HLA-DQ2 and HLA-DQ8 Alleles in Celiac Disease Patients and Healthy Controls

By Mustajab Alam¹, Hamid Nawaz Tipu¹, Dawood Ahmad¹, Muhammad Hussain¹, Usama Bin Khalid²,         Yumna Ijaz¹

Affiliations

1. Department of Immunology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, Pakistan
2. Department of Chemical Pathology and Endocrinology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, Pakistan

doi: 10.29271/jcpsp.2022.02.157

ABSTRACT
Objective: To compare HLA-DQ2 and HLA-DQ8 alleles between celiac disease patients and healthy control group.
Study Design: Observational cross-sectional study.
Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology (AFIP), from April to December 2018.
Methodology: Subjects were included: 100 celiac disease patients selected by non-probability consecutive sampling, and 100 healthy subjects. After collecting peripheral blood in EDTA tubes, chromosomal DNA was extracted and amplified, using sequence specific primers. Post-amplification electrophoresis was performed on two per cent agarose gel, followed by ethidium bromide staining; and specific band patterns were recorded under ultraviolet illumination to determine the HLA-DQ alleles. The subtypes of HLA-DQ2, i.e. HLA-DQ2.5 and HLA-DQ2.2 were also assessed. Frequency, percentage, mean and SD were calculated. Post-stratification Chi-square test was applied.
Results: The mean age of celiac disease group and healthy subjects was 14.79 ± 5.32 years and 14.71 ± 5.21 years, respectively. The frequency of HLA-DQ2 and HLA-DQ8 among celiac disease patients was 93% and 4%, respectively. Among HLA-DQ2 positive, HLA-DQ2.5 and HLA-DQ2.2 were found in 92% and 8%, respectively. Statistically significant difference (p <0.05) was observed between the celiac disease patients and healthy group. There was no significant difference observed among different age groups and gender (p >0.05).
Conclusion: HLA-DQ2 detection reliably diagnoses celiac disease among all age groups and either gender. It can be used as an effective marker for early diagnosis of celiac disease instead of invasive procedures such as intestinal biopsy. The diagnosis can be pin-pointed by presence of HLA-DQ2.5.

Key Words: Celiac disease, HLA-DQ2, HLA-DQ8, HLA-DQ2.5, HLA-DQ2.2.

INTRODUCTION

Celiac disease (CD) is a chronic autoimmune intestinal condition that is caused by immune-mediated enteropathy, triggered by ingested prolamins, commonly called gluten, found in wheat, barley and rye. CD is one of the most common genetic diseases arising from environmental factors (gluten) as well as genetic factors (HLA and non-HLA genes).¹ Initially thought to affect white Europeans exclusively, CD is now considered to be distributed globally.^2,3  In the population of European origin, CD is one of the most common life-long disorders, affecting approximately 1% of the general population.

In North Africa, Middle-East and South-East Asia, the incidence of CD is rising. The enormous prevalence of CD in some American communities (5.6-11.1%) is possibly due to their strong genetic predisposition and sudden dietary changes over the last few centuries.⁴ The prevalence of HLA-DQ2 and HLA-DQ8 in patients of celiac disease found in the literature is mostly from developed countries.⁵

Gastrointestinal symptoms (chronic diarrhea, abdominal pain, distension, bloating, weight loss, vomiting and constipation) confirmed by a small bowel biopsy (SBB) which shows villous atrophy, crypt hyperplasia and an increase in intra-epithelial lymphocytes and normalisation of these findings in response to a gluten-free diet are the classical features of CD. Previously, CD was predominantly considered to be a childhood disease. However, the clinical symptoms have become subtler with the delay in the introduction of wheat into infant diet; and diagnosis is now usually made in older children and adults. The capricious clinical picture of CD is due to the fact that genetic and immunological bases both influence the clinical presentation of the disease, age of commencement, degree of mucosal damage, dietary behaviours and gender.^6,7

Table I: The specifications of sequence specific primers (SSP) used in PCR reaction.

