Abstract
Inflammatory reactions associated with osteolysis and implant loosening can be the result of generated CoCr particles and the simultaneous release of ions, which are the consequence of wear at the articulating surfaces of metallic implants. By now, there is little knowledge about the influence of CoCr ions on the viability of human osteoblasts (hOB).
Therefore, metallic ions were generated from solid CoCr28Mo6 alloys using electric potentials against hydrogen bridge electrodes. For the cell experiments, hOBs (n ≥ 4) in the third passage were used. Cells were cultured for 24 h before incubated with the generated ion solution in two different concentrations (100 µg/l and 500 µg/l in DMEM with 10 % FCS). Cells incubated without ions served as controls. After 48 h and 96 h cell viability was determined (WST-1 assay, live-dead-stainings). Additionally, gene expression levels of osteogenic markers and cytokines were analysed.
A significant increase of metabolic activity and vital cells could be shown for both ion concentrations. Gene expression of alkaline phosphatase and Col1 was highly induced after 96 h for 100 µg/l whereas Col1 protein was significantly reduced on both time points (48 h: p=0.008 (100 µg/l, 500 µg/l); 96 h: p=0,029 (500 µg/l)) compared to the control. Additionally, MMP1 expression was decreased after 48 h and 96 h. IL6 mRNA was concentration-dependent increased after 48 h whereas a significant decrease could be shown for the highest ion concentration (p=0.029). Compared to the lower ion concentration, IL8, MCP1 (p=0.029) and TNF mRNA were clearly reduced for the higher ion solution after 96 h. Our results suggest that ions from CoCr28Mo6 alloys have only marginal effects on osteoblast viability whereas Col1 expression is reduced and cytokine release is induced. In further studies, the effects of metallic ions and particles from CoCr28Mo6 on other cells will be examined.
1 Introduction
A standard technique for the treatment of degenerative injured joints is the artificial joint replacement with metallic endoprosthesis. Hereby, the aseptic loosening of implants is the most important complication in total joint replacement. Inflammation reactions to wear particles followed by osteolysis processes are the main reasons of implant failure [1]. In this context, metallic particles and ions from metal-on-metal prosthesis will be deposited in the periprosthetic tissue whereby cellular reactions will be induced. The release of pro-inflammatoric cytokines like IL6, TNF and MCP1 leads to the activation of bone resorbing osteoclasts [2]. Beside macrophages and osteoclasts, osteoblasts seem to be involved in osteolytic processes of the bone [3]. Therefore, the biocompatibility of metallic implant materials has to be considered as critical. Nevertheless, these materials tend to corrosion processes and ion release resulting in chemically active degradation products [4]. It is well known that, due to the binding of metallic ions to proteins, immunological reactions resulted in hypersensitivity [5] whereby a metal allergy could be supported. For this reason, it has been suggested that patients with metal allergy could have a shorter survival time of hip endoprosthesis [6].
As already mentioned, human osteoblasts are also involved in osteolytic processes after exposure to metallic wear particles. Hereby, the osteoblasts show a reduced collagen type 1 synthesis rate combined with a higher apoptosis rate and cytokine release [3]. So far, there is little known about the influence of metallic ions of CoCr28Mo6 alloys on human osteoblast. Therefore, we generated defined ion solutions of solid CoCr28Mo6 alloys for the exposure to human osteoblasts for analysing viability, bone formation activity and cytokine release.
2 Material and methods
2.1 Generation of metallic ions
Metallic ions were generated from solid CoCr28Mo6 alloys (ISO 5832-12, ASTM F1537) using electric potentials against hydrogen bridge electrodes. Phosphate buffered saline (PBS) was used as surrounding solution. The solved content of all metallic ions were determined by ultratrace analysis and was 13.7 mg/l for Co, 4.3 mg/l for Cr, 0.8 mg/l for Mo and 1.7 mg/l for Ni. For the elimination of endotoxins, the ion solution was heat treated.
