pISSN 0513-5796   eISSN 1976-2437
Open Access, Peer-reviewed, Monthly
    Yonsei Med J. 2008 Feb;49(1):58-62. English.
    Published online Feb 20, 2008.
    https://doi.org/10.3349/ymj.2008.49.1.58
    Copyright © 2008 The Yonsei University College of Medicine
    Original Article

    Rarity of TLR4 Asp299Gly and Thr399Ile Polymorphisms in the Korean Population

    Yeun Sun Kim,1 You Jin Hwang,2 Sung Yong Kim,1 Sun Mee Yang,1 Ki Young Lee,1 and Ie Byung Park1
      • 1Department of Endocrinology, Gachon University of Medicine and Science, Gil Medical Center, Incheon, Korea.
      • 2Division of Biological Science, Gachon University of Medicine and Science, Incheon, Korea.
    • Reprint address: requests to Dr. Ie Byung Park, Department of Endocrinology, Gil Medical Center, Gachon University of Medicine and Science, 1198 Guwol-dong, Namdong-gu, Incheon 405-760, Korea. Tel: 82-32-460-2188, 82-32-460-3235, Fax: 82-32-469-4320, Email: park712@gilhospital.com
    Received May 30, 2007; Accepted August 06, 2007.

    This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

    Abstract

    Purpose

    Activation of the innate immune system and chronic low-grade inflammation are thought to be involved in the pathogenesis of atherosclerosis and also thought to be associated with type 2 diabetes and its complications. As a receptor for bacterial lipopolysaccharide and heat-shock proteins, Toll-like receptor 4 (TLR4) is one of the central regulators of the immune response. Recent studies have reported an association between TLR4 polymorphisms and diabetes and its complications in Caucasian populations.

    Materials and Methods

    In this study, we analyzed the association between TLR4 gene polymorphisms in patients with features of type 2 diabetes and healthy controls in Korea. Two polymorphisms of the TLR4 gene (Asp299Gly and Thr399Ile) were examined in 225 diabetic patients and 153 healthy controls using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and single-strand conformation polymorphism (SSCP).

    Results

    No Asp299Gly or Thr399Ile mutations were detected in any of the 378 subjects. Seven subjects from each group who had slightly different SSCP patterns were selected for sequencing, but we found no TLR4 polymorphisms on Exon3. The Asp299Gly and Thr399Ile TLR4 gene polymorphisms were absent in both groups, which was similar to the results for Japanese and Chinese Han subjects.

    Conclusion

    Our data and other Asian data suggest that a racial difference can be found in the frequency of the TLR4 polymorphism.

    Keywords
    Type 2 diabetes; TLR4; polymorphism; inflammation; innate immunity

    INTRODUCTION

    A homologous family of toll receptors, the toll-like receptors (TLRs), was discovered in 1997.1 TLRs serve as pattern-recognition receptors in mammals and play a critical role in the recognition of microbial components, such as lipopolysaccharides (LPSs), which initiate the innate immune response.1 TLR4, a member of the TLR family, is expressed on cardiomyocytes, macrophages, airway epithelium, and endothelial and smooth muscle cells.2, 3 TLR4 interacts with endogenous ligands, including oxidized low-density lipoprotein, heat-shock proteins 60 and 70, fibrinogen, and fibronectin, which are elevated in diabetic patients,4-8 as well as with exogenous ligands, such as LPS.2, 9-12 Twenty-nine single nucleotide polymorphisms (SNPs) have been identified in the human TLR gene.13 Of these, the Asp299Gly and 399 Thr399Ile polymorphisms have been shown to cause hyporesponsiveness to LPS in human alveolar macrophages and airway epithelial cells.14 Individuals carrying the Asp299Gly TLR4 allele have lower levels of proinflammatory cytokines, acute-phase reactants, and soluble adhesion molecules, such as interleukin 6 and fibrinogen.15 Countering the increased risk of severe bacterial infection, they have a lower risk of carotid atherosclerosis and smaller intima-media thickness in the common carotid artery.15

