genes involved in LC-PUFA for hybrid groupers.

5. Conclusions

In summary, elovl5, elovl8 and fads2 genes were identified from hybrid groupers. The characteristics of the above genes were similar to other marine teleost fish species. Moreover, elovl5, elovl8 and fads2 were broadly expressed in most tissues, with the highest levels being found in the brain and liver, followed by the stomach, and the lowest levels being found in the kidney. Furthermore, the hepatic gene expression of elovl5, elovl8 and fads2 was downregulated by high dietary n-3 LC-PUFA. However, future studies are needed to determine the functional characterization of these genes and to explore the mechanism of these genes when regulated by the dietary fatty lipid profiles to better understand the process of n-3 LC-PUFAs biosynthesis in this fish species.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ani12030234/s1. Figure S1: Multiple Sequence Alignment of elovl5, elovl8 and fads2 genes used for primer design. The design sequence of the primers is marked with square, Figure S2: Maximum likelihood method parameters, Figure S3: Effect of dietary n-3 LC-PUFA levels (g/100 g) on weight gain (%) of hybrid grouper, Figure S4: Nucleotide and deduced amino acid sequence of Elovl5 in hybrid grouper (GenBank accession number MZ713365). The nucleotide sequence is numbered from the first base at 5′ end, started in codon (ATG) and stopped in codon (TGA). Four conserved motif of elongases are in gray; the putative histidine-richdomain (HXXHH) is in bold; the predicted seven (I-VII) putative membrane-spanning domains are underlined; the ER retrieval signal is wavy underlined, Figure S5: Nucleotide and deduced amino acid sequence of Elovl8 in hybrid grouper (GenBank accession number MZ713364). The nucleotide sequence is numbered from the first base at 5′ end, started in codon (ATG) and stopped in codon (TGA). The putative transmembrane regions are in gray; the putative histidine-richdomain (HXXHH) is in bold; the predicted seven (I-VII) putative membrane-spanning domains are underlined; the ER retrieval signal is wavy underlined, Figure S6: Nucleotide and deduced amino acid sequence of Fads2 in hybrid grouper (GenBank accession number MZ713366). The nucleotide sequence is numbered from the first base at the 5′ end, started in codon (ATG) and stopped in codon (TGA). The Cytochrome b5-like Heme/Steroid binding domain is in gray; the putative histidine-rich domain (HXXHH, HDXGH and QXXHH) is in bold; the predicted four (I-IV) putative membrane-spanning domains are underlined.

Author Contributions

Q.W. manuscript preparation; C.W. and Y.W. investigation; Z.Z. and Y.S. formal analysis; Y.G. conceptualization and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Key Research Project of Hainan Province (ZDYF2019099) and National Natural Science Foundation of China (31802313).

Institutional Review Board Statement

The protocol of animal experiment was reviewed and approved by the Committee of Animal Welfare and Ethics of Hainan University (The project identification code: HNUAUCC-2021-00085).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available on request from the corresponding author.