2.2 Isolation and cultivation of human osteoblasts
Human primary osteoblasts (female: n = 2, mean age 75.5 ±2.1 years; male: n = 4, mean age 64.5 ±3.7 years) were isolated under sterile conditions from bone marrow derived from femoral heads of patients undergoing primary hip replacements (Local Ethical Committee AZ: 2010-10) [3]. For the in vitro tests, human osteoblasts were transferred to 24-well plates with 10000 cells/well (in duplicates) in 1 ml culture medium (DMEM, Biochrom AG, Berlin, Germany) containing 10 % fetal calf serum (FCS, Gibco® Invitrogen, Paisly, UK), 1 % penicillin/streptomycin, 1 % amphotericin B and osteogenic additives (50 µg/ml L-ascorbate-2-phosphate, 10 mM -glycerophosphat, 100 mM dexamethasone (all: Sigma-Aldrich, Munich, Germany)). After 24 h of adherence, the medium was changed and cells were incubated with a) 100 µg/l ion solution, b) 500 µg/l ion solution (both: in complete medium) and c) unstimulated control for 48 h and 96 h under standard culture conditions.
2.3 Testing of cell viability
Viability of cells was determined using the metabolic activity test WST-1 (Roche, Penzberg, Germany). The test was performed both, after 48 h and 96 h. Therefore, the ion solutions were removed and cells were incubated with a defined volume of WST-1/medium reagent (ratio 1:10) at 37 °C and 5 % CO2 for 30 min. Afterwards, an aliquot of 100 µl was transferred to 96-well plates (in duplicates) to determine the absorption at 450 nm (reference: 630 nm) in a microplate reader (Dynex Technologies, Denkendorf, Germany).
In addition, a live-dead staining (Invitrogen) was carried out to distinguish between vital and dead cells. The staining reagent contains two fluorescence dyes (calcein AM and ethidium homodimer 1). As calcein is membrane-impermeable, it will remain into intact cells, which therefore fluorescent green (ex/em 495/515 nm). Ethidium homodimer enters damaged cells and binds at DNA resulting in a red fluorescent (ex/em 495/635 nm). Both dyes were dissolved in PBS. Afterwards, cells were incubated at room temperature in the dark. Cells were examined under a fluorescence microscope (Nikon ECLIPSE TS100, Nikon GmbH, Duesseldorf, Germany).
2.4 Gene expression analysis
2.4.1 RNA extraction and cDNA synthesis
Isolation of RNA was carried out using the Direct-zol Kit (Zymo Research, Freiburg, Germany) which combines a trizol treatment of cells and afterwards column purification of RNA probes according to the supplier’s recommendations. For cDNA synthesis, the High Capacity cDNA Kit (Applied Biosystems, Forster City, US) was used according to the manufacturer‘s instructions.
2.4.2 Quantitative real-time PCR (qRT PCR)
Relative quantification of target cDNA levels was done by qRT PCR (qTOWER 2.0, Analytik Jena, Jena, Germany) using the innuMIX qPCR MasterMix SyGreen (Analytik Jena) and the primers (Sigma-Aldrich) described in Table 1. Following the instructions of the manufacturer, PCR was performed under the following conditions: 95 °C for 2 min, 40 cycles of 95 °C for 5 sec and 65 °C for 25 sec. The reactions were done as duplicates. Relative expression of each mRNA compared with HPRT was calculated to the equation ΔCt=Cttarget-CtHPRT. The relative amount of target mRNA in unstimulated cells and treated cells was expressed as 2−(ΔΔCt), where ΔΔCttreatment = ΔCtgene-ΔCtcontrol.