HLA	5’ Primer	Sequence	3’ Primer	Sequence	Size of PCR Product	Amplified HLA-DQ alleles
HLADQ2.2	B-5’07	GTGCGTCTTGTGAGCAGAAG	B-3’07	GCAAGGTCGTGCGGAGCT	205bp	DQB1*0201
HLADQ2.5	A-5’02	ACGGTCCCTCTGGCCAGTA	A-3’05	AGTTGGAGCGTTTAATCAGAC	186bp	DQA1*0501
HLADQ8	A-5’06	TTCACTCGTCAGCTGACCAC	A-3’03	CAAATTGCGGGTCAAATCTTCT	183bp	DQA1*0302

Table II: Stratification of HLADQ2 among disease group and healthy subjects with respect to age and gender.

Age (years)	HLADQ2 in disease group		p-value (HLA-DQ2 positive cases)	Age (years)	HLA-DQ2 in healthy group		p-value (HLA-DQ2 positive cases)
	Present	Absent			Present	Absent
1-18 (n=79)	73 (92.4%)	6 (7.6%)	0.651	1-18 (n=77)	12 (15.58%)	65 (84.42%)	0.071
>18 (n=21)	20 (95.2%)	1(4.8%)		>18 (n=23)	8 (34.79%)	15 (65.21%)
Total	93(93%)	7(7%)		Total (100)	20 (20 %)	80 (80 %)
Gender			p-value	Gender			p-value
Male (n=50)	44(88%)	6(12%)	0.050	Male (n=50)	11 (22%)	39(78%)	0.617
Female (n=50)	49(98%)	1(2%)		Female (n=50)	9(18%)	41 (82%)
Total	93(93%)	7(7%)		Total	20 (20%)	80 (80%)

Table III: Stratification of HLA-DQ8 among diseased and healthy subjects with respect to age and gender.

Age (years)	HLADQ8 disease group		p-value (HLA-DQ8 positive cases)	Age (years)	HLA-DQ8 healthy group		p-value (HLA-DQ8  positive cases)
	Present	Absent			Present	Absent
1-18 (n=79)	4(5.1%)	75 (94.9%)	0.841	1-18 (n=77)	2 (2.59%)	75 (97.41%)	0.435
>18 (n=21)	0(0%)	21(100%)		>18 (n=23)	0 (0%)	23 (100%)
Total 100	4(4%)	96(96%)		Total 100	2 (2%)	98 (98%)
Gender			0.307	Gender			1.000
Male (n=50)	3(6%)	47(94%)		Male (n=50)	1 (2%)	49 (98%)
Female (n=50)	1(2%)	49(98%)		Female (n=50)	1 (2%)	49 (98%)
Total	4(4%)	96(96%)		Total	2 (2%)	98 (98%)

Figure 1: The bands of HLA-DQ2 (top left) HLA-DQ8 (top right), HLA-DQ2.2 (bottom left) and HLA-DQ2.5 (bottom right) as seen under UV illumination. SB = Specific allele band, IC = Internal control.

Typing HL-ADQ is now known as a valuable method to diagnose difficult cases of celiac disease or as an alternative to intrusive biopsy.⁸ The European Society of Pediatric Gastroenterology, Hepatology and Nutrition (ESPGHAN) recommends analysis of HLA-DQ2 and HLA-DQ8 for diagnosis of CD. In Pakistan, while the association of HLADRB1 with celiac disease was previously determined, the data is scanty on the frequency of HLA-DQ in CD patients and their association thereof. In addition, their effectiveness is limited by trivial number of patients and the use of less responsive methods, like anti-gliadin and anti-reticulin antibodies. Hence, evaluating the prevalence of HLA-DQ2 and HLA-DQ8 in celiac patients in this population would help to determine its usefulness in the diagnosis of difficult cases and avoid the need for invasive duodenal biopsy.

The aim of this study was to find the association of HLA-DQ2 and HLA-DQ8 with celiac disease in symptomatic patients and the subtypes of HLA-DQ2, i.e. HLA-DQ2.5 and HLA-DQ2.2 in HLA-DQ2 positive individuals.