Acknowledgments

We appreciate the Analytical and Testing Center of Hainan University for the GC analysis of fatty acids.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, T.T.; Xu, J.; Wang, Y.M.; Xue, C.H. Health benefits of dietary marine DHA/EPA-enriched glycerophospholipids. Prog. Lipid Res. 2019, 75, 100997. [Google Scholar] [CrossRef] [PubMed]
  2. Zárate, R.; Jaber-Vazdekis, N.; Tejera, N.; Pérez, J.A.; Rodríguez, C. Significance of long chain polyunsaturated fatty acids in human health. Clin. Transl. Med. 2017, 6, 1–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Abedi, E.; Sahari, M.A. Long-chain polyunsaturated fatty acid sources and evaluation of their nutritional and functional properties. Food Sci. Nutr. 2014, 2, 443–463. [Google Scholar] [CrossRef] [PubMed]
  4. Auchterlonie, N. The continuing importance of fishmeal and fish oil in aquafeeds. Presented at the Aquafarm Conference, Pordenone, Italy, 15–16 February 2018. [Google Scholar]
  5. Bell, J.G.; Tocher, D.R.; Henderson, R.J.; Dick, J.R.; Crampton, V.O. Altered fatty acid compositions in Atlantic salmon (Salmo salar) fed diets containing linseed and rapeseed oils can be partially restored by a subsequent fish oil finishing diet. J. Nutr. 2003, 133, 2793–2801. [Google Scholar] [CrossRef] [PubMed]
  6. Menoyo, D.; López-Bote, C.J.; Obach, A.; Bautista, J.M. Effect of dietary fish oil substitution with linseed oil on the performance, tissue fatty acid profile, metabolism, and oxidative stability of Atlantic salmon. J. Anim. Sci. 2005, 83, 2853–2862. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Monroig, Ó.; Kabeya, N. Desaturases and elongases involved in polyunsaturated fatty acid biosynthesis in aquatic invertebrates: A comprehensive review. Fish. Sci. 2018, 84, 911–928. [Google Scholar] [CrossRef] [Green Version]
  8. Chen, C.; Zhang, M.; Li, Y.; Wang, S.; Xie, D.; Wen, X.; Monroig, Ó. Identification of miR-145 as a Key Regulator Involved in LC-PUFA Biosynthesis by Targeting hnf4 α in the Marine Teleost Siganus canaliculatus. J. Agric. Food Chem. 2020, 68, 15123–15133. [Google Scholar] [CrossRef]
  9. Sun, S.; Wang, Y.; Goh, P.T.; Lopes-Marques, M.; Castro, L.F.C.; Monroig, Ó.; Gao, J. Evolution and Functional Characteristics of the Novel elovl8 That Play Pivotal Roles in Fatty Acid Biosynthesis. Genes 2021, 12, 1287. [Google Scholar] [CrossRef]
  10. Monroig, O.; Rotllant, J.; Sanchez, E.; Cerda-Reverter, J.M.; Tocher, D.R. Expression of long-chain polyunsaturated fatty acid (LC-PUFA) biosynthesis genes during zebrafish Danio rerio early embryogenesis. BBA Mol. Cell Biol. Lipids 2009, 1791, 1093–1101. [Google Scholar] [CrossRef] [Green Version]
  11. Morais, S.; Monroig, O.; Zheng, X.; Leaver, M.; Tocher, D. Highly unsaturated fatty acid synthesis in Atlantic Salmon: Characterization of ELOVL5- and ELOVL2-like elongases. Mar. Biotechnol. 2009, 11, 627–639. [Google Scholar] [CrossRef] [PubMed]
  12. Gregory, M.K.; James, M.J. Rainbow trout (Oncorhynchus mykiss) Elovl5 and Elovl2 differ in selectivity for elongation of omega-3 docosapentaenoic acid. BBA Mol. Cell Biol. Lipids 2014, 1841, 1656–1660. [Google Scholar] [CrossRef] [PubMed]
  13. Oboh, A.; Betancor, M.B.; Tocher, D.R.; Monroig, O. Biosynthesis of longchain polyunsaturated fatty acids in the African catfish Clarias gariepinus: Molecular cloning and functional characterisation of fatty acyl desaturase (fads2) and elongase (elovl2) cDNAs. Aquaculture 2016, 462, 70–79. [Google Scholar] [CrossRef]
  14. Monroig, O.; Lopes-Marques, M.; Navarro, J.C. Evolutionary functional elaboration of the Elovl2/5 gene family in chordates. Sci. Rep. 2016, 6, 20510. [Google Scholar] [CrossRef]