cDNA primers for qRT PCR
| Primer | Sequence 5’-3’ forward reverse |
|---|---|
| collagen type 1 (Col1) | acgaagacatcccaccaatc |
| agatcacgtcatcgcacaac | |
| alkaline phosphatase (ALP) | cattgtgaccaccacgagag |
| ccatgatcacgtcaatgtcc | |
| osteocalcin (OC) | ggtgcagcctttgtgtcc |
| tcagccaactcgtcacagtc | |
| matrix metalloproteinase 1 (MMP1) | agagcagatgtggaccatgc |
| tcccgatgatctcccctgac | |
| tissue inhibitor of metallo-proteinase 1 (TIMP1) | attgctggaaaactgcaggatg |
| gtccacaagcaatgagtgcc | |
| interleukin 6 (IL6) | tggattcaatgaggagacttgcc |
| ctggcatttgtggttgggtc | |
| interleukin 8 (IL8) | tctgtgtgaaggtgcagttttg |
| atttctgtgttggcgcagtg | |
| monocyte chemotactic protein 1 (MCP1) | ccgagaggctgagactaacc |
| ggcattgattgcatctggctg | |
| tumour necrosis factor α (TNF α) | gttgtagcaaaccctcaagctg |
| gaggtacaggccctctgatg | |
| hypoxanthine-guanine phosphoribosyltransferase (HPRT) | ccctggcgtcgtgattagtg |
| tcgagcaagacgttcagtcc |
2.5 Pro-collagen type 1 synthesis
The synthesis rate of pro-collagen type 1 protein was determined using an enzyme-linked immunosorbent assay (ELISA) (C1CP, Quidel, Marburg, Germany). Therefore, supernatants of each stimulation experiment were collected and stored at −20 °C. The test procedure was done according to the manufacturer instructions. Absorbance was analysed at 405 nm using a microplate reader (Dynex Technologies). Afterwards, the total protein content was relativised to DNA content. For this purpose, DNA of cells was isolated using the peqGOLD Tissue DNA Kit (Peqlab, Erlangen, Germany) according to the manufacturer’s instructions.
Live-dead staining of human osteoblasts after 96 h of incubation with metallic ions or in DMEM only (unstimulated control). Green=vital cells; red=dead cells; bar=50 µm)
3 Results
3.1 Viability of human osteoblasts
Viability of human osteoblasts was not significantly influenced by metallic ions. More importantly, there was a significant increase of metabolic activity for each stimulation experiment from 48 h to 96 h (100 µg/l: 2-fold, p=0.03; 500 µg/l: 2.4-fold, p=0.017; control: 1.8-fold; p=0.03). Additionally, live-dead staining of cells revealed a clearly rise in cell number. Hereby, more vital cells could be shown after treatment with both ion solutions compared to the unstimulated control after 96 h (Figure 1).
3.2 Influence of metallic ions on bone remodelling
Gene expression of collagen type 1 (Col1), alkaline phosphatase (ALP) and osteocalcin (ALP) was not induced in human osteoblast after the treatment with metallic ions after 48 h compared to the unstimulated control. After 96 h, a non-significant increase of gene expression levels could be determined for Col1 (100 µg/l: 4-fold; 500 µg/l: 2-fold) and ALP (100 µg/l: 2-fold; 500 µg/l: 1.5-fold) for both ion concentrations. Concerning the protein synthesis rate of Col1, a significant reduction of protein content was visible for the lower ion concentration after 48 h (0.45-fold, p=0.008) and for the higher ion concentration at both time points (48 h: 0.43-fold, p=0.008; 96 h: 0.5-fold, p=0.029) compared to the unstimulated control.
Additionally, we analysed the mRNA expression rate of MMP1 and its natural antagonist TIMP1. For MMP1, mRNA levels were decreased at both time points for iontreated cells compared to unstimulated ones (100 µg/l: 0.36-fold (48 h) and 0.44-fold, p=0.029 (96 h); 500 µg/l: 0.58-fold (48 h); 500 µg/l: 0.68-fold (96 h). For TIMP1, similar expression rates could be determined for both ion concentrations as well as time points compared to unstimulated cells.
3.3 Cytokine release
We analysed mRNA levels of different cytokines after the treatment with CoCr ions. After 48 h of incubation, there was a non-significant increase of IL6 gene expression for both ion concentrations (100 µg/l: 1.9-fold; 500 µg/l: 2.7-fold). For IL8, MCP1 and TNF, no differences in expression levels compared to unstimulated cells could be shown. After 96 h, an increase of IL6 mRNA (3.2-fold, p=0.029), TNF mRNA (2.2-fold, p=0.029) and MCP1 mRNA (1.9-fold) were detected for the lower ion concentration (Fig. 3). Incubating with 500 µg/l ion solution resulted in a significant reduced IL6 expression rate (p=0.029 compared to 100 µg/l) as well as IL8 (p=0.029), MCP1 (p=0.029 compared to 100 µg/l) and TNF gene expression (Figure 2).
Gene expression analysis of human osteoblasts stimulated with 100 µg/l and 500 µg/l CoCr ion solutions in relation to unstimulated cells after 96 h. Data are shown as median ±min/max. Significances between stimulated and unstimulated groups (#p<0.05) as well as between both ion concentrations (*p<0.05) were analysed with the Mann-Whitney-U-Test.