    Many studies have suggested that activation of the innate immune system is closely associated with type 2 diabetes. The circulating inflammatory markers interleukin 6, acute-phase reactants, and especially C-reactive protein, have been shown to predict the development of type 2 diabetes.16-20

    Studies have analyzed the association between TLR4 polymorphisms and the features of type 2 diabetes. Although one study reported a poor relationship,21 a recent study of 776 Caucasians, including 246 with type 1 diabetes and 530 with type 2 diabetes, indicated that 68 of those with type 2 diabetes were heterozygous for the Asp299Gly polymorphism (carrier rate (CR) 12.8%, allelic frequency (AF) 6.4%), 67 of them were heterozygous for the TLR4 Thr399Ile polymorphism (CR 12.6%, AF 6.3%), and the type 2 diabetic subjects showed a strong association between the Asp299Gly/TLR4 Thr399Ile polymorphism and diabetic neuropathy.22 Since only one other previous study has examined the TLR4 polymorphism in ethnic Korean subjects,23 we analyzed the association between the TLR4 polymorphism and features of type 2 diabetes in Koreans.

    MATERIALS AND METHODS

    The study groups consisted of 378 Korean subjects: 225 had type 2 diabetes (mean age, 54.5 ± 10.0 years; 114 women and 111 men) and 153 were controls (mean age 46.1 ± 12.9 years; 77 women and 76 men). The diabetic patients were recruited from the outpatient clinic of the Department of Endocrinology, Gachon University of Medicine and Science, Gil Medical Center, Incheon, Korea. To be representative of the controls in Korea, we selected people who were recruited from the health care center during the same study period and whose age was between 20 - 70 years old to cover all age groups. Physical examinations and laboratory testing was performed on all patients (Table 1).

    Table 1
    Basal Characteristics of Patients with type 2 Diabetes and Normal Controls

    PCR

    DNA from both patients and controls was extracted from peripheral white blood cells using the standard method. The PCR primers for Asp299Gly and TLR4 Thr399Ile had the following sequences:

    TLR4 Asp299Gly: forward 5'GATTAGCATACTTAGACTACTACCTCCATG3'

    reverse 5'GATCAACTTCTGAAAAAGCATTCCCAC3',

    TLR4 Thr399Ile: forward 5'GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA3'

    reverse 5'ACCTGAAGACTGGAGAGTGAGAGTTAAATGCT3'.

    In total, 50 ng DNA were amplified in a 20-µL volume containing 0.4 µL primer, 1 µL DNA extract, 0.4 µL Taq polymerase (Takara Bio, Otsu, Japan), 2 µL 10 × PCR buffer, and 2 µL dNTPs. Amplification consisted of two initial cycles at 94℃ for 30 s, 52℃ for 1 min, and 72℃ for 1 min, followed by 30 cycles at 94℃ for 30 s, 55℃ for 30 s, and 72℃ for 30 s, followed by 5 min at 72℃, and ending at 10℃.

    Restriction enzymes

    To screen for the TLR4 Asp299Gly and Thr 399Ile polymorphisms, the sequence was cleaved using NcoI and HinfI restriction endonucleases, respectively. Eight microliters of PCR product were treated with 0.5 µL restriction endonuclease, and a drop of mineral oil was added. The mixture was incubated at 37℃ for 24 h, and then electrophoresed on 2.5% NuSieve® GTG (GeneFrontier, Tokyo, Japan) and Seakem® LE agarose gels (GeneFrontier) at 100 V for 30 min.

    SSCP (Single Strand Conformation Polymorphism)

    To locate the TLR4 Asp299Gly polymorphism, the PCR product was subjected to an SSCP study. A mixture of 8 µL of SSCP solution and 2 µL of PCR product was heated at 94℃ for 5 min and then iced for 2 min. The product was run on a 10% acrylamide gel at 150 V for 1.5 h and stained using a Silverstar® Staining Kit (Bioneer, Daejeon, Korea).