  15. Monroig, Ó.; Navarro, J.C.; Tocher, D.R. Long-chain polyunsaturated fatty acids in fish: Recent advances on desaturases and elongases involved in their biosynthesis. In Proceedings of the Avances en Nutrición Acuícola XI—Memorias del Décimo Primer Simposio Internacional de Nutrición Acuícola, San Nicolás de los Garza, Mexico, 23–25 November 2011; pp. 257–283. [Google Scholar]
  16. Castro, L.F.C.; Tocher, D.R.; Monroig, O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef] [PubMed]
  17. Leonard, A.E.; Kelder, B.; Bobik, E.G.; Chuang, L.T.; Lewis, C.J.; Kopchick, J.J.; Mukerji, P.; Huang, Y.S. Identification and expression of mammalian long-chain PUFA elongation enzymes. Lipids 2002, 37, 733–740. [Google Scholar] [CrossRef]
  18. Monroig, O.; Wang, S.; Zhang, L.; You, C.; Tocher, D.R.; Li, Y. Elongation of long-chain fatty acids in rabbitfish Siganus canaliculatus: Cloning, functional characterisation and tissue distribution of Elovl5-and Elovl4-like elongases. Aquaculture 2012, 350, 63–70. [Google Scholar] [CrossRef] [Green Version]
  19. Li, Y.; Wen, Z.; You, C.; Xie, Z.; Li, Y. Genome wide identification and functional characterization of two LC-PUFA biosynthesis elongase (elovl8) genes in rabbitfish (Siganus canaliculatus). Aquaculture 2020, 522, 735127. [Google Scholar]
  20. Sprecher, H.; Luthria, D.L.; Mohammed, B.S.; Baykousheva, S.P. Reevaluation of the pathways for the biosynthesis of polyunsaturated fatty acids. J. Lipid Res. 1995, 36, 2471–2477. [Google Scholar] [CrossRef]
  21. Marquardt, A.; Stöhr, H.; White, K.; Weber, B.H. cDNA cloning, genomic structure, and chromosomal localization of three members of the human fatty acid desaturase family. Genomics 2000, 66, 175–183. [Google Scholar] [CrossRef] [PubMed]
  22. Kabeya, N.; Yamamoto, Y.; Cummins, S.F.; Elizur, A.; Yazawa, R.; Takeuchi, Y.; Yoshizaki, G. Polyunsaturated fatty acid metabolism in a marine teleost, Nibe croaker Nibea mitsukurii: Functional characterization of Fads2 desaturase and Elovl5 and Elovl4 elongases. Comp. Biochem. Physiol. Part B Biochem. 2015, 188, 37–45. [Google Scholar] [CrossRef] [PubMed]
  23. Abdul Hamid, N.K.; Carmona-Antonanzas, G.; Monroig, O.; Tocher, D.R.; Turchini, G.M.; Donald, J.A. Isolation and functional characterisation of a fads2 in rainbow trout (Oncorhynchus mykiss) with Δ5 desaturase activity. PLoS ONE 2016, 11, 0150770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Li, Y.; Monroig, O.; Zhang, L.; Wang, S.; Zheng, X.; Dick, J.R. Vertebrate fatty acyl desaturase with Δ4 activity. Proc. Natl. Acad. Sci. USA 2010, 107, 16840–16845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Morais, S.; Castanheira, F.; Martínez-Rubio, L.; Conceição, L.E.C.; Tocher, D.R. Long-chain polyunsaturated fatty acid synthesis in a marine vertebrate: Ontogenetic and nutritional regulation of a fatty acyl desaturase with Δ4 activity. Biochim. Biophys. Acta 2012, 1821, 660–671. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Yearbook, C.F.S. China Fishery Statistics Yearbook; Bureau of Fisheries, Ministry of Agriculture: Beijing, China, 2021. [Google Scholar]
  27. Sun, Y.; Guo, C.Y.; Wang, D.D.; Li, X.F.; Xiao, L.; Zhang, X.; Zhang, Y. Transcriptome analysis reveals the molecular mechanisms underlying growth superiority in a novel grouper hybrid (Epinephelus fuscogutatus♀ × E. lanceolatus♂). BMC Genet. 2016, 17, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Li, S.; Mai, K.; Xu, W.; Yuan, Y.; Zhang, Y.; Ai, Q. Characterization, mRNA expression and regulation of Δ6 fatty acyl desaturase (FADS2) by dietary n-3 long chain polyunsaturated fatty acid (LC-PUFA) levels in grouper larvae (Epinephelus coioides). Aquaculture 2014, 434, 212–219. [Google Scholar] [CrossRef]
