Proteomic analysis of T. brucei-infected tsetse saliva reveals an enrichment of parasite GPI-anchored surface proteins

We initially investigated the protein composition of Glossina morsitans morsitans saliva with a T. b. brucei infection in the salivary glands to identify novel soluble factors important for parasite transmission. We performed high-resolution nano-liquid chromatography-tandem mass spectrometry (nLC-MS/MS) on pools of saliva from flies at 30 days post-infection (dpi) in three biological replicates (S1 Fig). After filtering out the Glossina protein hits (S1 Table), we detected peptides from the bacterial symbiont Sodalis glossinidius [39] in both uninfected and trypanosome-infected saliva (S2 Table). The presence of these symbiont peptides was validated by immunoblotting using an anti-Sodalis Hsp60 monoclonal antibody (S2 Fig). Following manual curation of the MS/MS spectra, we also identified 45 unique peptides derived from a total of 27 T. b. brucei proteins in infected saliva datasets only (>95% confidence protein identification) (S3 Table). Of the identified proteins, 17 (62.9%) were predicted to be intracellular (S4 Table) mainly linked to functions such as protein folding (14.8%), cytoskeleton (11.1%), and metabolic processes (7.4%). The remaining 10 proteins (37.1%) were predicted to be GPI-anchored surface proteins from three major families (Fig 1A). We found four unique peptides shared by eight different BARP isoforms and identified five different mVSGs from seven unique peptides (Fig 1A, S1 File and S3 Table). Notably, we also identified a single peptide (100% confidence, supported by two spectra, S1 File and S3 Table) belonging to SGE1 [37], a small family of GPI-anchored proteins we characterized and renamed metacyclic invariant surface proteins (MISP) (Fig 1A) because of its predominant life-cycle expression (see below). The conserved peptide ‘SVAEDNSAASTAR’ was fully conserved across all MISP isoforms (Fig 1B–1D and S3 Table).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Identification of sequence analyses of MISP.

(A) Summary table of trypanosome GPI-anchored proteins identified in T. brucei-infected tsetse saliva by nLC-MS/MS. All identified proteins and peptides have >95% confidence and were manually curated. Protein accession code (Protein ID), protein description (Annotation), number of identified unique peptides (Peptides), and number of spectra (Spectra) are indicated; see peptides and spectra in S1 File. Accession codes either from TriTrypDB (BARP and MISP) or UniProt (VSG). (I) representative ID for Tb927.9.15520, Tb927.9.15530, Tb927.9.15550, Tb927.9.15590, Tb927.9.15600, Tb927.9.15620 and Tb927.9.15660; (II) representative ID for VSGs 646, 769, 3613, 1125.408, 1125.474, 1125.1142, 1125.4207 and 1125.4707; (III) representative ID for Tb927.7.360, Tb927.7.380, Tb927.7.400, Tb927.7.420, Tb927.7.440. (B) Phylogenetic tree generated from a multiple sequence alignment of all MISP predicted proteins. Note the demarcation of two sub-families MISP-A (light blue) and MISP-B (dark blue) and the least-conserved T. congolense isoform (red). The T. b. brucei MISP are boxed. Tree created using PhyML 3.1 and the WAG substitution model of maximum likelihood; bootstrap of 500; numbers show branch support values (%); scale bar: 0.1 substitutions/site. (C) Schematic representation of the T. b. brucei chromosome 7 region containing the misp gene array. Genes represented by arrows; misp-A (light blue), misp-B (light purple), unrelated genes (light grey); C-terminal repeats represented by purple rectangles on the arrows. (D) Multiple protein alignment of T. b. brucei MISP isoforms. Residues colored from grey (full conservation) to bright red (highest divergence). Protein domains highlighted: N- signal peptide (green), predicted N-glycosylation sites (yellow asparagine), disulphide bonds identified in crystal structure (cysteines in black boxes), C-terminus repetitive motives of 26 residues (blue) and GPI-anchor signal peptide (red). The conserved peptide ‘SVAEDNSAASTAR’ identified by nLC-MS/MS is highlighted in orange. The top bar numbers indicate residue position starting from Met¹. Top bar colors indicate the main protein domains N-terminus (purple) and C-terminus (grey).