    DNA sequencing

    Samples with different SSCP patterns were selected, and the PCR products were sequenced with the TLR4 Asp299Gly forward primer using a commercial service (Macrogen®, Seoul, Korea).

    RESULTS

    PCR DNA from type 2 diabetic patients using the TLR4 Asp299Gly and TLR4 Thr399Ile primers was not cut by the NcoI or HinfI restriction endonucleases. No TLR4 Asp299Gly or Thr399Ile polymorphisms were detected in the type 2 diabetics.

    We examined the SSCP band patterns from the DNA of 225 type 2 diabetics and 153 controls. Seven SSCP bands from the 225 diabetic patients and 7 of the 153 controls differed slightly from the others. Therefore, we sequenced these 14 DNA samples but detected no Asp299Gly polymorphisms at the TLR4 Exon 3 (Fig. 1).

    Fig. 1
    The sequencing results for the samples in diabetic patients (A) and normal controls (B). The sequencing results in all lanes were homozygous for adenine at position 896. No GAT(Asp)→GGT(Gly) substitution was observed.

    DISCUSSION

    Many studies in Caucasians suggest that the Asp299Gly polymorphism is associated with innate immunity-related diseases, such as chronic inflammatory disease and atherosclerosis.15, 24, 25 Therefore, association with the TLR4 polymorphism has been analyzed in type 2 diabetics with features of mild systemic inflammation. Rudosky et al. reported that the Asp 299Gly and Thr399Ille genotypes of the TLR4 gene are associated with a reduced prevalence of diabetic neuropathy in type 2 diabetes.21 In contrast, the Asp299Gly polymorphism was reported to be very rare in several studies of Asian ethic groups.26-29 Therefore, we examined the ethnic differences in the TLR4 polymorphism and its association with type 2 diabetes, but were unable to find Asp299Gly and Thr399Ile polymorphisms in 378 Korean subjects (225 type 2 diabetics, and 153 controls).

    Hang et al. failed to detect any homozygous or heterozygous variant genotypes of the Asp299Gly and Thr399Ile polymorphisms in 491 Han Chinese subjects, consisting of cotton and silk textile workers who were exposed to endotoxins.26 In addition, no Asp299Gly polymorphisms were detected in ethnic Chinese patients in a study that analyzed the association of ischemic stroke with the TLR4 gene polymorphism27 (although one TLR4 gene C119A was found). A study on polymorphisms of the TLR4 and CD 14 genes in ulcerative colitis patients revealed no TLR4 Asp299Gly mutation in any Chinese patients or healthy controls but detected mutations in 10% of the Caucasian Dutch subjects.28 Of 411 Japanese subjects, including 197 critically ill patients and 214 healthy controls, no TLR4 Asp299Gly or Thr399Ile polymorphisms were detected.29

    Even among Caucasian subjects, some studies have suggested that the TLR4 Asp299Gly polymorphism is not related to conditions such as rheumatoid arthritis and systemic lupus erythematosus30 or even the incidence of myocardial infarction (MI) and stroke in a large prospective study of US men.31 Yang et al. reported that the TLR4 polymorphism was not related to the severity of atopy in asthmatics33 or that of coronary artery stenosis in 695 patients with atherosclerotic MI.33 Moreover, the TLR4 Asp299Gly variant had no influence on LPS responsiveness or the susceptibility to pulmonary tuberculosis in a study in Gambia.34

    In conclusion, Asp299Gly and Thr399Ile TLR4 gene polymorphisms were not found in diabetic patients and healthy controls in a Korean population, findings that are similar to those for Japanese and Chinese Han subjects. Therefore, our data and other Asian data suggest that a racial difference can be found in the frequency of the TLR4 polymorphism.

    Notes

    This study was supported by a research grant from the Gil Medical Center, Gachon University of Medicine and Science.