  29. Li, S.; Monroig, Ó.; Navarro, J.C.; Yuan, Y.; Xu, W.; Mai, K.; Ai, Q. Molecular cloning and functional characterization of a putative Elovl4 gene and its expression in response to dietary fatty acid profiles in orange-spotted grouper Epinephelus coioides. Aquacult. Res. 2017, 48, 537–552. [Google Scholar] [CrossRef]
  30. Baoshan, L.; Jiying, W.; Yu, H.; Tiantian, H.; Shixin, W.; BingShan, H.; Yongzhi, S. Effects of replacing fish oil with wheat germ oil on growth, fat deposition, serum biochemical indices and lipid metabolic enzyme of juvenile hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Aquaculture 2019, 505, 54–62. [Google Scholar] [CrossRef]
  31. Yong, A.S.K.; Mubarak, N.S.S.; Shapawi, R. Effects of partial replacement of fish oil with different vegetable oils on growth, feed utilization and fatty acid profile of hybrid grouper juvenile (Epinephelus fuscoguttatus x Epinephelus lanceolatus). J. Oil Palm Res. 2019, 31, 110–121. [Google Scholar]
  32. An, W.; Dong, X.; Tan, B.; Wu, M.; Zhang, S.; Chi, S.; Yang, Y. Effects of dietary vegetable oil on growth performance, digestive capacity, antioxidant capacity and expression of immune-related genes in the hybrid grouper (Epinephelus fuscoguttatus♀ × E. lanceolatus♂). Aquacult. Nutr. 2020, 26, 2086–2101. [Google Scholar] [CrossRef]
  33. Yan, X.; Dong, X.; Tan, B.; Zhang, S.; Chi, S.; Liu, H.; Yang, Y. Effects of alternative dietary oils on lipid metabolism and related gene expression in hybrid grouper (Epinephelus fuscoguttatus♀ × ♂ E. lanceolatu). Aquacult. Nutr. 2021, 27, 105–115. [Google Scholar] [CrossRef]
  34. Xie, D.; Chen, C.; Dong, Y.; You, C.; Wang, S.; Monroig, Ó.; Li, Y. Regulation of long-chain polyunsaturated fatty acid biosynthesis in teleost fish. Prog. Lipid Res. 2021, 36, 2471–2477. [Google Scholar] [CrossRef] [PubMed]
  35. Meyer, A.; Kirsch, H.; Domergue, F.; Abbadi, A.; Sperling, P.; Bauer, J.; Cirpus, P.; Zank, T.K.; Moreau, H.; Roscoe, T.J. Novel fatty acid elongases and their use for the reconstitution of docosahexaenoic acid biosynthesis. J. Lipid Res. 2004, 45, 1899–1909. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Jakobsson, A.; Westerberg, R.; Jacobsson, A. Fatty acid elongases in mammals: Their regulation and roles in metabolism. Prog. Lipid Res. 2006, 45, 237–249. [Google Scholar] [CrossRef] [PubMed]
  37. Tocher, D.R.; Zheng, X.; Schlechtriem, C.; Hastings, N.; Dick, J.R.; Teale, A.J. Highly unsaturated fatty acid synthesis in marine fish: Cloning, functional characterization, and nutritional regulation of fatty acyl Δ6 desaturase of Atlantic cod (Gadus morhua L.). Lipids 2006, 41, 1003–1016. [Google Scholar] [CrossRef] [PubMed]
  38. Lopes-Marques, M.; Kabeya, N.; Qian, Y.; Ruivo, R.; Santos, M.M.; Venkatesh, B.; Tocher, D.R.; Castro, L.F.C.; Monroig, Ó. Retention of fatty acyl desaturase 1 (fads1) in Elopomorpha and Cyclostomata provides novel insights into the evolution of long-chain polyunsaturated fatty acid biosynthesis in vertebrates. BMC. Evol. Biol. 2018, 18, 157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Xie, D.; Fu, Z.; Wang, S.; You, C.; Monroig, O.; Tocher, D.R.; Li, Y. Characteristics of the fads2 gene promoter in marine teleost Epinephelus coioides and role of Sp1-binding site in determining promoter activity. Sci. Rep. 2018, 8, 5305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Zheng, X.; King, Z.; Xu, Y.; Monroig, O.; Morais, S.; Tocher, D.R. Physiological roles of fatty acyl desaturases and elongases in marine fish: Characterisation of cDNAs of fatty acyl Δ6desaturase and Elovl5 elongase of cobia (Rachycentron canadum). Aquaculture 2009, 290, 122–131. [Google Scholar] [CrossRef]