https://doi.org/10.1371/journal.ppat.1011269.g001

The Metacyclic Invariant Surface Proteins (MISP) family

MISP proteins are part of the large Fam50 family of trypanosome surface proteins [40]. T. b. brucei contains five misp paralog genes (Tb927.7.360, Tb927.7.380, Tb927.7.400, Tb927.7.420, Tb927.7.440 in reference strain TREU927), which encode for proteins that are unique in sequence and have no predicted function. All five T. b. brucei paralogs are localized to chromosome 7 (Fig 1C) and are separated by unrelated genes encoding hypothetical proteins (Tb927.7.370, Tb927.7.390, Tb927.7.410 and Tb927.7.430). Notably, the same misp homologs are found in T. b. gambiense (Tbg972.7.270 and Tbg972.7.290). Furthermore, slightly divergent versions of misp genes are found in the animal trypanosome species T. evansi (TevSTIB805.7.300, TevSTIB805.7.320 and TevSTIB805.7.380) and T. congolense (TcIL3000.0.02370), and no homologs were found in the T. vivax genome (S3 Fig). Using a phylogenetic analysis (PhyML 3.1) [41], we determined that MISP are comprised of two sub-families (MISP-A and MISP-B) (Fig 1B). MISP-A members are mainly characterized by containing one to three 26 residue repetitive motives at the C-terminus (see below) and MISP-B isoforms, in contrast, present no C-terminal repeats. The T. congolense homolog (TcIL3000.0.02370) shares only 34.2% identity with the others and was not included into either sub-family (S3B Fig). A comparison of all T. b. brucei MISP paralogs revealed an overall amino acid sequence identity of ~79% (Fig 1D), with the N-terminal domain (Met¹–Glu²³⁷) showing greater conservation (88.7% identity) compared to the divergent C-terminal (Lys²³⁸-Ser³⁵⁷) (49.0% identity). Importantly, sequence divergence is not random but primarily localized to the charged 26 residue repetitive motives (EVEEVPKKDPEGNVEVPEDKEKTERT or DVQEISREEFEGNVEVPEDKEKTERT). We identified predicted signal peptides for all MISP isoforms (Met¹–Ala/Thr¹⁷). While no transmembrane domains were identified, all MISP isoforms contain a predicted GPI omega site at the C-terminus (Fig 1D and S5 Table). Furthermore, all MISP isoforms contain at least one potential N-glycosylation site (Asn⁵⁹), while Tb927.7.400 and Tb927.7.420 contain an additional site on Asn¹²¹ (S5 Table). Overall, sequence-based predictions suggest that MISP is a family of surface GPI-anchored glycoproteins presenting little sequence divergence and differential C-terminal lengths.

MISP are expressed on the surface of T. b. brucei salivary gland stages

To understand the expression pattern of individual misp paralogs throughout the T. b. brucei’s life cycle, we used semi-quantitative RT-PCR to detect transcript levels of individual misp isoforms and barp, which are markers for salivary gland epimastigotes [21] (Fig 2A). Total RNA was purified from all isolated T. b. brucei life stages obtained from both in vitro cultures (i.e., bloodstream forms and procyclic cultured forms) and tsetse-derived parasites at 30 dpi. (i.e., midgut procyclics, proventricular parasites (mixture of 95% mesocyclics and 5% epimastigotes), whole infected SGs, and metacyclics isolated from infected saliva (mixture of 95% metacyclics and 5% epimastigotes). Thirty day old uninfected flies were used as an age-matched control. Due to the high sequence identity among misp paralogs, assessing the expression of individual misp transcripts by real-time RT-PCR was not feasible and hence, we used semi-quantitative RT-PCR to target the different C-terminal misp repetitive regions, which are unique amongst four of the paralogs with differences of 78 bp (S4 Fig). While all control samples from uninfected flies were negative, whole infected SGs and purified metacyclics from saliva showed the highest levels of misp transcripts compared to midgut procyclics (11.8-fold) and BSFs (25.1-fold) (Fig 2A). Expression of misp transcripts was also found to be high in trypanosomes colonizing the PV, suggesting it is in those stages where gene up regulation starts. Although there seems to be an overall preferential selection for paralogs with the shortest C-termini (misp400/420), the longer paralogs misp380 and misp360 were up regulated and significantly higher in SG stages. In parallel, the transcriptional profile of misp was validated by measuring that from a transgenic cell line overexpressing misp360 under a tetracycline-inducible promoter (S4 Fig). Interestingly, all barp transcripts (originated from 14 paralogs sharing >60% identity, S5 Fig) followed a similar expression pattern, although PV-associated trypanosomes were the highest expressors, suggesting that the expression of barp may precede that of misp genes during development.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Expression and localization of MISP and BARP.

(A) Relative mRNA expression levels (arbitrary units, normalized to the expression of tert) of T. b. brucei misp paralogs (blue) and barp (yellow), in cultured bloodstream forms (BSF), procyclic cultured forms (PCF), midgut procyclics (MG), proventricular forms (PV), salivary gland forms (SG) and purified metacyclic forms (MCF). Bars represent mean values; error bars represent ±S.D from two technical replicates. (B) Representative images of non-permeabilized fixed parasites extracted from infected tsetse salivary glands, immunostained with either anti-MISP (B) or anti-BARP (C) polyclonal antibodies; epimastigote (EMF), pre-metacyclic (P-MCF) and metacyclic forms (MCF); shown as phase, anti-MISP (cyan) or anti-BARP (yellow), and DAPI (magenta); kinetoplasts (K) and nuclei (N) are annotated in the DAPI channel; anterior (A) and posterior (P) ends of the parasite are annotated in the Phase channel. (D) Maximum intensity projection of representative metacyclic cells immunostained with anti-MISP (top) or anti-BARP (bottom) polyclonal antibodies and 3D-reconstructed from z-stacks; y-z orthogonal views show surface localization of the signal and graphs on the right plot fluorescence intensity over the white line crossing the cell section. (E) Localization of anti-HA monoclonal antibodies on metacyclic (MCF), bloodstream form (BSF) and procyclic cultured form (PCF) transgenic T. b. brucei cells overexpressing ectopic HA-tagged MISP360 upon doxycycline induction; shown as phase, anti-HA (cyan), DAPI (magenta) and merge; kinetoplasts (K) and nuclei (N) are annotated in the DAPI channel; anterior (A) and posterior (P) ends of the parasite are annotated in the Phase channel. (F) Representative HRSEM images of wild type metacyclic (MCF), procyclic MISP360 overexpressor uninduced (PCF MISP -) and induced (PCF MISP+) cell surfaces immunostained with anti-MISP polyclonal antibodies; secondary electron detection (SE), 50% inverted backscatter electron detection (50% BSD); scale bars annotated in SE.