METHODOLOGY

Approval was taken from the Institutional Ethical Committee to perform this research. This cross-sectional study was conducted at the Department of Immunology, Armed Forces Institute of Pathology (AFIP), from April to December 2018. Non-probability consecutive sampling technique was employed for sampling. Informed consent was obtained from the study participants. The data were obtained on a pre-designed questionnaire, including information related to their demographic characteristics and laboratory findings. The information was kept in a password-protected database and strict confidentiality was preserved.

Sample size was calculated by WHO calculator at 95% confidence interval, 5% margin of error, and disease prevalence at 1%.⁹ Two hundred subjects were included; 100 celiac disease patients were selected on the basis of age greater than or equal to one year, belonging to either gender, with clinical features suggestive of celiac disease and anti-TTG (IgA) antibody levels ten times the upper reference limit. The patients having type 1 diabetes mellitus, including those having family history of type 1 DM, the patients having anti-TTG (IgA) levels less than ten times the upper limit, and known patients of IgA deficiency were excluded from the study. One hundred age and gender matched healthy subjects were selected from bone marrow and renal transplant donors.

The blood samples were collected by venipuncture from peripheral veins in EDTA containing tubes. Chromosomal DNA was extracted according to the manufacturer's directions, (Puregene^® Blood Core Kit B; QIAGEN). The concentration of DNA was adjusted to 100 ng/µl. Using sequence specific primers (SSPs) for HLA-DQ2 and HLA-DQ8, DNA was amplified on GeneAMP^® PCR system 9700. The conditions used for PCR were: initial denaturation at 95⁰C for 5 minutes, followed by annealing at 58⁰C for one minute and extension at 72⁰C for 10 minutes. The sequence specific primers (SSP) are described in Table I. Internal controls (IC) available with the commercial kits were run with each test during the process of PCR and electrophoresis for validation of results.

Electrophoresis was done on 2% agarose gel for DNA, followed by staining with ethidium bromide for 30 minutes. The alleles of HLA-DQ were ascertained by documenting specific band patterns seen on the gel under ultraviolet radiance.

Statistical package for social sciences (SPSS) version 23.0 was used to measure quantitative and qualitative variables. For categorical variables, DQ2 and DQ8 frequency and percentages were calculated. Mean + SD were calculated for age. Stratification was done for age and gender for controlling the effect changers. Chi-square test was used to see any significant difference between the groups. Statistically significant level was set at p ≤0.05.

RESULTS

Celiac disease group had mean age of 14.79 ± 5.32 years, while healthy subjects had mean age of 14.71± 5.21 years. The occurrence of HLA-DQ2 was higher among the celiac disease (93%) patients as compared to healthy patients (20%) (p <0.05). The frequency of HLA-DQ8, although greater in celiac disease patients (4%) as compared to the healthy subjects (2%), but was found statistically not significant (p = 0.683). This suggests that HLA-DQ2 had a significant association with the disease in contrast to HLA-DQ8.

Among the HLA-DQ2 positive patients (n=93), the fre-quency of HLA-DQ2.5 (HLA-DQA1*05/HLA-DQB1*02) and HLA-DQ2.2 (HLA-DQA1*02/HLA-DQB1*02) was assessed and found 86 (92.4%) and 7 (7.6%), respectively. The photograph of the bands of HLA-DQ2, HLA-DQ8, HLA-DQ2.5 and HLA-DQ2.2 as seen under UV illumination are shown in Figure 1.

Chi-square test applied to the data after stratification showed that the confounding factors, like age and gender, had no significant effect (p >0.05) on HLA-DQ2 and HLA-DQ8 in celiac disease group. Similarly, no significant difference was observed in healthy group. HLA HLA-DQ2 detection reliably diagnoses celiac disease among all age groups, gender and ethnicities Tables II and III.

DISCUSSION

Celiac disease has a strong genetic background and diversity in its phenotype (depending on the point at which the illness is discovered); thus the observer needs a high degree of skepticism. In the pathogenesis of the disease, the factors involved are: gluten ingestion; shifts in the confluences of the intestinal mucosa (gliadin breaching the barrier and triggering the inflammatory process), and the involvement of a hereditary factor administered by a particular HLA.