  41. Mohd-Yusof, N.Y.; Monroig, Ó.; Mohd-Adnan, A.; Wan, K.-L.; Tocher, D.R. Investigation of highly unsaturated fatty acid metabolism in the Asian sea bass, Lates calcarifer. Fish Physiol. Biochem. 2010, 3, 827–843. [Google Scholar] [CrossRef]
  42. Carmona-Antonanzas, G.; Tocher, D.R.; Taggart, J.B.; Leaver, M.J. An evolutionary perspective on Elovl5 fatty acid elongase: Comparison of Northern pike and duplicated paralogs from Atlantic salmon. BMC Evol. Biol. 2013, 13, 1–13. [Google Scholar] [CrossRef] [Green Version]
  43. Bell, M.V.; Dick, J.R.; Porter, A.E. Pyloric ceca are significant site of of newly synthesized 22:6n3 in rainbow trout (Oncorhynchus mykiss). Lipids 2003, 39, 39–44. [Google Scholar] [CrossRef] [PubMed]
  44. Li, S.; Yuan, Y.; Wang, T.; Xu, W.; Li, M.; Mai, K.; Ai, Q. Molecular cloning, functional characterization and nutritional regulation of the putative elongase Elovl5 in the orange-spotted grouper (Epinephelus coioides). PLoS ONE 2016, 11, 0150544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Xie, D.; Ye, J.; Lu, M.; Wang, S.; You, C.; Li, Y. Comparsion of activities of fatty acyl desaturases and elongases among six teleosts with different feeding and ecological habits. Front. Mar. Sci. 2020, 7, 117. [Google Scholar] [CrossRef] [Green Version]
  46. Zuo, R.; Mai, K.; Xu, W.; Dong, X.; Ai, Q. Molecular cloning, tissue distribution and nutritional regulation of a fatty acyl elovl5-like elongase in large yellow croaker, Larimichthys crocea. Aquacult. Res. 2016, 47, 2393–2406. [Google Scholar] [CrossRef]
  47. Minghetti, M.; Leaver, M.J.; Tocher, D.R. Transcriptional control mechanisms of genes of lipid and fatty acid metabolism in the Atlantic salmon (Salmo salar l.) established cell line, shk-1. Biochim. Biophys. Acta 2011, 1811, 194–202. [Google Scholar] [CrossRef]
  48. Geay, F.; Zambonino-Infante, J.; Reinhardt, R.; Kuhl, H.; Santigosa, E.; Cahu, C. Characteristics of Fads2 gene expression and putative promoter in European sea bass (Dicentrarchus labrax): Comparison with salmonid species and analysis of CpG methylation. Mar. Genom. 2012, 5, 7–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Animals 12 00234 g001 550
Figure 1. Multiple amino acids sequence alignment of Elovl5 from different fish species. The transmembrane region of amino acids is represented by a straight line; the conserved motif is marked with a square; the histidine box is marked with an ellipse, and endoplasmic reticulum signal is marked with a double line.
Figure 1. Multiple amino acids sequence alignment of Elovl5 from different fish species. The transmembrane region of amino acids is represented by a straight line; the conserved motif is marked with a square; the histidine box is marked with an ellipse, and endoplasmic reticulum signal is marked with a double line.
Animals 12 00234 g001
Animals 12 00234 g002 550
Figure 2. Multiple amino acids sequence alignment of Elovl8 from different species. The transmembrane region of amino acids is represented by a straight line; the conserved motif is marked with a square; the histidine box is marked with an ellipse, and endoplasmic reticulum signal is marked with a double line.
Figure 2. Multiple amino acids sequence alignment of Elovl8 from different species. The transmembrane region of amino acids is represented by a straight line; the conserved motif is marked with a square; the histidine box is marked with an ellipse, and endoplasmic reticulum signal is marked with a double line.
Animals 12 00234 g002
Animals 12 00234 g003 550
Figure 3. Multiple amino acids sequence alignment of Fads2 from different species. The transmembrane region of amino acids is represented by a straight line; the conserved motif is marked with a square; the histidine box is marked with an ellipse, and endoplasmic reticulum signal is marked with a double line.