https://doi.org/10.1371/journal.ppat.1011269.g002

Having identified SG stages as the major expressors of misp and barp transcripts, we next determined which life stages translated these transcripts into proteins by immunostaining with polyclonal antibodies that recognize epitopes conserved across all MISP or BARP isoforms. Antibody binding was only to SG parasites, both within the glands (S6 Fig) and ex vivo (Fig 2B and 2C), and no recognition was detected on BSFs, PCFs, midgut procyclics or PV parasites by either antibody (S7 Fig). Surprisingly, despite PV-associated trypanosomes showing high levels of misp and barp transcripts, the corresponding gene products are not produced until they reach the next developmental stage in the salivary glands. Instead, we confirmed that both mesocyclic and epimastigote forms in the proventriculus expressed EP-procyclin as the major surface GPI-anchored protein (S8 Fig). Furthermore, both polyclonal anti-MISP and anti-BARP antibodies recognized all parasite cells and stages in infected SGs, including attached epimastigotes, pre-metacyclics and mature metacyclic forms (Figs 2B, 2D and S6). The relative mean fluorescence intensity of MISP was higher in metacyclics compared to epimastigotes (2.3-fold); in contrast, BARP intensity was found to be higher in epimastigotes than in metacyclics (3.3-fold) (S9 Fig). Moreover, MISP appeared to localize evenly across the cell surface of non-permeabilized fixed epimastigote and metacyclic cells (Fig 2B). In contrast, BARP appears homogeneously expressed on the surface of all epimastigotes, yet on metacyclics, BARP is detected on the surface of few (~10.4% of the cells; n = 481), while the rest show exclusively flagellar expression (Figs 2C and S10). To confirm the identity of SG-specific trypanosomes, we measured the length of parasites and the relative position of kDNA and nucleus (S11 Fig), and performed immunostainings with anti-CRD polyclonal antibodies, which recognize the GPI cross-reacting determinant (CRD) epitope [23,42]. While epimastigotes and pre-metacyclics were not detected by the antibody, mature metacyclics showed surface staining as indirect detection of mVSGs that are partially cleaved by GPI-PLC (S12 Fig). To confirm the localization of MISP and BARP in metacyclics, immuno-stained cells were 3D-rendered using confocal laser scanning microscopy and orthogonal views from z-stacks confirmed the fluorescence only localized to the edges of the cell body (Fig 2D).

As an additional approach to investigate MISP localization, we engineered a T. b. brucei transgenic cell line to ectopically express HA/eGFP-tagged MISP360 under a tetracycline-inducible promoter (Figs 2E and S13). Upon induction, ectopic MISP localized on the metacyclic cell body surface in a pattern resembling that of wild type cells (S13C Fig). However, in BSF, ectopic MISP was only detected in the flagellar pocket and, upon differentiation to PCF, it was then found redistributed to the flagellum and co-localised with the paraflagellar rod (PFR) (S13C Fig). We also used high-resolution scanning electron microscopy (HRSEM) to precisely locate anti-MISP antibodies on the surface of stained cells (Fig 2F). While uninduced MISP360 overexpressing PCF cells did not show antibody binding, induction of the transgene led to detection of the ectopic MISP mainly along the flagellum as in Fig 2E. In contrast, native MISP was equally detected in wild type metacyclic cells on both flagellum and cell body, thus validating the observations from confocal microscopy (Fig 2B and 2D). To confirm exposure of MISP epitopes in native conditions and free of potential fixative-derived artifacts, we performed immunostaining on live wild type metacyclic cells, which still displayed positive binding of anti-MISP antibodies on the cell surface (S14 Fig). Lastly, metacyclics extracted from flies infected with T. brucei TSW196 strain are also recognized by the anti-MISP antibody (S15 Fig), confirming that staining is not specific for AnTat 1.1 metacyclic trypanosomes.

The N-terminal ectodomains of MISP and BARP adopt a triple helix bundle structure

To complement the expression and localization analyses, we next determined the crystal structure of the conserved N-terminal ectodomain (Gly²⁴-Ala²³⁴) of MISP360 (Tb427.07.360; T. b. brucei MISP360 homolog in reference strain Lister 427) to 1.82 Å resolution (Fig 3). Crystals of purified, monomeric MISP360 (Figs 3A–3B and S16A–S16B) were obtained using the hanging drop method and grew in space group P2₁2₁2₁ with a single molecule in the asymmetric unit. The structure of MISP360 was determined by molecular replacement using a truncated form of T. congolense GARP (PDB entry: 2Y44) as the search model. The identification of GARP as a suitable model was based on secondary structure predictions as the amino acid sequence identity of the N-terminal ectodomain is only 15%. The overall structure of MISP360 was well defined with only two residues from the N-terminus remaining unmodelled (Gly²⁴ and Ser²⁵). The core of the N-terminal ectodomain adopts an elongated structure measuring approximately 83 Å in height and spanning approximately 26 Å in width (Fig 3C, left). The ectodomain is well ordered with low B-factors throughout the protein (Fig 3C, middle). MISP360 adopts an overall triple helical bundle structure composed of a core of extended twisted helices capped by a smaller helical bundle at the N-terminal end. The helical bundle that dominates the structure consists principally of three helices (Fig 3C, right): helix I is comprised of residues Val²⁹-Ser⁸³, helix II of Glu⁸⁸-Thr¹³⁰ and helix VI of Phe¹⁸²-Ala²³³. The three helices adopt a bend of approximately 30 degrees at Gly⁴⁴ (helix I), Ala¹²⁷ (helix II) and Leu¹⁹⁵ (helix VI) and collectively form the helical bundle cap. In addition to the terminal portions of the three major helices, the helical bundle includes three shorter helices: helix III (Asp¹³⁴-Glu¹⁴²), which is connected by a 5-residue loop to helix IV (Ser¹⁴⁸-Gly¹⁵⁶), and helix V (Ser¹⁶⁶-Phe¹⁷⁹) connected to helix IV by a 9-residue loop. Helices IV and V lie at either side of helix I and form the broadest face of the helical bundle cap. Moreover, the head structure of MISP360 is anchored by two disulphide bonds; one between Cys³⁶ and Cys¹⁵⁷, and the other between Cys¹⁷⁷ and Cys¹⁸⁵ (Fig 1D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Crystal structures of MISP and BARP N-terminal ectodomains.

