Translation initiation on CoV2 gRNA is non-optimal

Next, we examined the core components of protein synthesis. Consistent with a global translation shutoff, heavy polysome fractions from infected cells contained fewer elongating ribosomes, reflected by lower abundance of ribosomal proteins and the two major elongation factors, EEF1A and EEF2 (Fig 4A). In contrast, a subset of translation initiation factors was enriched in heavy polysome fractions (Fig 4A), but not other fractions (S4A Fig), upon CoV2 infection. These included EIF1, 1A, 3A, 4A1, 4B and RNA helicase DDX3 (Figs 4A, 4B and S4B). By analyzing previous RNA interactome studies, we found that translation initiation factors are some of the most abundant host interactors of CoV2 RNA in both Vero [12] (Fig 4C) and Huh7 [18] (S4C Fig). Viral RNAs were also associated with more 40S than 60S ribosomal subunits (Figs 4C and S4C), likely representing pre-initiation complexes that await large subunit joining. If assembly of elongation-competent 80S ribosomes is slower in CoV2-infected cells, more pre-initiation complexes should accumulate in the polysome fractions. Indeed, we find more 40S than 60S ribosomal proteins in the heavy polysome fraction of infected Vero cells (Fig 4D). Furthermore, rRNA absorbance profiles of infected cells show lower abundance of free 40S but not 60S subunits in both Vero (Fig 4E) and Calu3 (Fig S4D). These observations suggest that the conversion of scanning pre-initiation complexes to initiating 80S ribosomes is inefficient—and perhaps an important rate limiting step—during CoV2 infection.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Translation initiation on CoV2 gRNA is non-optimal.

(a) Pairwise comparisons of individual protein abundance in the heavy polysome fractions. Ribosomal proteins and translation elongation factors are depleted, whereas translation initiation factors are enriched. (b) Line plots of individual translation initiation factors quantified by MS in each fraction. Each line represents a single replicate. P, two-tailed Student’s t-test p-value. (c) Translation initiation factors are highly represented in the CoV2 RNA interactome. Shown are pairwise comparisons of individual host protein abundance, quantified by MS, that specifically interact with either genomic or subgenomic CoV2 RNA during infection. Inset, cumulative distribution plots of 40S and 60S ribosomal protein interaction with CoV2 RNA. P, Mann-Whitney p-value. (d) Heavy polysome fractions contain more 40S ribosomal proteins in infected cells. Shown are cumulative distribution plots of 40S and 60S ribosomal proteins in heavy polysome fractions from infected and uninfected cells, across three replicates. P, Mann-Whitney p-value. (e) rRNA absorbance profiles from Fig 1D, showing lower abundance of free 40S subunits during CoV2 infection. (f) Translation initiation from CoV2 5’ untranslated region (UTR) is less efficient than GAPDH 5’UTR. mRNA encoding for nano-luciferase (nLuc) flanked by 5’ and 3’UTRs of either CoV2 (orange) or GAPDH (white) was transcribed in vitro, capped/polyadenylated, and transfected into Vero cells. At 4 hours post-transfection, luminescence was measured in parallel with qPCR using oligonucleotides specific to nLuc. Shown are means±SD of 3 independent replicates.

https://doi.org/10.1371/journal.ppat.1011535.g004

To determine whether this reflects a lower rate of translation initiation on CoV2 RNA, we generated in-vitro transcribed, capped and polyadenylated nano-luciferase (nLuc) mRNAs flanked by 5’ and 3’ UTRs of either GAPDH or CoV2 gRNA [9]. GAPDH UTRs were chosen as reference based on their prior use as controls for efficient constitutive translation, including in the context of CoV2 infection [9,19,20]. As the two mRNA variants encode for an identical protein sequence, differences in luminescence should reflect the relative translation initiation rate from each set of UTRs. At 4h post-transfection in Vero cells, we measured nLuc mRNA levels by RT-qPCR and protein levels by luminescence. Despite similar levels of intracellular mRNA for both reporters, CoV2 UTRs generated about 2-fold less luminescence than GAPDH UTRs (Fig 4F). Thus, translation initiation on CoV2 gRNA is less efficient than GAPDH in uninfected Vero cells. These observations are consistent with previous measurements of translation efficiency by ribosome profiling, which showed that translation of CoV2 RNAs, and particularly gRNA, is less efficient than that of most cellular mRNAs [21,22].

Nsp1 promotes translation initiation on CoV2 gRNA

Next, we plotted the sedimentation patterns of individual CoV2 proteins in our gradients. Non-structural proteins 2–13 shared a similar pattern of sedimentation in 80S monosome and polysome fractions (Figs 5A and S5A), likely reflecting their presence in formaldehyde-stabilized protein complexes. Such interactions between viral proteins were reported in affinity purification (AP) MS studies of CoV2 and related coronaviruses [23,24]. Nsp1, on the other hand, peaked in the subpolysome fractions (Fig 5A). Nsp1 is known to inhibit translation initiation of cellular mRNAs by blocking the ribosomal mRNA channel on 40S subunits and 80S ribosomes [6,8,25], and its accumulation in fractions containing 40S and 80S ribosomes is therefore consistent with the reported inhibitory function.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Nsp1 promotes translation initiation on CoV2 gRNA.

(a) Line plots of individual viral proteins quantified by MS in each fraction. Each line represents a single replicate. (b) Vero cells were transfected with plasmids encoding for individual CoV2 proteins. At 48 hours post-transfection, cells were transfected with nLuc mRNA flanked by either CoV2 (orange) or GAPDH (white) UTRs. At 4 hours post-second transfection, cells were subjected to either luminescence measurements or sucrose gradients coupled to qPCR of nLuc mRNA. (c) nLuc luminescence. Shown are means±SD of 3 independent replicates. (d) Cells transfected, as above, with either GFP or Nsp1 followed by GAPDH-nLuc or CoV2-nLuc mRNA, were lysed and fractionated on 10–50% sucrose gradients with continuous monitoring of rRNA. The content of nLuc mRNA in each fraction was determined by qPCR. Left, rRNA absorbance profiles. Right, percent of GAPDH-nLuc or CoV2-nLuc mRNA found in polysome fractions of sucrose gradients. Shown are qPCR measurements of 4 polysome fractions from 2 independent gradients. P, two-tailed Student’s t-test p-value.

https://doi.org/10.1371/journal.ppat.1011535.g005

Still, Nsp1 was not entirely excluded from polysome fractions of infected cells (Fig 5A). Previous studies have shown that translation of CoV2 RNAs not only escapes repression by Nsp1 but is even enhanced by it, pointing towards additional modes of interaction with the translation machinery. Reporter assays found that low levels of Nsp1 stimulated translation from CoV2 5’UTR in transfected cells [26], and ribosome profiling analyses reported that loss of Nsp1 activity in the context of live virus infection reduced translation efficiency of viral RNAs [22]. Therefore, we next compared the effect of Nsp1 and other CoV2 proteins on translation of our nLuc reporter mRNAs. We transfected Vero cells with plasmids encoding CoV2 proteins, and at 48 h transfected again with nLuc mRNAs flanked by either GAPDH or CoV2 UTRs (Fig 5B). Most viral proteins had negligible effects on nLuc translation from either GAPDH or CoV2 UTRs (Fig 5C). In contrast, Nsp1 decreased nLuc translation from the GAPDH UTRs but increased translation from the CoV2 UTRs (Fig 5C). Given the potential destabilizing effects of Nsp1 on non-viral mRNAs [6,22], we measured the total intracellular levels of GAPDH, ACTB, and nLuc mRNA in the presence of either GFP or Nsp1. Expression of Nsp1 reduced the levels of endogenous GAPDH and ACTB (S5B Fig) but had no effect on the levels of transfected nLuc mRNAs flanked by either GAPDH or CoV2 UTRs (S5C Fig). This is likely due to the lower sensitivity of in-vitro transcribed RNAs to Nsp1-mediated degradation [27] and the short duration of the experiment (4 h post RNA transfection). However, it is also possible that a fraction of transfected mRNAs is retained in endocytic vesicles, which may protect them from Nsp1-induced degradation and potentially confound measurements of intracellular mRNA stability, thus obscuring the destabilizing effects of Nsp1 on host mRNA.

To independently confirm that the stimulatory effect of Nsp1 is indeed the result of increased translation initiation, we repeated the dual transfection experiment and measured whether the presence or absence of Nsp1 affects how much of each nLuc mRNA variant is associated with polysomes. To that end, we performed sucrose gradient ultracentrifugation followed by qPCR of gradient fractions. As expected, Nsp1 expression reduced global translation (Fig 5D, left). Furthermore, it shifted GAPDH-nLuc mRNA from heavy polysomes to lighter fractions containing soluble untranslated mRNAs (Fig 5D, right). In contrast, Nsp1 increased the proportion of CoV2-nLuc mRNA associated with polysomes (Figs 5D and S5D), consistent with specific and selective enhancement of translation initiation on CoV2 gRNA.

Stimulatory effect of Nsp1 on CoV2 translation is mediated by EIF1/1A and an upstream non-AUG start codon

To better understand the mechanism by which Nsp1 stimulates CoV2 translation, we investigated potential links between Nsp1 and translation factors. Two datasets using proximity labeling coupled to proteomic analysis [26,28] found that wild-type Nsp1—but not mutant Nsp1 deficient for ribosome binding—interacts with a subset of translation initiation factors, including EIF1A, EIF3A, DDX3 and EIF4A1. These were also enriched in the heavy polysome fractions of infected cells (Fig 4A). Furthermore, initiation factors EIF1 and 1A were found associated with Nsp1-bound 40S ribosomes in cryo-EM studies [8], although a more recent study reported that Nsp1 may prevent EIF1A binding to ribosomes [29].

Initiation from the correct start codon is critical for translation fidelity, and EIF1 and 1A are important regulators of this process [30–33]. Natural and induced fluctuations in the levels or activity of these factors affect initiation site stringency [30,34–36], particularly in the context of non-AUG translation of upstream open reading frames (uORFs) [37,38] (reviewed in [39]). Interestingly, CoV2 and other coronaviruses encode for multiple conserved uORFs that are actively translated during infection [21,40]. Ribosome profiling analyses of CoV2-infected cells have shown that ribosomes initiate translation from an upstream CUG codon found at position 59 of all gRNA and sgRNAs, just before the transcription regulatory sequence (TRS) [21,41]. This CUG is one of five codons in the 5’UTR of CoV2 gRNA that can initiate translation [21]. Four of the five potential initiating codons are predicted to translate two short uORFs, both of which terminate ahead of the fifth and main AUG at position 266 (Fig 6A). Template-switching at the TRS generates sgRNAs with conserved CUG but variable downstream sequences, forming uORFs with different initiation contexts that are all—except for Spike sgRNA—out of frame with the main AUG. Given that uORFs are generally thought to repress translation of downstream ORFs [39,42], we speculated that EIF1/1A may affect CoV2 translation by either promoting or inhibiting the bypass of repressive uORFs and therefore control downstream initiation from the main AUG.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Nsp1 promotes accurate start codon usage through EIF1/1A.

(a) Diagram of elements in CoV2 gRNA 5’UTR involved in translation. SL1, stem-loop 1. uORF1 and uORF2 can both be translated from two different start codons. (b) Vero cells were transfected with siRNAs targeting initiation factors 1A, 1, and 4B, compared to non-targeting (NT) controls. At 48h the same transfection was repeated. At 48h after the second transfection, cells were infected with either CoV2 (orange, left) polio (PV), Zika (ZIKV) or dengue (DENV) viruses (black, right) at MOI = 0.5. Viral titers were determined by plaque assays. Shown are means±SD of 4 independent replicates. (c) Vero cells were transfected with siRNA as above, infected with CoV2 at MOI = 5, and subjected to ribosome profiling analysis at 16 hpi. Traces show ribosome footprints on CoV2 RNA. Insets, ribosome footprints on nucleotides 20–80 of the gRNA. Representative of 2 independent replicates. (d) Ribosome footprints spanning 13 nt upstream and 12 nt downstream of the indicated start codons. Each bar represents a single biological replicate. P, Wilcoxon ranked-sum p-value. (e) Cumulative fraction plots of ribosome footprints on Orf1a, Spike and Nucleocapsid (N) open reading frames. Combined analysis of two independent replicates. P, Wilcoxon ranked-sum p-value. A shift of the curve to the left reflects lower ribosome occupancy and therefore lower translation. (f) Vero cells transfected with siRNA and infected as in (b) were subjected to immunoblot analysis of whole cell lysates using antibodies against CoV2 Spike, Nucleoprotein and Nsp1. Shown are representative blots of 4 independent repeats. (g) Vero cells were transfected with siRNA as above, followed by combined plasmid transfections of GFP and Nsp1 at the indicated amounts. The same total amount of DNA was used for each transfection. At 24 hours, cells were transfected again with nLuc mRNA flanked by UTRs from either GAPDH (left panel), CoV2 gRNA (middle panel) or CoV2 gRNA with CUG(59) mutated to AUG (right panel). At 4 hours post-second transfection, cells were subjected to luminescence measurements. Shown are means±SD of 3 independent replicates.

https://doi.org/10.1371/journal.ppat.1011535.g006

To test the role of EIF1/1A in CoV2 infection, we transfected Vero cells with siRNAs, infected with CoV2, and measured virus production by plaque assays. Knockdown of EIF1A, and to a lesser extent, EIF1, reduced CoV2 titers by up to about 10 fold (Fig 6B, left). siRNAs targeting EIF4B did not affect CoV2 titers (Fig 6B, left), suggesting that the effects of EIF1/1A depletion were not simply due to interfering with core components of the protein synthesis machinery. Furthermore, other positive strand RNA viruses e.g. polio (PV), Zika (Zikv) and dengue (DENV) were not affected by knockdown of either EIF1 or 1A (Fig 6B, right), suggesting a CoV2-specific dependency. Next, we performed ribosome profiling analysis of Vero cells transfected as above and infected with CoV2 for 16h. We confirmed efficient knockdown at the protein level (S6A Fig), generated ribo-seq libraries without formaldehyde crosslinking, and aligned ribosome protected fragments to both the virus and the host transcriptome. Reads mapping to CoV2 RNA accounted for about 2–3% of all uniquely aligned reads, regardless of EIF1/1A levels (S6B Fig). Although overall read numbers were similar, their distribution was different. Knockdown of EIF1A, and to a lesser extent, EIF1, led to more ribosomes accumulating on the upstream CUG (Fig 6C and 6D). This was followed by a 3-nt periodicity typical of translated ORFs (S6C Fig), confirming that the CUG codon serves to initiate translation. Under the same conditions, ribosomes spent more time on a downstream in-frame stop codon (S6D Fig) and less time on the two AUG sites at positions 107 (uORF1) and 266 (Orf1), reflected by a respective increase or decrease in ribosome protected reads (Fig 6D). These observations are consistent with an inverse relationship between initiation from the upstream CUG and downstream AUG codons, which is regulated by EIF1/1A.

The increase in ribosome occupancy on CUG(59) affected both gRNA and individual sgRNA, ranging in magnitude from 2 fold (Orf1a, N, M) to 8 fold (Spike, Orf6, Orf3a) upon EIF1A depletion (S6E Fig). EIF1 depletion had similar effects on some but not all viral RNAs (S6E Fig). If CUG-mediated translation of uORF1 inhibits initiation from the main AUG, EIF1/1A depletion should decrease the number of ribosomes on the main ORFs of both gRNA and sgRNAs. Indeed, knockdown of either EIF1 or 1A reduced ribosome occupancy on Orf1a (Fig 6E, left). However, only EIF1A depletion decreased ribosome occupancy on Nucleoprotein (N) and increased ribosome occupancy on Spike coding regions (Fig 6E, middle and right panels). Importantly, these changes in relative translation of gRNA and sgRNAs altered the stoichiometry of CoV2 proteins during infection. Knockdown of EIF1A, and to a lesser extent, EIF1, increased the levels of Spike and decreased the levels of Nsp1 (Fig 6F). Furthermore, knockdown of EIF1A decreased whereas knockdown of EIF1 increased the levels of N protein, consistent with the differences observed by ribosome profiling (compare Fig 6E and 6F).

Such inconsistencies between gRNA and sgRNA, as well as EIF1 and 1A depletion, are likely attributed to the variable initiation context of sgRNAs, conferring different responses to EIF1/1A depletion. Spike sgRNA is unique in that CUG(59) is in frame with the main AUG and therefore promotes—rather than inhibits—translation of the main coding region, particularly during CoV2 infection [41]. Indeed, both EIF1 and 1A knockdown resulted in a proportional increase of ribosome protected reads on both the upstream CUG and the main ORF of Spike gRNA (Figs 6E and S6E).

We next used our reporter assays to test how Nsp1, EIF1 and EIF1A affect initiation from the upstream CUG and downstream AUG. We sequentially transfected Vero cells with targeting or non-targeting siRNAs, GFP or Nsp1 plasmids, and GAPDH- or CoV2-nLuc mRNA. 4 hours after mRNA transfection, we performed RT-qPCR and luminescence measurements. As before, Nsp1 had little effect on mRNA levels for either nLuc reporter (S6F Fig). Consistent with a prior report [9], Nsp1 decreased translation from GAPDH UTRs in a dose-dependent manner, regardless of EIF1/1A levels (Fig 6G, left). In contrast, translation from CoV2 UTRs was stimulated by Nsp1, but only at low to moderate levels (Fig 6G, left). Indeed, Nsp1 was previously shown to stimulate CoV2 translation at low concentrations and inhibit it at high concentrations [26]. The observed stimulation of translation by Nsp1 was dependent on both EIF1 and 1A, because depletion of EIF1 lowered and 1A nearly abrogated the Nsp1-mediated increase in translation (Fig 6G, middle panel). Finally, replacing CUG(59) with AUG to enforce higher translation [43] of uORF1 strongly inhibited translation of the main ORF. Under these conditions, Nsp1 failed to stimulate translation at any of the concentrations tested (Fig 6G, right).

Taken together, these observations imply that Nsp1 may act as a molecular switch balancing translation of gRNA and sgRNA during infection by influencing initiator codon choice. To explore this hypothesis, we reanalyzed ribosome profiling datasets generated from Calu3 cells infected with either WT or Nsp1-dead CoV2 [22]. This mutant, in which amino acids 155–165 of Nsp1 were deleted to disrupt its ribosome binding, is unable to suppress host translation and shows delayed replication kinetics [22]. At 4 hpi, loss of Nsp1 function reduced translation of gRNA and sgRNA by up to about 95 and 90%, respectively (S6G Fig). However, at 7 hpi, translation of most sgRNA recovered to nearly WT levels whereas that of gRNA barely increased at all (S6G and S6H Fig). Our analyses thus indicate that early accumulation of Nsp1 preferentially stimulates translation of CoV2 gRNA. Indeed, for WT-CoV2, translation efficiency of gRNA increased from 4 to 7 hpi, but this increase was not observed with Nsp1-dead CoV2 (S6I Fig).

Finally, it was previously proposed that certain cellular mRNAs may also escape translation repression by Nsp1 [44]. Therefore, we wondered whether the presence of uORFs in cellular mRNAs may confer protection from Nsp1 repression. Notably, we find that Nsp1 promotes uORF bypassing not only on viral but also cellular mRNAs. At 4 hpi, translation of uORF-repressed host transcripts was higher in the presence of Nsp1, and this difference was proportional to the number of uORFs in each 5’UTR (S6J Fig).

Cell cultures and viral infection

The African green monkey kidney Vero E6 (ATCC, no. CRL-1586) and human Calu3 cells (ATCC, no. HTB-55) were grown in DMEM medium (Thermo Fisher) supplemented with 10% fetal bovine serum, 100 units/ml penicillin and 100 mg/ml streptomycin, at 37°C in a 5% CO2 incubator. A clinical isolate of SARS-CoV-2 (USA-WA1/2020, BEI Cat No: NR-52281) was propagated in Vero cells and was used for Vero experiments. Viral titers were quantified with a plaque assay. All infections were performed at biosafety level-3 (BSL-3). To assess antiviral activity, ~70% confluent monolayers of Vero cells (3×105 cells/well in 24-well plates) were pretreated with drugs or drug combinations at indicated concentrations for 3 hours (pretreatment) and then infected with SARS-CoV-2 (MOI = 0.5) at 37°C for 1 hour. The virus solution was removed, cells were further cultured with fresh medium containing drugs at the same concentrations. At 16 hours post-infection, supernatants were collected, and viral titers were measured with a plaque assay. Type I poliovirus (Mahoney), type 2 dengue (Thailand/16681/84) and Zika virus (PRVABC59) were generated, passaged and tittered as described [5], at biosafety level-2 (BSL-2).

Plaque assay

Confluent monolayers of Vero cells grown in six-well plates were incubated with the serial dilutions of virus samples (250 μl/well) at 37°C for 1 hour. Next, the cells were overlayed with 1% agarose (Invitrogen) prepared with MEM supplemented with 2% FBS and antibiotics. Three days later, cells were fixed with 4% formaldehyde for 2 hours, the overlay was discarded, and samples were stained with crystal violet dye, and the number of plaques was calculated.

Polysome profiles

A total of 1-5x10⁷ Vero or Calu3 cells in T175 flasks were washed twice with and scraped into ice-cold PBS with calcium and magnesium. Cells were pelleted at 1,200 RCF for 5 min at 4°C, and supernatants were removed. Pellets were resuspended in 220 μl polysome buffer (25 mM HEPES pH = 7.5, 100 mM NaCl, 10 mM MgCl₂, 2 mM dithiothreitol (DTT) and Complete EDTA-free protease inhibitor cocktail (Millipore Sigma). Triton X-100 and sodium deoxycholate were added to a final concentration of 1% each and the samples were incubated on ice for 20 min and centrifuged at 20,000 RCF for 10 min at 4°C to remove cell debris. 250 μl lysates were transferred to fresh tubes, combined with 125 μl 12% formaldehyde, and incubated on ice for 30 min. To quench the crosslinking reaction, samples were incubated with 125 μl 4M Tris pH = 8.0 on ice for 20 min, followed by flash freezing. Frozen lysates were thawed on ice and loaded on 10–50% sucrose gradients in Polysome buffer and subjected to ultracentrifugation at 36,000 rpm in an SW41.Ti swinging bucket rotor (Beckman Coulter) for 150 min at 4°C. 15 Equal volume fractions were collected using Gradient Station (BioComp) with continuous monitoring of rRNA at UV254. Fractions were pooled as follows: 1–4 for free RNP; 5 for 80S monosomes; 6–8 for light polysomes, and 9–15 for heavy polysomes. For polysome profiles of cells transfected with nanoluciferase reporters, the above protocol was followed without formaldehyde fixation or pooling of gradient fractions.

Sample preparation for proteomic analysis

Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 μl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C, and supernatant was removed. Beads were resuspended in 100 μl PBS supplemented with 2% SDS and incubated at 95°C for 15 min to elute proteins from beads and reverse formaldehyde crosslinks. Beads were pelleted at 600 RCF for 5 min at room temperature, and supernatants were transferred to fresh tubes. Protein was extracted using methanol-chloroform precipitation: 400 μl methanol, 100 μl chloroform and 350 μl water were added sequentially to each 100 μl sample, followed by centrifugation at 14,000 RCF for 5 min at room temperature. The top phase was removed, and the protein interphase was precipitated by addition of 400 μl methanol, followed by centrifugation at 14,000 g for 5 min at room temperature. Pellets were air dried and resuspended in 8M urea, 25 mM ammonium bicarbonate (pH 7.5). Protein concentration was determined by BCA (Thermo Fisher) and 1–2 μg total protein were subjected to reduction and alkylation by incubation with 10 mM DTT for 1 h at room temperature followed by 5 mM iodoacetamide for 45 min at room temperature, in the dark. The samples were then incubated with 1:50 enzyme to protein ratio of sequencing-grade trypsin (Promega) overnight at 37°C. Peptides were desalted with μC18 Ziptips (Millipore Sigma), dried and resuspended in 10 μL 0.1% formic acid in water.

LC-MS/MS acquisition

Digested peptides were resuspended in 0.1% formic acid and 40% of each specimen was analyzed on an LTQ Orbitrap Fusion Lumos Tribrid Mass Spectrometer (Thermo Fisher Scientific) coupled with a Dionex Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). Peptides were separated by capillary reverse-phase chromatography for 120 min on a 24-cm reversed-phase column (inner diameter of 100 μm, packed in-house with ReproSil-Pur C18-AQ 3.0 m resin (Dr. Maisch)). A multi-step linear gradient was applied as follows: 96% A + 4% B to 75% A + 25% B over 70 min; 75% A + 25% B to 60% A + 40% B over 20 min; 60% A + 40% B to 2% A + 98% B over 2 min and maintain this proportion for 2 min before returning to 98% A + 2% B and holding this proportion for 24 min. Buffer A is 0.1% formic acid in water and buffer B is 0.1% formic acid in acetonitrile; flow rates were maintained at 300 nl/min throughout the gradient. Full MS scans of intact peptide precursor ions were acquired in the Orbitrap mass analyser at a resolution of 120,000 (FWHM) and m/z scan ranges of 400–1,500 in a data-dependent mode. The automatic gain control (AGC) target was 4 × 10^5, the maximum injection time was 50 ms, and the isolation width was 1.6 Da. The most intense ions recorded in full MS scans were then selected for MS2 fragmentation in the Orbitrap mass analyser using higher-energy collisional dissociation (HCD) with a normalized collision energy of 30% and resolution of 15,000 (FWHM). Monoisotopic precursor selection was enabled, and singly charged ion species and ions with no unassigned charge states were excluded from MS2 analysis. Dynamic exclusion was enabled, preventing repeated MS2 acquisitions of precursor ions within a 10 ppm m/z window for 15 s. AGC targets were 5 × 10^4 and the maximum injection time was 100 ms.

Mass spectrometry data processing

Raw MS data were processed using MaxQuant version 1.6.7.0 [62]. MS/MS spectra searches were performed using the Andromeda search engine [63] against the forward and reverse human and mouse Uniprot databases (downloaded August 28, 2017 and November 25, 2020, respectively). Cysteine carbamidomethylation was chosen as fixed modification and methionine oxidation and N-terminal acetylation as variable modifications. Parent peptides and fragment ions were searched with maximal mass deviation of 6 and 20 ppm, respectively. Mass recalibration was performed with a window of 20 ppm. Maximum allowed false discovery rate (FDR) was <0.01 at both the peptide and protein levels, based on a standard target-decoy database approach. The “calculate peak properties” and “match between runs” options were enabled. All statistical tests were performed with Perseus version 2.0.7.0 using either ProteinGroups or Peptides output tables from MaxQuant. Potential contaminants, proteins identified in the reverse dataset and proteins only identified by site were filtered out. For proteins not annotated in the Chlorocebus sabaeus proteome, we manually added the human ortholog gene symbol where similarity was >90%. Human ortholog Uniprot IDs were added based on gene symbol. Intensity-based absolute quantification (iBAQ) was used to estimate absolute protein abundance. Data was log2 transformed and median adjusted. Two-sided Student’s t-test with a permutation-based FDR of 0.01 and S0 of 0.1 with 250 randomizations was used to determine statistically significant differences between grouped replicates. Categorical annotation was based on Gene Ontology Biological Process (GOBP), Molecular Function (GOMF) and Cellular Component (GOCC), as well as protein complex assembly by CORUM.

Drug treatments, toxicity and synergy

To determine the effects of drugs on host cells, 5x10⁴ Vero cells were seeded per well in a black wall, clear bottom 96-well plate. Drugs were added 24 h after seeding. 24 h after adding drugs, cell viability was assayed using CellTiter-Glo (Promega), according to the manufacturer’s instructions, on a Tecan Ultra Evolution microplate reader. To determine the effects of drugs on CoV2 infection, virus adsorption was performed as described above, at MOI = 0.5, and inoculum was replaced with fresh media containing drugs. Cell supernatants were collected at 16 hpi and subjected to plaque assays. SynergyFinder2 [64] was used to calculate Bliss scores.

Nanoluciferase reporters, viral proteins, and RNA/DNA transfections

Plasmids encoding for nanoluciferase (nLuc) flanked by 5’ and 3’ untranslated regions of either CoV2 or GAPDH, and plasmids encoding for strep-tagged individual CoV2 proteins were kind gifts from Joseph (Jody) Puglisi [9] and Nevan Krogan [3]. To generate translation-competent mRNA, nLuc plasmids were linearized using SpeI and subjected to in-vitro transcription using HiScribe T7 kit (New England Biolabs), according to the manufacturer’s instructions. In 20 μL total volume per reaction, 1 μg plasmid was combined with 2 μL buffer, 2 μL of each nucleotide, 1.6 μL cap, 1 μL SUPERase-in and 2 μL enzyme. Transcription was performed for 3 h at 37°C and terminated by precipitation. Each sample was combined with 1:1 v/v 5 M ammonium acetate, incubated on ice for 15 min, and centrifuged 20,000 RCF for 30 min at 4°C. Pellets were washed with 1 mL 75% ethanol, air dried and resuspended in 50 μL nuclease-free water. RNA integrity was confirmed using agarose gels stained with SYBR Safe, and concentration was determined by nanodrop.

For RNA transfections, Vero cells were plated at 2x10⁴ cells/well in 96-well plates. The following day, transfection reactions were prepared as follows (per well). 0.15 μL Lipofectamine MessengerMAX (Thermo) was diluted in 5 μL OptiMEM (Thermo) and incubated for 10 min at RT. 20 ng in-vitro transcribed RNA was diluted in 5 μL OptiMEM and mixed with the MessengerMAX solution for 5 min. 10 μL transfection reactions were added per well, and cells were harvested at 4 h post-transfection. Luminescence measurements were acquired using Nano-Glo Luciferase Assay System (Promega), according to the manufacturer’s instructions, on a Tecan Ultra Evolution microplate reader.

For DNA/RNA transfections, Vero cells were plated at 2x10⁴ cells/well in 96-well plates. The following day, transfection reactions were prepared as follows (per well). 1 μL Lipofectamine 2000 (Thermo) was diluted in 5 μL OptiMEM and 25 ng plasmid DNA was diluted in 5 μL OptiMEM. The two solutions were mixed, incubated at RT for 5 min, and added to cells. Media was replaced at 6 h post-transfection. RNA transfections were performed as above, 24 h after DNA transfections. For DNA/RNA transfections prior to sucrose gradient fraction, the above procedure was scaled up 500x, and cells were collected for polysome profiled analysis, as described above.

Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted using Trizol (Invitrogen) according to the manufacturer’s instructions. To extract RNA from sucrose gradient fractions, 1 μl pellet paint co-precipitant (Millipore Sigma) and 500 μl phenol:chloroform:isoamyl alcohol (25:24:1) were added to each 500 μl fraction and incubated for 5 min at room temperature. Phase separation was performed at 12,000 RCF for 15 min at 4°C, and the top phase was removed and subjected to another round of extraction as above. 400 μl of the top phase was combined with 600 μl isopropanol and RNA was pelleted at 12,000 RCF for 1 h at 4°C. Pellets were washed with 1 ml 75% ice-cold ethanol, air dried and resuspend in 20 μl RNase-free water. cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher), according to the manufacturer’s instructions, using 5 μl of RNA from each gradient fraction. qRT-PCR analysis was performed using SensiFast SYBR (BioLine) and gene-specific primers (nLuc FWD 5’ CAGCCGGCTACAACCTGGAC 3’, REV 5’ AGCCCATTTTCACCGCTCAG 3’; GAPDH FWD 5’ AGGTCGGAGTCAACGGAT 3’, REV 5’ TCCTGGAAGATGGTGATG 3’; ACTB FWD 5’ GGCTGTATTCCCCTCCATCG 3’, REV 5’ CCAGTTGGTAACAATGCCATGT 3’; 18S rRNA FWD 5’ GTAACCCGTTGAACCCCATT 3’, REV 5’ CCATCCAATCGGTAGTAGCG 3’), according to the manufacturer’s instructions. To estimate relative abundance of specific mRNAs in each gradient fraction, each Ct value was divided by the sum of Ct values across all gradient fractions.

siRNA transfections

siRNAs against EIF1AX, EIF1 and EIF4B (Smartpool M-011262-02-0005, M-015804-01-0005, L-020179-00-0005), as well as nontargeting siRNAs (Smartpool D-001206-13-05), were from Dharmacon. siRNAs were reconstituted in nuclease-free water to a concentration of 10 μM. Vero cells were plated at 1x10⁵ cells/well of 12-well plates. The following day, 3 μl RNAiMax reagent (Thermo) was diluted in 50 μl OptiMEM and combined with 2 μl siRNA in 50 μl OptiMEM. After 5 min at RT, the reaction mix was added to cells, and media was replaced after 6 h. At 48 h post-transfection, cells were passaged and transfected again, as above. Additional DNA/RNA transfections were launched 48 h after the second siRNA transfection.

SDS-PAGE and immunoblotting

For immunoblotting, cells were washed twice with ice-cold PBS and lysed on plate with RIPA buffer (25 mM Tris-HCl pH = 7.5, 150 mM NaCl, 1% NP-40, 0.5% Sodium deoxycholate) supplemented with 2 mM DTT, Complete EDTA-free protease inhibitor cocktail, and 50 units/mL benzonase (Millipore Sigma) to remove DNA. Lysis was performed on ice for 20 min and lysates were clarified by centrifugation for 10 min at 12,000 RCF at 4°C. Protein concentration was determined by BCA assay (Thermo Fisher) and 4x Laemmli sample buffer (Bio-Rad) supplemented with fresh 10% 2-mercaptoethanol was added to a final concentration of x1. 15 μg of each sample was resolved on 4–20% SDS-PAGE (Bio-Rad), transferred to 0.2 μm PVDF membranes presoaked in methanol for 30 sec. Membranes were blocked with 4% molecular biology grade BSA (Millipore Sigma) in tris-buffered saline supplemented with 0.1% Tween-20 (Millipore Sigma) (TBST) for 1 h at room temperature then probed with specific primary antibodies for 2 h at room temperature. Primary antibodies were diluted in 4% BSA/TBST supplemented with 0.02% sodium azide, as follows: rabbit anti-EIF1A (1:1000, GeneTex GTX118810), rabbit anti-EIF1 (1:1000, ProteinTech 15276-1-AP), mouse anti-beta tubulin (1:10,000, EMD 05–661). Secondary antibodies were diluted 1:10,000 in TBST. Western blot detection was done using ECL Plus Western Blotting Substrate (Thermo Fisher) and images were taken either by film radiography.

Ribosome profiling analysis

Ribosome footprints were prepared essentially as described [65]. EIF1A and nontargeting siRNA were transfected into Vero cells as above, and 24 h after the second transfection, cells were replated at 2x10⁶ per T25 flask. CoV2 infection was launched the following day at MOI = 5. At 16 hpi, cells were washed with 5 mL ice-cold PBS with calcium and magnesium. PBS was fully aspirated and replaced with 350 μl polysome buffer (25 mM HEPES pH = 7.5, 100 mM NaCl, 10 mM MgCl₂, 2 mM DTT and Complete EDTA-free protease inhibitor cocktail) supplemented with 1% Triton X-100 and 1% sodium deoxycholate. On-plate lysis was allowed to proceed on ice for 10 min with occasional shaking. Lysates were transferred to fresh tubes and clarified at 12,000 RCF for 5 min at 4°C. 200 μl clarified lysate were combined with 5 μl RNase I (10 U/μl, Invitrogen). Reactions were incubated at RT for 45 min with shaking, and terminated by addition of 200 U Superase-In (Thermo). Spin columns were used to separate monosome, as follows. S-400 HR MicroSpin Columns (Amersham) were drained at 600 RCF for 4 min at 4°C and the flowthrough was discarded. Resin was resuspended in 200 μl polysome buffer and centrifuged again. Each 200 μl RNase-digested sample was loaded on 2 separate columns (100 μl each), centrifuged at 600 RCF for 2 min at 4°C. The flowthroughs were combined and 800 μl Trizol (Invitrogen) was added. RNA was extracted according to the manufacturer’s instructions. Footprints were resolved on 8M urea 15% PAGE. 15–35 nt fragments were extracted, dephosphorylated, linker ligated according to the protocol. rRNA depletion was performed using Ribo-Zero rRNA Removal Kit (Illumina), according to the manufacturer’s instructions. All downstream steps were performed as described [65]. Libraries from two independent repeats were sequenced on a NextSeq 2000 P3 (Illumina). After demultiplexing, sequencing reads were trimmed of adaptor sequences and quality filtered using cutadapt (-a CTGTAGGCACCATCAAT -m1 -q20). Ribosomal RNA was removed using Bowtie2 (—un). Remaining reads 28–32 nt in length were aligned to SARS-Cov-2 genome (Genebank MN985325) using Hisat2 (—trim5 1). Per-nucleotide ribosome occupancy tables were generated using bamCoverage and visualized on Integrated Genome Viewer. For periodicity analysis, a p-site offset of 13 nt was used. For re-analysis of previously published ribosome profiling datasets, read count tables for both mRNA and ribosome footprints were downloaded from GSE200422 [22]. For uORF annotation, we used a previous dataset generated using ribosome profiling (dataset EV3) [42].