4 Discussion
Inflammatory reactions associated with osteolysis and implant loosening are the result of generated CoCr particles and the simultaneous release of ions. By now, there are some studies dealing with the influence of ions from Co-Cr-Mo to human osteocytes [7] and osteosarcoma cell lines like MG-63 [8]. In the present study, we used human primary osteoblasts, which were exposed to generated ion solutions from CoCr28Mo6 alloys. In joint puncture studies, concentrations of 200-250 µg/l of Co- and Cr-ions were measured in patients undergoing revision surgeries [9]. However, in preliminary experiments, we could not determine significant effects of the reported concentration in human osteoblasts. In contrast, concentrations of 100 µg/l and 500 µg/l had influence bone formation processes and cytokine release significantly. Thereby, the ion concentration of 100 µg/l induced an increase of IL6-, MCP1- and TNF -mRNA expression in human osteoblasts. Furthermore, a reduced Col1 protein expression after exposure to both concentrations was detected. Consequently, CoCr ions could have an inhibiting effect on matrix assembly and therefore, trigger osteolytic processes. Another characteristic of osteolysis is matrix degradation, caused e.g. by special proteinases like MMP1 [3]. Surprisingly, in this study, MMP1 mRNA was clearly decreased compared to unstimulated cells. This result suggests that human osteoblasts are only rarely involved in matrix reduction.
Our results suggest that CoCr ions have only marginal effects on the viability of human osteoblasts. Nevertheless bone formation is limited and cytokine release induced, especially in lower ion concentrations. In further studies, the effects of the generated metallic ion solutions on other cells (e.g. macrophages) will be examined.
Funding: This study was supported by the German Research Foundation (DFG).
Author's Statement
Conflict of interest: Authors state no conflict of interest. Material and Methods: Informed consent: Informed consent has been obtained from all individuals included in this study. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved by the authors’ institutional review board or equivalent committee.
References
[1] Purdue PE, Koulouvaris P, Potter HG, et al. The cellular and molecular biology of periprosthetic osteolysis. Clin Orthop Relat Res 2007: 251-261.10.1097/01.blo.0000238813.95035.1bSearch in Google Scholar PubMed
[2] Al-Saffar N, Revell PA. Pathology of the bone-implant interfaces. J Long Term Eff Med Implants 1999: 319-347.Search in Google Scholar
[3] Lochner K, Fritsche A, Jonitz A, et al. The potential role of human osteoblasts for periprosthetic osteolysis following exposure to wear particles. Int J Mol Med 2011: 1055-1063.10.3892/ijmm.2011.778Search in Google Scholar PubMed
[4] Jacobs JJ, Hallab NJ, Skipor AK, Urban RM. Metal degradation products: a cause for concern in metal-metal bearings? Clin Orthop Relat Res 2003: 139-147.10.1097/01.blo.0000096810.78689.62Search in Google Scholar
[5] Hallab NJ. Metal sensitivity in patients with orthopedic implants. J Clin Rheumatol 2001: 215-218.10.1097/00124743-200108000-00004Search in Google Scholar PubMed
[6] Granchi D, Cenni E, Trisolino G, et al. Sensitivity to implant materials in patients undergoing total hip replacement. J Biomed Mater Res B Appl Biomater 2006: 257-264.10.1002/jbm.b.30445Search in Google Scholar PubMed
[7] Kanaji A, Orhue V, Caiedo MS, et al. Cytotoxic effects of cobalt and nickel ions on osteocytes in vitro. J Orthop Surg Res 2014: 9:91.10.1186/s13018-014-0091-6Search in Google Scholar PubMed PubMed Central
[8] Hallab NJ, Anderson S, Caicedo M, et al. Effects of soluble metals on human peri-implant cells. J Biomed Mater Res A 2005: 124-140.10.1002/jbm.a.30345Search in Google Scholar PubMed
[9] De Smet K, De Haan R, Calistri A, et al. Metal ion measurement as a diagnostic tool to indent problems with metal-on-metal hip resurfacing. J Bone Joint Surg Am 2008: 202-208.10.2106/JBJS.H.00672Search in Google Scholar PubMed
© 2015 by Walter de Gruyter GmbH, Berlin/Boston
This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