(A) Schematic representation of MISP360 and BARP protein sequences, highlighting in color the region recombinantly expressed in E. coli and crystallized; numbers indicate residue positions, signal peptide (SP), C-terminal domain (C-term), GPI-anchor peptide (GPI). (B) FPLC SEC elution chromatogram of recombinant MISP360; SDS-PAGE of monomeric recombinant MISP360 (inset). (C) MISP360 N-terminus crystal structure with molecular surface representation. The structure was found to be 83.3 Å tall, 25.5 Å in width with a 30° helix bend at the top (left); B-factor putty model with ordered regions displayed in blue and thin tubes and flexible regions in red and thicker tubes (middle); secondary structure depiction highlighting the organization of the helices (right); bend-forming residues are in parentheses; coiled structures are represented in white. (D) BARP high confidence homology model generated with Modeller 9v18 [43] shown with a semi-transparent surface representation. The BARP model reveals an overall architecture that is 82.7 Å tall, 25.0 Å in width with a 34° helix bend consistent with the molecular envelope calculated from the 3.2 Å X-ray crystallography diffraction data set. (E) Structural superimposition of the MISP360 N-terminus crystal structure (cyan) with GARP (purple, PDB: 2Y44) and the high confidence model of BARP (orange) (left). A black dashed line highlights the area where the apical surface pocket is found. Top view of an electrostatic surface representation of MISP360, BARP and GARP where the surface pocket is found (middle), and its orthogonal view indicating the residues forming the pocket and size (right). (F) Conservation of the pocket-forming (top) and overall (bottom) residues across MISP360, BARP and GARP depicted on the MISP360 structure (left). Residue conservation between the five T. brucei MISP isoforms on the MISP360 structure (right); from most variable (dark blue) to most conserved (dark purple). (G) Schematic comparison of the C-terminal domain lengths of BARP, VSG and MISP; scale bar = 10 residues; dashed line sets length baseline (VSG). (H) Structural model of the proposed T. brucei metacyclic surface glycocalyx displaying the GPI-anchored metacyclic VSG homodimers (mVSG; light and deep purple), MISP-A (cyan), MISP-B (dark blue) and remains of BARP (yellow). The mVSG structure is represented with a model of mVAT4 based on the crystal structure of VSG 221 N- (PDB: 1VSG) and C-terminus (PDB: 1XU6). MISP is represented with the crystal structure of MISP360 N-terminus (PDB: 5VTL) and a model of its C-terminus; BARP is represented with our confidence model.

https://doi.org/10.1371/journal.ppat.1011269.g003

Given that BARP is co-expressed with MISP in both epimastigote and metacyclic forms (Fig 2C), we also sought to determine its crystal structure after expression in E. coli and purification (S16C and S16D Fig). Diffraction data was collected to 3.2 Å resolution and structure solution revealed a molecular envelope consistent with MISP. However, the data quality did not support a detailed atomic level refinement and thus we opted to generate a high-confidence BARP (Tb927.9.15630) homology model using Modeller 9v18 [43]. Consistent with the X-ray data, the BARP model revealed an extended helical architecture with comparable dimensions and a largely conserved helical bundle relative to MISP360 (Fig 3D).

The lack of significant sequence identity between MISP360 and any protein with known function led us to perform a DALI search [44] to identify structural homologs. T. congolense’s GARP, of unknown function, was identified as the top hit with a Z-score of 21.4. A least squares superposition between the two structures resulted in a root-mean-square deviation of 1.7 Å over 183 C_α atoms (Fig 3E, left). The DALI search also revealed structural homology to the previously characterized haptoglobin-hemoglobin receptor (HpHbR) from T. brucei (PDB: 4X0J) and T. congolense (PDB: 4E40) [45, 46], and to a T. brucei VSG monomer (PDB: 1VSG) with Z-scores of 18.1, 17.7 and 6.5, respectively. All these proteins exhibit a complementary core of twisted three helical bundles (S17 Fig). Structural comparison, however, indicates a closer architectural similarity with HpHbR compared to VSG, due in part to the breakdown of the third helix into loops and extensions enabling substantial conformational diversity in VSG [47]. Moreover, MISP360 is monomeric in contrast to dimeric VSGs [47]. Despite the general structural similarity with GARP, BARP, HpHbR and the VSG monomer, the overall low sequence identity and the lack of key conserved residues suggest a different biological role for MISP.