HLA-DQ2 exists in 98.6% of CD patients in the world population and has a high negative predictive value.³ In addition, HLA-DQ2 and/or HLA-DQ8 are present in approximately 40 percent of the general population who do not have CD, and this proportion rises in the individuals who have first-degree relatives with celiac disease.

When the patient is on a gluten-containing diet, positive serological tests and SBB are necessary for the diagnosis of CD.^10,11 Therefore, in settings with poor histopathological diagnostic ability, serology based and especially genetic tests would be much-prized to develop more precise diagnosis of CD.^12,13 As a matter of fact, a recent multi-centric study organised in Spain established that small intestinal biopsies could have been prevented without any chance of misdiagnosis in a large fraction of symptomatic patients.¹⁴ Recent revisions of the CD diagnostic criteria have, therefore, adopted the greater involvement of HLA-DQ genotyping because of its high negative predictive value, in addition to antibodies, to diagnosis of CD.^15,16

In this study, HLA-DQ2 was seen in 93 percent celiac disease patients and HLA-DQ8 was seen in 4 per cent celiac disease patients. The explanation for the higher pervasiveness of these antigens in this area compared to other places in the literature may include the genetic heterogeneity of the population, environmental and cultural factors. Further subtyping revealed that HLA-DQ2.5 was more strongly associated with celiac disease, i.e. 92.4 % of HLA-DQ2 positive patients had HLA-DQ2.5.

These findings are similar to those recorded in European populations, where the HLA-DQ2 frequency is greater than ninety percent and the HLA-DQ8 frequency is between five to ten percent.^17,18

This work on Pakistani population provides a basis for association of HLA specifically HLA-DQ2 and HLA-DQ8 with celiac disease. The subtypes of HLA-DQ2 i.e. HLA-DQ2.5 having high association with the disease reveals its prevalence in local population.  Further multicentric studies with larger sample size can be employed based on this data to make local guidelines for diagnostic testing of celiac disease.

CONCLUSION

HLA-DQ2 can be used as an effective marker for early diagnosis of celiac disease instead of invasive procedures such as intestinal biopsy. The lack of genotyping of HLA-DQ2 in patient workup may lead to misdiagnosis of celiac disease, particularly HLA-DQ2.5. This can prevent invasive biopsy procedure and its associated complications.

ETHICAL APPROVAL:
This study was approved by Ethical Review Committee, Armed Forces Institute of Pathology (AFIP), Rawalpindi; and ethical approval was obtained prior to the initiation of research work.

PATIENTS' CONSENT:
Informed consents were taken from all the participants about the study; and detailed history was recorded.

CONFLICT OF INTEREST:
The authors declared no conflict of interest.

AUTHORS' CONTRIBUTION:
MA: Concept, study design, data collection, data analysis, interpretation and discussion.
HNT: Study design, data analysis and interpretation.
DA: Critical review.
MH: Data collection.
UBK: Statistical analysis.
YI: Data collection, and literature review.