Figure 3. Multiple amino acids sequence alignment of Fads2 from different species. The transmembrane region of amino acids is represented by a straight line; the conserved motif is marked with a square; the histidine box is marked with an ellipse, and endoplasmic reticulum signal is marked with a double line.
Animals 12 00234 g003
Animals 12 00234 g004 550
Figure 4. Phylogenetic tree analysis constructed by using the full-length amino acid sequences of Elovl8, Elovl4 and Elovl5. The full-length amino acid sequence of Elovl8, Elovl4 and Elovl5 proteins were extracted from Genbank and analyzed using the maximum likelihood method by Mega x with 1000 bootstrap replications. Elovl2 is regarded as the outgroup. The numbers shown at branches indicated the bootstrap values (%). Our Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ sequence was marked “▲”.
Figure 4. Phylogenetic tree analysis constructed by using the full-length amino acid sequences of Elovl8, Elovl4 and Elovl5. The full-length amino acid sequence of Elovl8, Elovl4 and Elovl5 proteins were extracted from Genbank and analyzed using the maximum likelihood method by Mega x with 1000 bootstrap replications. Elovl2 is regarded as the outgroup. The numbers shown at branches indicated the bootstrap values (%). Our Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ sequence was marked “▲”.
Animals 12 00234 g004
Animals 12 00234 g005 550
Figure 5. Phylogenetic tree analysis constructed by using full-length amino acid sequences of Fads2. The full-length amino acid sequence of Fads2 and Fads1 proteins were extracted from Genbank and analyzed using Maximum Likelihood method by Mega x with 1000 bootstrap replications. The numbers shown at branches indicated the bootstrap values (%). Fads1 is regarded as the outgroup. Our Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ sequence was marked “▲”.
Figure 5. Phylogenetic tree analysis constructed by using full-length amino acid sequences of Fads2. The full-length amino acid sequence of Fads2 and Fads1 proteins were extracted from Genbank and analyzed using Maximum Likelihood method by Mega x with 1000 bootstrap replications. The numbers shown at branches indicated the bootstrap values (%). Fads1 is regarded as the outgroup. Our Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ sequence was marked “▲”.
Animals 12 00234 g005
Animals 12 00234 g006 550
Figure 6. Tissue expression of elovl5, elovl8 and fads2 genes in hybrid grouper. Results are expressed as mean standard error (n = 4). Different letters above the bars denote significant (p < 0.05) differences among tissues.
Figure 6. Tissue expression of elovl5, elovl8 and fads2 genes in hybrid grouper. Results are expressed as mean standard error (n = 4). Different letters above the bars denote significant (p < 0.05) differences among tissues.
Animals 12 00234 g006
Animals 12 00234 g007 550
Figure 7. Relative mRNA expression of elovl5, elovl8 and fads2 in liver of hybrid grouper fed diets with different levels of n-3 LC-PUFA. Results are expressed as means standard error (n = 3). Different letters above the bars denote significant (p < 0.05) differences among dietary groups.
Figure 7. Relative mRNA expression of elovl5, elovl8 and fads2 in liver of hybrid grouper fed diets with different levels of n-3 LC-PUFA. Results are expressed as means standard error (n = 3). Different letters above the bars denote significant (p < 0.05) differences among dietary groups.
Animals 12 00234 g007
Table
Table 1. Primers used for sequencing and qRT-PCR analysis of elovl5, elovl8 and fads2 from hybrid grouper.
Table 1. Primers used for sequencing and qRT-PCR analysis of elovl5, elovl8 and fads2 from hybrid grouper.