    References

      1. Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:394–397.
      1. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol 2001;2:675–680.
      1. Zarember KA, Godowski PJ. Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbe, their products, and cytokines. J Immunol 2002;168:554–561.
      1. Chen S, Mukherjee S, Chakraborty C, Chakrabarti S. High glucose-induced, endothelin-dependent fibronectin synthesis is mediated via NF-kappa B and AP-1. Am J Physiol Cell Physiol 2003;284:C263–C272.
      1. Streja D, Cressey P, Rabkin SW. Associations between inflammatory markers, traditional risk factors, and complications in patients with type 2 diabetes mellitus. J Diabetes Complications 2003;17:120–127.
      1. Carr ME. Diabetes mellitus: a hypercoagulable state. J Diabetes Complications 2001;15:44–54.
      1. Yabunaka N, Ohtsuka Y, Watanabe I, Noro H, Fujisawa H, Agishi Y. Elevated levels of heat-shock protein 70 (HSP70) in the mononuclear cells of patients with non-insulin-dependent diabetes mellitus. Diabetes Res Clin Pract 1995;30:143–147.
      1. Keren P, George J, Shaish A, Levkovitz H, Janakovic Z, Afek A, et al. Effect of hyperglycemia and hyperlipidemia on atherosclerosis in LDL receptor-deficient mice: establishment of a combined model and association with heat shock protein 65 immunity. Diabetes 2000;49:1064–1069.
      1. Smiley ST, King JA, Hancock WW. Fibrinogen stimulates macrophage chemokine secretion through toll-like receptor 4. J Immunol 2001;167:2887–2894.
      1. Termeer C, Benedix F, Sleeman J, Fieber C, Voith U, Ahrens T, et al. Oligosaccharides of Hyaluronan activate dendritic cells via toll-like receptor 4. J Exp Med 2002;195:99–111.
      1. Ohashi K, Burkart V, Flohé S, Kolb H. Cutting edge: heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex. J Immunol 2000;164:558–561.
      1. Sasu S, LaVerda D, Qureshi N, Golenbock DT, Beasley D. Chlamydia pneumoniae and chlamydial heat shock protein 60 stimulate proliferation of human vascular smooth muscle cells via toll-like receptor 4 and p44/p42 mitogen-activated protein kinase activation. Circ Res 2001;89:244–250.
      1. Raby BA, Klimecki WT, Laprise C, Renaud Y, Faith J, Lemire M, et al. Polymorphisms in toll-like receptor 4 are not associated with asthma or atopy-related phenotypes. Am J Respir Crit Care Med 2002;166:1449–1456.
      1. Arbour NC, Lorenz E, Schutte BC, Zabner J, Kline JN, Jones M, et al. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet 2000;25:187–191.
      1. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E, et al. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med 2002;347:185–192.
      1. Pickup JC, Crook MA. Is type II diabetes mellitus a disease of the innate immune system? Diabetologia 1998;41:1241–1248.
      1. Pickup JC, Mattock MB, Chusney GD, Burl D. NIDDM as a disease of the innate immune system: association of acute-phase reactants and interleukin-6 with metabolic syndrome X. Diabetologia 1997;40:1286–1292.
      1. Pradhan AD, Manson JE, Rifai N, Buring JE, Ridker PM. C-reactive protein, interleukin 6, and risk of developing type 2 diabetes mellitus. JAMA 2001;286:327–334.
      1. Temelkova-Kurktschiev T, Henkel E, Koehler C, Karrei K, Hanefeld M. Subclinical inflammation in newly detected Type II diabetes and impaired glucose tolerance (Letter). Diabetologia 2000;45:151.
      1. Freeman DJ, Norrie J, Caslake MJ, Gaw A, Ford I, Lowe GD, et al. C-reactive protein is an independent predictor of risk for the development of diabetes in the West of Scotland Coronary Prevention Study. Diabetes 2002;51:1596–1600.