Surface analysis of the MISP360 and GARP [48] crystal structures, and the BARP high confidence homology model revealed a similar distribution of acidic and basic patches along the entire length of the structure with no clear localized charge densities that would indicate a molecular recognition site (Fig 3E). However, a surface pocket of similar dimensions was identified at the membrane distal end near the region where the core helices bend in each protein (Fig 3E), but intriguingly, the residues forming the pockets are quite divergent. While the pocket in MISP360 is mainly formed by hydrophobic residues, BARP’s contain both hydrophobic and basic residues, and GARP’s are formed by acidic, polar and hydrophobic amino acids. This variability in pocket residue composition prompted us to map the residues conserved between MISP360, BARP and GARP onto the MISP360 crystal structure using ConSurf [49, 50] (Fig 3F, left), which showed no clear conservation among the pocket-forming residues. Moreover, mapping conservation between the five T. brucei MISP isoforms on MISP360, revealed that most of the conserved residues are found forming the core of the helices and pocket. However, a striking 51% of the non-conserved residues (representing 22.3% of the full protein sequence) are in close proximity to the pocket (Fig 3F, right), suggesting these residues may mediate differential affinity or recognition of putative ligands.

A structural comparison between the VSG MiTat 1.2 N-terminus (PDB: 1VSG), MISP360, and the BARP model revealed they all share a similar height (~99.9 Å, ~93.0 Å and ~89.2 Å, respectively) (S18A Fig). However, when comparing the sequence length of their unstructured C-terminal domains (Fig 3G) with that of VSGs, it was clear that MISP360 and MISP380 have ~71% and ~34% longer C-termini; MISP440 has an equivalent length and MISP400/420 have a 60% shorter C-terminus. All BARP isoforms (except Tb927.9.15590) lack a C-terminal domain. By combining the crystal structure of MISP360 and the MISP C-terminal sequences, we generated structural models for all T. brucei MISP isoforms using I-TASSER [51–53] and IntFOLD [54] (S18B Fig). Similar to TcHpHbR and VSG monomers, we predict that the MISP monomeric triple helical bundle is vertically oriented and, within the MCF surface context, is in close contact with neighboring mVSG homodimers. Since MISP360/380 have longer C-terminal domains than VSGs, and despite their lack of secondary structure, we predict that the MISP N-terminal domains (except for MISP400/420) could extend above the mVSG coat (Figs 3H and S18B). Consistent with our live immunostaining results (S14 Fig), these data suggest that despite being covered by a dense coat of mVSG homodimers, metacyclic trypomastigotes still allow room for the co-exposure of invariant GPI-anchored glycoproteins throughout the cell surface like BARP and MISP.

MISP does not protect mice against a tsetse-transmitted T. brucei infection

Since we found MISP isoforms to be highly conserved, expressed on the metacyclic surface and susceptible to antibody binding in native conditions, we considered MISP as transmission-blocking vaccine candidates against T. brucei. To explore the experimental immunoprotective properties of MISP, the N-terminal ectodomain of MISP360 (Fig 4A) was recombinantly produced in E. coli, purified by nickel affinity and size exclusion chromatography (Fig 4B–4C), depleted from endotoxins, and used to formulate a vaccine with glucopyranosyl lipid adjuvant aqueous formulation (GLA-AF) as adjuvant. In parallel, we also immunized mice with recombinant BARP (Fig 4D–4F) and dead whole T. b. brucei metacyclic cells. Ten BALB/c mice per group were immunized by subcutaneous injection and received two more boost doses after 10 and 20 days (Fig 4G–4H and S2 File). Ten days after the last booster, each mouse was bitten once by a single tsetse with a confirmed SG infection. Infection was followed up to 31 days post-challenge and parasitemia was regularly measured for each individual (Fig 4G). Animals vaccinated with either MISP or BARP developed an infection and did not show a significant reduction in parasitemia compared with the control groups (PBS and adjuvant only), at any point. Only mice immunized with dead metacyclic cells showed a significant reduction of parasitemia at 7 days post-challenge (Fig 4H), but this was restored to levels comparable to the controls the day after. Despite the immunized animals successfully developing an immune response against either antigen by generating high titers of specific antibodies as shown by immunoblotting (S2 File), vaccination did not prevent the development of a T. b. brucei infection.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Immunoprotective potential of MISP and BARP.

Representation of MISP (A) and BARP (B) recombinant proteins produced for mouse vaccination; sections in gray were not included; signal peptide (SP), C-terminus domain (CTD), GPI anchor peptide (GPI); numbers indicate position from Methionine 1. Size exclusion chromatography chromatograms of recombinant MISP (C) and BARP (D), indicating the purified peaks including the SDS-PAGE of the peak fraction as inset. Western blotting of BSA as control, recombinant MISP and BARP, probed with either anti-MISP polyclonal antibodies (E) or anti-BARP (F). (G) T. brucei parasitaemia development (parasites/mL blood) in mice either vaccinated with PBS only (gray), PBS and adjuvant (dark gray), recombinant MISP and adjuvant (blue), recombinant BARP and adjuvant (yellow) or dead metacyclic cells (purple) from 5 to 32 days post-challenge; dots indicate the mean of each group (n = 10 per group). (H), parasitemia levels from 5 to 8 days post-challenge highlighting the significant (*) reduction of parasitemia at day 7 post-challenge in mice vaccinated with dead metacyclic cells.