Primer NameSequence (5′-3′)UsageTMExpected Amplicon Size
Elovl5 FACCTTCTAATCGTGTGGATGPartial sequence51.9 °C648 bp
Elovl5 RTGTGCTTCTTGTAAGTCTGAPartial sequence51.3 °C
Elovl5 5FAAGCAGTGGTATCAACGCAGAGT5’-RACE59 °C383 bp
Elovl5 5RTCCACTTCCTGTGCACTGTGAGTGTC5’-RACE62.8 °C
Elovl5 3FCACACTCATCTTCCTCTTCTCAAACTT3’-RACE57.3 °C466 bp
Elovl5 3R1CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT3’-RACE68 °C
Elovl5 3R2CTAATACGACTCACTATAGGGC3’-RACE51.8 °C
Elovl8 FATGGCTGCTGGTCTACTCPartial sequence53.3 °C677 bp
Elovl8 RAGTTACTGAAGAGGATGATGAGPartial sequence51.4 °C
Elovl8 5FAAGCAGTGGTATCAACGCAGAGT5’-RACE59 °C608 bp
Elovl8 5RGGTGCCGTGGTGGTAAACATGAAGG5’-RACE62.5 °C
Elovl8 3FATGCAGAAGTACCTGTGGTGGAAGAGA3’-RACE61.4 °C538 bp
Elovl8 3R1CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT3’-RACE68 °C
Elovl8 3R2CTAATACGACTCACTATAGGGC3’-RACE51.8 °C
Fads2 FCACTACGCTGGAGAGGATGPartial sequence55.2 °C608 bp
Fads2 RTGGTGTTGGTGATGATAGGPartial sequence51.4 °C
Fads2 5FAAGCAGTGGTATCAACGCAGAGT5’-RACE59 °C476 bp
Fads2 5RCTCCGTGGCATCCTCTCCAGCGTAGT5’-RACE65.6 °C
Fads2 3FCATTTCCAGCATCACGCTAAACCCAAC3’-RACE60 °C1117 bp
Fads2 3R1CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT3’-RACE68 °C
Fads2 3R2CTAATACGACTCACTATAGGGC3’-RACE51.8 °C
elongation factor 1 alpha FAGGGATGGAAGATTGAGCGCInternal control57.2 °C74 bp
elongation factor 1 alphaRCGTACCGGGCTTCAGGATACInternal control57 °C
Elovl8 RT-FCAGATGATCCAGTTCCACGTCAqRT-PCR56.8 °C525 bp
Elovl8 RT-RGCGGTAGGTCTGGTAGTAGAAGqRT-PCR56.1 °C
Elovl5 RT-FCTACTGCCAGGACACTCACAqRT-PCR56 °C415 bp
Elovl5 RT-RGAGGCGCCAAAGTATGAGTGqRT-PCR56 °C
Fads2 RT-FCCAGGTGGAGGCAGAAGAACAqRT-PCR58.8 °C184 bp
Fads2 RT-RAGCCACTATGCTGGAGAGGATGqRT-PCR58.2 °C
Elovl8 AFAGCGTGCTCACTCACTTTTAACGGORF validation57 °C933 bp
Elovl8 ARGTGTGCTTCTGCCTTCTCCATCCTTORF validation59 °C
Elovl5 AFGTCGCTTTCTCTCCCCCGCCTCTCAORF validation64 °C953 bp
Elovl5 ARCTACAGTGAGAATTGGGTGGCGGTTTORF validation60 °C
Fads2 AFGCCAAAATCTGGATACTGTGTCAAAORF validation54 °C1628 bp
Fads2 ARAAGACACTGTAAGGCAACCAGAGAAAORF validation56 °C
Table
Table 2. Formulation and proximate analysis of the experimental diets.
Table 2. Formulation and proximate analysis of the experimental diets.