REFERENCES

1. Catassi C, Yachha SK. The global village of celiac disease. Recenti Prog Med 2001; 92(7-8):446-50.
2. Amarapurkar DN, Somani VS, Shah AS, Kankonkar SR. HLA-DQ genotyping in celiac disease in western India. Trop Gastroenterol 2016; 36(3):174-8. doi: 10.7869/tg.279.
3. Cecilio LA, Bonatto MW. The prevalence of hla dq2 and dq8 in patients with celiac disease, in family and in general population. Arq Bras Cir Dig 2015; 28(3):183-5. doi: 10.1590/ S0102-67202015000300009.
4. Ludvigsson JF, Rubio-Tapia A, van Dyke CT, Melton LJ, Zinsmeister AR, Ahr BD, et al. Increasing incidence of celiac disease in a North American population. Am J Gastroenterol 2013; 108(5):818-24. doi: 10.1038/ajg.2013.60. 
5. Catassi C, Rätsch I, Fabiani E, Rossini M, Coppa G, Giorgi P, et al. Coeliac disease in the year 2000: Exploring the iceberg. Lancet 1994; 343(8891):200-3. doi: 10.1016/ s0140-6736 (94)90989-x.
6. Rabbani MW, Ali I, Aziz T, Imran W, Aslam M. Diagnostic usefulness of Anti-tissue transglutaminase in celiac disease: Correlation with Intestinal Mucosal Biopsy. Pak J Med Sci 2011; 27(3):599-602.
7. Hussain S, Sabir M, Afzal M, Asghar I. Coeliac disease--clinical presentation and diagnosis by anti tissue trans glutaminase antibodies titre in children. J Pak Med Assoc 2014; 64(4): 437-41.
8. Husby S, Koletzko S, Korponay-Szabo I, Mearin M, Phillips A, Shamir R, et al. European society for pediatric gastroenterology, hepatology, and nutrition guidelines for the diagnosis of coeliac disease. J Pediatr Gastroenterol Nutr 2012; 54(1):136-6. doi: 10.1097/MPG.0b013e31821a23d0.
9. Rashid M, Khan AG. Celiac disease in Pakistan: challenges and opportunities. J Ayub Med Coll Abbottabad 2009; 21(3):1-2. PMID: 20929000.
10. Ludvigsson JF, Leffler DA, Bai JC, Biagi F, Fasano A, Green PH, et al. The Oslo definitions for coeliac disease and related terms. Gut 2012; 62(1):43-52. doi: 10.1136/ gutjnl-2011- 301346.
11. Hill ID, Dirks MH, Liptak GS, Colletti RB, Fasano A, Guandalini S, et al. Guideline for the diagnosis and treatment of celiac disease in children: Recommendations of the North American society for pediatric gastroenterology, hepatology and nutrition. J Pediatr Gastroenterol Nutr 2005; 40(1):1-19. doi: 10.1097/ 00005176-200501000-00001.
12. Kapitany A, Toth L, Tumpek J, Sipos E, Woolley N, Partanen J, et al. Diagnostic significance of HLA-DQ typing in patients with previous coeliac disease diagnosis based on histology alone. Aliment Pharmacol Ther 2006; 24(9):1395-402. doi: 10.1111/j.1365-2036.2006.03133.x.
13. Anderson RP, Henry MJ, Taylor R, Duncan EL, Danoy P, Costa MJ, et al. A novel serogenetic approach determines the community prevalence of celiac disease and informs improved diagnostic pathways. BMC Med 2013; 11(1):188. doi: 10.1186/1741-7015-11-188.
14. Donat E, Ramos JM, Sanchez-Valverde F, Moreno A, Martinez MJ, Leis R, et al. ESPGHAN 2012 guidelines for coeliac disease diagnosis: Validation through a retrospective Spanish multicentric study. J Pediat Gastroenterol Nutr 2015; 62(2): 284-91. doi: 10.1097/MPG.0000000000000870.
15. Hadithi M, Von Blomberg BME, Crusius JBA, Bloemena E, Kostense PJ, Meijer JW, et al. Accuracy of serologic tests and HLA-DQ typing for diagnosing celiac disease. Ann Intern Med 2007; 147(5):294-302. doi: 10.7326/0003-4819- 147-5-2007 09040-00003.
16. Kurppa K, Salminiemi J, Ukkola A, Saavalainen P, Löytynoja K, Laurila K, et al. Utility of the new ESPGHAN criteria for the diagnosis of celiac disease in at-risk groups. J Pediatr Gastroenterol Nutr 2012; 54(3):387-91. doi: 10.1097/ MPG.0b013e3182407c6b.
17. Karell K, Louka AS, Moodie SJ, Ascher H, Clot F, Greco L, et al. Disease EGCoC (2003) HLA types in celiac disease patients not carrying the DQA1* 05-DQB1* 02 (DQ2) heterodimer: Results from the European genetics cluster on celiac disease. Human Immunol 64(4):469-77. doi: 10. 1016/s0198-8859 (03)00027-2.
18. Tye-Din J, Anderson R. Immunopathogenesis of celiac disease. Curr Gastroenterol Rep 2008; 10(5):458-65.  doi: 10.1007/s11894-008-0085-9.