      1. Illig T, Bongardt F, Schöpfer A, Holle R, Müller S, Rathmann W, et al. The endotoxin receptor TLR4 polymorphism is not associated with diabetes or components of the metabolic syndrome. Diabetes 2003;52:2861–2864.
      1. Rudofsky G Jr, Reismann P, Witte S, Humpert PM, Isermann B, Chavakis T, et al. Asp299Gly and Thr 399Ile genotypes of the TLR4 gene are associated with a reduced prevalence of diabetic neuropathy in patients with type 2 diabetes. Diabetes Care 2004;27:179–183.
      1. Yoon HJ, Choi JY, Kim CO, Park YS, Kim MS, Kim YK, et al. Lack of Toll-like receptor 4 and 2 polymorphisms in Korean patients with bacteremia. J Korean Med Sci 2006;21:979–982.
      1. Hollestelle SC, De Vries MR, Van Keulen JK, Schoneveld AH, Vink A, Strijder CF, et al. Toll-like receptor 4 is involved in outward arterial remodeling. Circulation 2004;109:393–398.
      1. Boekholdt SM, Agema WR, Peters RJ, Zwinderman AH, van der Wall EE, Reitsma PH, et al. Variants of toll-like receptor 4 modify the efficacy of statin therapy and the risk of cardiovascular events. Circulation 2003;107:2416–2421.
      1. Hang J, Zhou W, Zhang H, Sun B, Dai H, Su L, et al. TLR4 Asp299Gly and Thr399Ile polymorphisms are very rare in the Chinese population. J Endotoxin Res 2004;10:238–240.
      1. Lin YC, Chang YM, Yu JM, Yen JH, Chang JG, Hu CJ. Toll-like receptor 4 gene C119A but no Asp299Gly polymorphism is associated with ischemic stroke among ethnic Chinese in Taiwan. Atherosclerosis 2005;180:305–309.
      1. Guo QS, Xia B, Jiang Y, Morré SA, Cheng L, Li J, et al. Polymorphisms of CD14 gene and TRL 4 gene are not associated with ulcerative colitis in Chinese patients. Postgrad Med J 2005;81:526–529.
      1. Nakada TA, Hirasawa H, Oda S, Shiga H, Matsuda K, Nakamura M, et al. Influence of toll-like receptor 4, CD14, tumor necrosis factor, and interleukine-10 gene polymorphisms on clinical outcome in Japanese critically ill patients. J Surg Res 2005;129:322–328.
      1. Sánchez E, Orozco G, López-Nevot MA, Jiménez-Alonso J, Martín J. Polymorphisms of toll-like receptor 2 and 4 genes in rheumatoid arthritis and systemic lupus erythematosus. Tissue Antigens 2004;63:54–57.
      1. Zee RY, Hegener HH, Gould J, Ridker PM. Toll-like receptor 4 Asp299Gly gene polymorphism and risk of atherothrombosis. Stroke 2005;36:154–157.
      1. Yang IA, Barton SJ, Rorke S, Cakebread JA, Keith TP, Clough JB, et al. Toll-like receptor 4 polymorphism and severity of atopy in asthmatics. Genes Immun 2004;5:41–45.
      1. Yang IA, Holloway JW, Ye S. TLR4 Asp299Gly polymorphism is not associated with coronary artery stenosis. Atherosclerosis 2003;170:187–190.
      1. Newport MJ, Allen A, Awomoyi AA, Dunstan SJ, McKinney E, Marchant A, et al. The toll-like receptor 4 Asp299Gly variant: no influence on LPS responsiveness of susceptibility to pulmonary tuberculosis in The Gambia. Tuberculosis (Edinb) 2004;84:347–352.
    Cited by
    Crossref 28
    Google Scholar 
    PubMed Central 12
    Scopus 35
    Web of Science 35
    MeSH Terms
    Adult
    Amino Acids/genetics
    Base Sequence
    Female
    Humans
    Korea
    Male
    Middle Aged
    Molecular Sequence Data
    Mutation/genetics
    Polymorphism, Genetic/genetics*
    Toll-Like Receptor 4/genetics*
    Metrics
    Share
    Links to
    Figures
    slide

    1 / 1

    Tables
    slide

    1 / 1

    PERMALINK