Ingredients (g/100 g Diet)Dietary n-3 PUFA Levels
0.531.192.69
Fish meal 1222222
Pork blood meal 26.06.06.0
Chicken meal 3181818
Casein 417.517.517.5
Palm oil 53.412.530.66
DHA purified oil 60.20.731.87
EPA purified oil 700.351.08
Vitamin premix 8111
Mineral Premix 90.50.50.5
Starch161616
Cellulose13.413.413.4
Crude protein53.353.453.6
Crude lipid7.126.937.1
n-3 PUFA0.531.192.69
1 Yongsheng Feed Co., Ltd (Binzhou, Zhejiang province, China). Proximate composition (%Dry matter): Moisture, 7.43; Crude protein, 73.3; Crude lipid, 5.1; 2 Zhejiang Sonak Company (Chaozhou, Zhejiang province, China). Proximate composition (%Dry matter): Moisture, 6.46; Crude protein, 98.53; Crude lipid, 0.02; 3 Dalian Xin Ruisen Trading Company (Dalian, Liaoning province, China). Proximate composition (%Dry matter): Moisture, 4.38; Crude protein, 68.77; Crude lipid, 12.6; 4 Gansu Hualing Dairy Products Co., Ltd (Hezuo, Gansu province, China). Proximate composition (%Dry matter): Moisture, 4.38; Crude protein, 93.80; 5 Tianjin Julong Cereals and Oils Co., Ltd (Tianjin, China).; 6 Shaanxi Guanchen Biological Co., Ltd (Xian, Shaanxi province, China). Proximate composition (%Dry matter): Dh 75.1; EPA 4.8; 7 Shaanxi Guanchen Biological Co., Ltd (Xian, Shaanxi province, China). Proximate composition (%Dry matter): DHA 5.1; EPA 74.9; 8 Vitamin premix (mg/g premix): thiamin hydrochloride, 2.5; riboflavin, 10; calcium pantothenate, 25; nicotinic acid, 37.5; pyridoxine hydrochloride, 2.5; folic acid, 0.75; inositol, 100; ascorbic acid, 50; choline chloride, 250; menadione, 2; alpha-tocopheryl acetate, 20; retinol acetate, 1; cholecalciferol, 0.0025; biotin, 0.25; vitamin B12, 0.05. All ingredients were supplemented to 1 g with alpha cellulose; 9 Mineral Premix (mg/g mixture): calcium lactate, 327; K2PO4, 239.8; CaHPO4·2H2O, 135.8; MgSO4·7H2O, 132; Na2HPO4·2H2O, 87.2; NaCl, 43.5; ferric citrate, 29.7; ZnSO4·7H2O, 3; CoCl2·6H2O, 1; MnSO4·H2O, 0.8; KI, 0.15; AlCl3·6H2O, 0.15; CuCl2, 0.1; Note: The data represent the average of repeated samples.
Table
Table 3. Fatty acid composition of experimental diets. The results are expressed as the average of repeated samples; SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: highly unsaturated fatty acid.
Table 3. Fatty acid composition of experimental diets. The results are expressed as the average of repeated samples; SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: highly unsaturated fatty acid.
Fatty AcidDietary n-3 PUFA Levels
0.531.192.69
14:01.011.272.04
16:028.1823.5510.16
18:010.268.759.40
16:1n-90.972.123.18
18:1n-70.800.870.91
18:1n-920.7517.3319.48
20:1n-90.110.110.21
22:1n-90.110.100.10
18:2n-6 (LA)18.1313.065.99
18:3n-60.410.320.30
20:2n-60.100.200.31
20:4n-6 (ARA)1.061.070.99
18:3n-3 (ALA)1.071.001.01
20:5n-3 (EPA)2.996.6915.12
22:6n-3 (DHA)4.6110.2823.29
∑SFA39.4533.5721.60
∑MUFA22.7320.5423.87
∑n-3 PUFA7.6016.9738.41
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wu, Q.; Zheng, Z.; Wang, C.; Wang, Y.; Sun, Y.; Gao, Y. Molecular Characterization, Tissue Distribution and Differential Nutritional Regulation of Three n-3 LC-PUFA Biosynthesis-Related Genes in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Animals 2022, 12, 234. https://doi.org/10.3390/ani12030234

AMA Style

Wu Q, Zheng Z, Wang C, Wang Y, Sun Y, Gao Y. Molecular Characterization, Tissue Distribution and Differential Nutritional Regulation of Three n-3 LC-PUFA Biosynthesis-Related Genes in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Animals. 2022; 12(3):234. https://doi.org/10.3390/ani12030234

Chicago/Turabian Style

Wu, Qingjun, Zhi Zheng, Chuijin Wang, Yao Wang, Yuejia Sun, and Yujie Gao. 2022. "Molecular Characterization, Tissue Distribution and Differential Nutritional Regulation of Three n-3 LC-PUFA Biosynthesis-Related Genes in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂)" Animals 12, no. 3: 234. https://doi.org/10.3390/ani12030234

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop