Altered expression profile of long non-coding RNAs during heart aging in mice

2.1 Heart tissue collection

Male C57BL/6 mice (20–25 g) of 6–8 weeks were purchased from the Experimental Animal Center of the Affiliated Second Hospital of Harbin Medical University (Harbin, China). Mice were stochastically assigned to two groups: young mice (3 months) and aging mice (18 months). The mice were sacrificed at the age of 3 (for the young group) and 18 (for the aged group) months. The hearts were stored at −80°C for subsequent preparation of total RNA samples. The protocols involving the use of mice were approved by the Animal Ethics Committee of Harbin Medical University. The investigation procedures conform to the guidelines of the Care and Use of Laboratory Animals published by the US National Institutes of Health.

2.2 Echocardiography

Mice were anesthetized with tribromoethanol (0.02 g/10 g). Echocardiography with Vevo 1100 VisualSonics devices (VisualSonics, Toronto, ON, Canada) was performed to assess the cardiac function of aging and young mice. The short-axis view of M-mode was selected for the measurements of fractional shortening (FS) and ejection fraction (EF) as the main parameters of cardiac function.

2.3 Microarray

Total RNA samples were extracted from the hearts of three aging and three young mice, respectively, using the Trizol® Reagent (Invitrogen life technologies) and further purified by using RNasey Mini Kit (Qiagen p/n 74104). Next, the quantification and quality of RNA were measured using NanoDrop ND-1000. The RNAs were transcribed into cRNAs and labeled using Quick Amp Labeling Kit, One-Color (Agilent p/n 5190-0442). Then, nanodrop was used to detect the fluorescence labeling efficiency to ensure the reliability of subsequent chip experimental results. The labeled cRNAs were hybridized with a high-density chip using Agilent Gene Expression Hybridization Kit (Agilent p/n 5188–5242) and scanned by the Agilent Microarray Scanner (Agilent p/n G2565BA). Finally, the data were extracted by Agilent Feature Extraction (version 11.0.1.1). The microarray analysis was performed by Kangchen Biotech, Shanghai, P.R. China.

2.4 Microarray data analysis

The criteria for differential expression of lncRNAs and mRNAs with statistical significance between aging and young mice were set as P < 0.05 and | log2 fold change| > 2.

2.5 Gene Ontology and KEGG pathway analysis

GO (Gene Ontology) analysis of molecular function (MF), cellular components (CC), and biological processes (BP) of genes was carried out based on the GO database. The related signal pathways of differentially expressed mRNAs were analyzed by the KEGG database. Two-side Fisher's exact test was used to filter the GO category and pathways. P < 0.05 was set as the threshold for defining statistical significance, and a false discovery rate (FDR) was used to correct the P-value.

2.6 RNA extraction and Quantitative Real-Time PCR

Total RNA samples were extracted from myocardium of 3 and 18 months, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA concentration and purity were determined with a NanoDrop ND-1000. A reverse transcription kit was used for reverse transcription of RNA to cDNA (TaKaRa, Tokyo, Japan). PCR was performed using GreenER Two-Step qRT-PCR Kit Universal (Invitrogen, USA).

The sequences of primer pairs used in this study include:

Up-regulated lncRNAs:

• ENSMUST00000143329-F: AGGCATCCAGCATCCTTTCT,

•                                                         -R: GGTAGACAGCACCTGAGGAA.

• uc007bte.1-F: AGCATGAATCAGCAGGAGGA,

•                         -R: TGAGAGAGGCAAGGCAAAGA.

• uc007pgi.1-F: TGCGAGAAATCCCACCATCT,

•                         -R: TCAGGCAGCCGATTATCACT.

• uc009cfw.1-F: GCCTCCTTTGTCTTCCTCCT,

•                         -R: TTGTCTGAGAGCTGCCTTGA.

• ENSUMST00000162347-F: AGAGTCAATTCCCAGCACCA,

•                                                       -R: CCCAGTAGGGTGTCACAGTT.

Down-regulated lncRNAs:

• ENSMUST00000146359-F: CTACTGGCTGCTCGGACTAA,

•                                                       -R: TACAGAGGAATGCGCCTGAT.

• NR_045178-F: ATGGACAAAGCAGGATGTGC,

•                            -R: AGCGTGAGAGTCTCTTGAGG.

• TCONS_00008432-F: AAGCCTGCAAGGAAGAGACT,

•                                          -R: TTGCTTCCAGCATGTCCAAC.

• ENSMUST00000180853-F: ATTCGAGAGGCGCTAGGAAA,

•                                                       -R: GAAAGGGAACGCAAGGAAGG.

The GAPDH was used as internal control. 2^−ΔΔCt was used to analysis the data.

2.7 Statistical Analysis

Two-tailed unpaired Student's t-test of the GraphPad Prism 7.0 program was used to compare the differences between the young and the aged mice. P < 0.05 was considered statistically significant.

3.1 Alteration of cardiac function in aging mice

While there was no significant difference in the heart weight between aged and young mice (Fig. 1A), the cardiac function of aged mice was significantly impaired with markedly decreased EF and FS relative to the young counterparts (Fig. 1B–D). This result is an indication cardiac aging in 18-months old mice compared to 3-months old ones.

Fig. 1

Reduced cardiac function in aging mice

(A) There was no difference in the heart weight ratio between the aging mice (N = 7) and young mice (N = 5), and the cardiac function was determined by echocardiography (B–D), N = 5. Data are shown as mean ± SEM. ^*P < 0.05 vs. young mice.

3.2 Aberrant lncRNAs and mRNAs in the heart of aging mice

To elucidate the potential molecular mechanisms for the observed impairment of cardiac function in aged mice, we performed a high-throughput microarray analysis to identify the differentially expressed lncRNAs and mRNAs between aged (N = 3) and young mice (N = 3). Clustering analysis was carried out to detect differential expression of lncRNAs (Fig. 2A) and mRNAs (Fig. 2B). Based on the criteria of fold change ≥2.0 and P < 0.05, 192 differentially expressed lncRNAs (Fig. 2C) and 214 differentially expressed mRNAs (Fig. 2D) were found, of which 155 lncRNAs were upregulated and 37 downregulated in the aged hearts relative to young ones. In addition, 170 mRNAs were up-regulated and 44 downregulated in aged mouse hearts. Table 1 and Table 2 show the 10 most significantly upregulated and downregulated lncRNAs and mRNAs in aged mouse hearts. The top five upregulated lncRNAs uc007pgi.1, uc009cfw.1, ENSMUST00000143329, ENSMUST00000162347 and uc007bte.1 (Fig. 2E and Table 3) and four downregulated lncRNAs TCONS_00008432, NR_045178, ENSMUST00000146359, and ENSMUST00000180853 (Fig. 2F and Table 3) were selected for qRT-PCR verification. Except for uc007pgi.1, uc009cfw.1, and ENSMUST00000162347, the differential expression of other 6 lncRNAs initially identified by microarray analysis were confirmed by qRT-PCR.

Fig. 2

Differential expression of lncRNAs and mRNAs in cardiac tissues from aged and young mice

Hierarchical clustering and volcano plots of data from microarray analysis showing the differences in lncRNA (A, C) and mRNA (B, D) expression profiles in the hearts of aged mice relative to young mice. qRT-PCR verification of the upregulated lncRNAs (E) and downregulated lncRNAs (F).

3.3 GO analysis of differentially expressed mRNAs in the aging hearts

To investigate the role of mRNAs in aged heart, GO analysis was performed to annotate the Biological Process (BP), Cellular Component (CC), and Molecular Function (MF) of deregulated mRNAs. The results revealed that the 214 deregulated mRNAs are mainly enriched in cell proliferation, immune system process, cellular metal ion homeostasis, and positive regulation of endothelial cell apoptotic process. More specifically, 170 upregulated mRNAs are mainly enriched in cell proliferation and immune system process (Fig. 3A), while 44 downregulated mRNAs are mainly enriched in cellular metal ion homeostasis and positive regulation of endothelial cell apoptotic process (Fig. 3B).

Fig. 3

GO analysis of differentially expressed genes for their potential roles in regulating biological process (BP), cellular component (CC) and molecular function (MF)

The biological process of top ten upregulated (A) and downregulated (B) mRNAs predicted by Go analysis. The analysis of the cellular component for the upregulated (C) and downregulated (D) genes. (E and F) The predicted molecular function of upregulated and downregulated mRNAs, respectively.

Concerning cellular components, the upregulated mRNAs are enriched in extracellular space and extracellular region (Fig. 3C), and the downregulated transcripts are mainly enriched in membrane, plasma membrane protein complex, and apical plasma membrane (Fig. 3D). In regard with molecular function, the upregulated mRNAs were predicted to be largely related to the serine-type peptidase activity and serine hydrolase activity (Fig. 3E), and the downregulated genes are significantly enriched in protein binding, copper ion binding, and metal ion transmembrane transport activity (Fig. 3F).

3.4 KEGG analysis of altered mRNAs

We further analyzed the pathways associated with differentially expressed mRNAs. The results indicate that the differentially expressed genes are mostly related to 16 signaling pathways. Specifically, the upregulated mRNAs in aged mice are theoretically associated with endocrine-and other factor-regulated calcium reabsorption, renin-angiotensin system, arachidonic acid metabolism, and cytokine-cytokine receptor interaction (Fig. 4A). The downregulated mRNAs were predicted to participate in transcriptional dysregulation in cancer, systemic lupus erythematosus, the NF-kappa signaling pathway, and the thyroid hormone signaling pathway (Fig. 4B).

Fig. 4

KEGG pathway analysis

The KEGG pathway enrichment analysis of the upregulated (A) and downregulated (B) mRNAs.