https://doi.org/10.1371/journal.ppat.1011269.g004

MISP is not essential for trypanosome colonization of the tsetse salivary glands

To gain more insight into the essentiality of MISP, we created a T. b. brucei transgenic cell line that allows the RNAi knockdown of all misp paralogs at once through a tetracycline-inducible RNAi stem loop system [55] targeting a conserved gene region. Although misp knockdown was successfully induced, both transcript and protein downregulation were only partial and did not lead to any conclusive phenotype either in PCF in vitro or within the tsetse salivary glands (S19 Fig). We then used a CRISPR-Cas9 strategy to knock out (KO) misp by targeting DNA breaks at both 5’ and 3’ sequences conserved in all paralogs, and replacement with drug selection markers (Fig 5A). An addback (AB) rescue cell line was created by inserting a tetracycline-inducible ectopic misp360 gene for overexpression. As expected, due to the native expression pattern of misp, neither PCF cell line presented any growth or morphology phenotype in vitro. We then infected tsetse with either misp KO or AB cell lines and assessed infection rates at 30 dpi. All cell lines (i.e. KO, uninduced (AB-) and induced (AB+) addback) yielded normal midgut and proventricular infection rates, comparable to that of wild type cells. However, salivary gland infection rates of KO and AB- experienced a slight (although not statistically significant) reduction (Fig 5B) despite the observation that morphology and motility were apparently not affected, suggesting that MISP may have a minor but non-essential role in salivary gland infection establishment and/or maintenance. Lastly, misp KO cells re-expressing MISP360 (AB+ cells) failed to restore normal salivary gland infection rates. It remains to be determined whether this is due to the differential expression level compared to the endogenous gene and/or whether more than one isoform is necessary for complementation. Lack of MISP expression in KO cells was confirmed by immunostaining with anti-MISP antibody (Fig 5C), while expression of BARP and CRD remain comparable to the wild type and AB+ cells (S20 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Characterization of MISP null mutants.

(A) PCR genotyping of MISP KO clones (#1 to #6), wild type (WT), and negative template control (NTC) by amplification of MISP C-terminal domains (top gel); amplification of tert as control (bottom gel); relative molecular weight on the right (bp). (B) Infection prevalence (percentage) in tsetse salivary glands infected with either wild type (WT), MISP knock-out clone #3 (KO), MISP KO uninduced addback (AB-), and MISP KO induced addback (AB+); two biological replicates (replicate 1 (light blue circle); replicate 2 (dark blue square)); error bars indicate binomial ±SE of sample proportion (replicate 1(black), replicate 2 (gray)); sample population indicated next to each point. (C) Representative images of wild type (WT), MISP knock out (KO) and induced MISP addback (AB) immunostained with anti-MISP polyclonal antibodies (cyan), DAPI (magenta), merge, and differential interference contrast (DIC); scale bars = 5 μm.

https://doi.org/10.1371/journal.ppat.1011269.g005

Ethics statement

All applicable international, national, and institutional guidelines for the care and use of animals were followed. Specifically, the experimental use of the BALB/c female mice for the immunization and tsetse fly-mediated trypanosome infection was approved by the Institute of Tropical Medicine Antwerp (ITM) Animal Ethics Committee Clearance under licence No. ECD VPU2018-1.

T. b. brucei cell culture

Trypanosoma brucei brucei strain AnTat 1.1 90:13 PCF [55,79] were cultured in SDM-79 medium supplemented with 10% FBS, haemin, 2 mM L-glutamine, Glutamax (Gibco), 15 μg/mL G418 (InvivoGen) and 50 μg/mL hygromycin B (InvivoGen), at 27°C and 5% CO₂. Cells were typically passaged every 2 days. Transgenic AnTat 1.1 90:13 PCF cell lines were cultured in the presence of the selection marker drugs puromycin 1 μg/mL or zeocin 10 μg/mL (InvivoGen). Cells requiring the activation of the transgene were cultured in the presence of fresh 1μg/mL doxycycline (in 70% ethanol) or the same volume of 70% ethanol for negative controls. T. b. brucei AnTat 1.1 90:13 BSF were cultured in HMI-9 medium supplemented with 10% FBS, 10% Serum Plus (Sigma) and GlutaMax (Gibco), 2.5 μg/mL G418 and 4 μg/mL hygromycin B at 37°C and 5% CO₂.

Tsetse fly infection and dissection

G. m. morsitans were obtained from the tsetse insectary at the Liverpool School of Tropical Medicine, where they were maintained at 26°C (+/-1°C) and 68–78% relative humidity. Flies were fed for 12 minutes every second day on sterile, defibrinated horse blood (TCS Biosciences) through a silicone membrane feeding system. Teneral (24h post emergence, unfed) males were infected by combining T. b. brucei TSW196-infected rat blood with fresh, sterile, defibrinated horse blood at a density of 10⁶ cells/mL (for saliva proteomics, S1 Fig). Alternatively, flies were infected by mixing either T. b. brucei AnTat 1.1 90:13 [55] or AnTat 1.1 Cas9 [80] PCF cells with washed, defibrinated horse blood at a density of 5x10⁵ cells/mL. Uninfected control flies were fed on the same blood (free of trypanosomes) for the same amount of time. Any experimental flies that had not fed were removed the following day. Experimental flies were maintained for 4 weeks, feeding on normal defibrinated horse blood every 2 days. Alternatively, flies infected with mutant trypanosomes requiring tetracycline activation of the transgene were fed with normal defibrinated horse blood supplemented with fresh 2 μg/mL doxycycline (in 70% ethanol). Bloodmeals for control flies were supplemented with the same volume of 70% ethanol only. Flies were dissected at 28 to 30 days post infection, 72 hours after receiving the last bloodmeal. For saliva proteomics, based on normal T. b. brucei TSW196 salivary gland infection rates (~15%) and yields (~10⁴ trypanosomes/gland pair), 1,500 naïve and 1,500 T. b. brucei-infected tsetse were dissected (3 biological replicates of ~500 male flies per group). Salivary glands were collected in sterile ice-cold PBS and centrifuged at 12,000 rpm for 5 minutes at 4°C to collect the resultant saliva supernatant. SG and saliva were then separately stored at -80°C until further analyses. Alternatively, the tsetse SG, PV and MG were dissected out (in this order to prevent trypanosome cross-contamination) in sterile ice-cold PBS and T. brucei cells were isolated, washed in PBS by centrifugation at 2,000 rpm for 5 minutes at 4°C and either stored at -80°C or directly used for immunostaining.

High-resolution nLC-MS/MS proteomic analysis

Saliva samples from naïve and T. brucei-infected tsetse were lyophilized and sent to the Dundee University Fingerprints Proteomics Facility for in-solution trypsin digests and identification by mass spectrometry. Briefly, lyophilized saliva samples (10–100 μg each) were redissolved in 200 μL 0.4 M NH₄HCO₃ containing 8 M urea, and disulfide bonds were reduced with 5 mM dithiothreitol for 15 min at 50°C. Cysteine residues were alkylated with freshly prepared 10 mM iodoacetamide for 30 min at room temperature (RT), protected from light. Proteins were digested with 20 μg sequencing-grade trypsin (Sigma-Aldrich) for 24 h at 37°C. The reaction was terminated by adding 10 μL formic acid. The resulting peptides were desalted in a C18-SPE cartridge (1 mL, Discovery DSC-18, Supelco, Sigma-Aldrich), and analyzed by nano-liquid chromatography-high-resolution tandem mass spectrometry (nLC-HR-MS/MS) using an Ultimate 3000 RSLC nano coupled to LTQ-Orbitrap Velos Pro MS (Thermo Fisher Scientific) and filtered with an estimated false-discovery rate (FDR) of 1%. The PD settings were as follows: HCD MS/MS; cysteine carboxyamidomethylation as fixed modification; methionine oxidation and lysine acetylation as variable modifications; fully tryptic peptides only; up to two missed cleavages; parent ion mass tolerance of 10 ppm (monoisotopic); and fragment mass tolerance of 0.6 Da (in SEQUEST) and 0.02 Da (in PD 2.1.1.21) (monoisotopic). Tandem MS/MS spectra were searched against the following databases: a combined protein database of T. b. brucei, T. b. gambiense and T. b. rhodesiense (downloaded in October 2017 from TriTrypDB; http://www.tritrypdb.org/ in FASTA format, release 34, 18,729 entries, and from UniProtKB; http://www.uniprot.org/; release 2017_10, 25,450 entries), and G. m. morsitans (downloaded in May 2017 from VectorBase; https://www.vectorbase.org/; version 1.7, 12,494 entries). Common contaminant sequences (MaxQuant) were included in this combined database. The resulting PD dataset was further processed through Scaffold Q+ 4.8.2 and perSPECtives (Proteome Software, Portland, OR). A protein threshold of 95%, peptide threshold of 95%, and a minimum number of one unique peptide was used for identification of proteins. Manual inspection of the MS/MS spectrum was always performed for identification of any protein based on a single peptide. Using BLAST2GO, proteins were BLAST searched against the non-redundant NCBI protein database and mapped and categorized according to gene ontology terms (GO). Sodalis glossinidius proteins were identified using the Liverpool School of Tropical Medicine in-house MASCOT MS/MS ion search using a protein database from UniProtKB generated from the latest re-annotated coding sequences in S. glossinidius [81], using the following settings: two missed trypsin cleavages, same peptide modifications described above, peptide tolerance of 1.2 Da, MS/MS tolerance of 1.2 Da and peptide charges set to +1, +2 and +3. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (www.ebi.ac.uk/pride/) partner repository with the dataset identifier PXD039684.

Bioinformatic analyses

All trypanosome sequences were obtained from TriTrypDB (www.tritrypdb.org) [82] or UniProt (www.uniprot.org) [83]. G. m. morsitans sequences were obtained from VectorBase (www.vectorbase.org) [84]. Sequence analyses and multiple alignments were done using Clustal Omega [85] and Geneious R9 (Biomatters Ltd). Alignment figures were made in Jalview [86]. Phylogenetic trees were generated using PhyML 3.1 [41] under default conditions with a set bootstrap of 500. Signal peptide, GPI-anchor signal peptide, and transmembrane domain predictions were determined using the servers SignalP 4.1 [87], PredGPI [88] and TMHMM 2.0 [89,90], respectively, under default settings. N-glycosylation predictions were run using the NetNGlyc 1.0 server (http://www.cbs.dtu.dk/services/NetNGlyc). MISP 3D protein modelling was performed using I-TASSER [51–53] with the crystal structure of MISP360 as a structural template and multiple sequence alignments (Clustal Omega) with the query sequences, or with IntFOLD [54]. Structural homology searches were performed using DALI [91] and the conservation models using ConSurf [49,50].

PCR and semi-quantitative RT-PCR

Total RNA from cultured and tsetse-isolated trypanosome samples was extracted using the GeneJet RNA extraction kit (Thermo Scientific) following the manufacturer’s protocol. Extracted RNA was further treated with the TURBO DNAse kit (Ambion) to remove residual genomic DNA following the manufacturer’s instructions. Variable amounts of RNA were reverse-transcribed into cDNA at 52°C for 10 minutes using SuperScript IV (Invitrogen) and oligo-dT₂₀ primer, inactivated at 80°C for 10 minutes and treated with E. coli RNAse H at 37°C for 20 minutes. The resultant RNA-free cDNA was used in a downstream PCR using the Taq 2x Mastermix (New England Biolabs) and the primer pairs (400 nM) 5’-GCCGAAAGGACGGCAGAGACG-3’ and 5’-GTGTATCCTCCTATAGATT CTGCATAGC-3’ for the detection of individual misp homologs (amplicons of 410 bp, 332 bp, 254 bp and 176 bp for misp360, misp380, misp440 and misp400/420, respectively); 5’-GGCTACTTTTGACAGTGTTATG-3’ and 5’-CTTCCTTCGCTTTCGTAACG-3’ to detect all barp homologs (270 bp amplicon). To determine misp knockdown levels in misp^RNAi cells, the primers 5’-GATGCCTCTAAAGCGAGAGAAGG-3’ and 5’-GTACTGGCGGCACTATTGTCCTC-3’ were used (263 bp amplicon). Expression values were normalized against the expression of tert [92,93] using the primers 5’-AACAGTAAGTCCCGTGTGG-3’ and 5’-CAAAGTCGTACTTCAACATCAG-3’ (233 bp amplicon). For all RT-PCR reactions, we ran a non-template control, a control for DNAse treatment, for reverse-transcription and a positive control with 1 ng genomic DNA for standardization. PCR conditions were as follows: 95° for 2 minutes, followed by 30 or 35 cycles of 95°C for 30 seconds, annealing for 30 seconds at variable temperatures, and elongation at 68°C for 30 seconds. A last elongation step at 68° was performed for 2 minutes. The cycle number was set at the exponential phase of the reaction. All RT-PCR products were mixed with sample buffer and run in a 2% agarose gel at 100V for 50 minutes. Gels were stained with SYBR Safe (Invitrogen), imaged using a Bio-Rad Gel Doc EZ system and analyzed using the ImageLab software. Imaging conditions were kept identical for all measurements for comparison.

Generation of anti-MISP and anti-BARP antibodies

Anti-MISP polyclonal antibody was generated by immunization of a single rabbit (Davids Biotechnologie GmbH) with 3 courses of 0.3 mg of recombinant MISP380 (full Hisx6-tagged protein lacking N- and GPI-signal peptides produced in Rosetta 2 (DE3) E. coli and purified by nickel affinity followed by size exclusion chromatography), and further purification of IgG from antiserum (63 days post immunization bleed) by protein A and affinity (MISP) chromatography, and posterior exclusion chromatography using DE3 E. coli lysate). Anti-BARP polyclonal antibody was generated by immunization of a single rabbit (Eurogentec) with BSA conjugated to the epitope peptide sequence CKVQAEEAVELAESK (fully conserved across all BARP isoforms) and further purification of specific antibodies by protein A and affinity chromatography. We tested the specificity of either antibody using western blotting by probing recombinant MISP, BARP and soluble VSG221 (S23 Fig).

Immunofluorescence assay and confocal laser scanning microscopy

Cultured or tsetse-derived T. b. brucei cells were washed in PBS and fixed in fresh 4% paraformaldehyde (PFA) for 30 minutes at RT. Cells were then allowed to settle onto poly-L-lysine coated slides for 20 minutes in a humidity chamber. Alternatively, cells were first air-dried on a poly-L-lysine slide, fixed in 100% methanol for 10 minutes at -20°C and rehydrated in PBS after air-drying. PFA-fixed cells were then either permeabilized or not in 0.1% Triton X-100 for 10 minutes at RT. They were then blocked in vPBS (PBS containing 45.9 mM sucrose and 10 mM glucose) 20% FBS for 1 hour, washed in PBS and incubated for 1 hour at RT with the primary antibody solution; 1:200 (anti-MISP (this study), anti-BARP (this study), anti-HA (ThermoFisher), 1:50 (anti-CRD (Glyko)), 1:100 (anti-PFR (a generous gift from Prof Helen Price, Keele University), 1:800 (anti-EP (Cedar Lane)) dilutions in vPBS 20% FBS. After further washing, they were incubated for 1 hour at RT with the secondary antibody solution (1:500 goat-anti-mouse/rabbit Alexa Fluor 488/555; ThermoFisher). Cells were then incubated with 300 ng/mL 4’,6-diamidino-2-phenylindole (DAPI) for 10 minutes, washed and mounted in Slowfade Diamond mounting oil (Life Technologies). Slides were imaged and analyzed using the confocal laser scanning microscope Zeiss LSM-880 and the Zeiss Zen software. For mean intensity fluorescence measurements, images were taken conserving laser power, pinhole aperture and digital gain settings. Images were further analyzed using Zen and ImageJ.

High-Resolution Scanning Electron Microscopy (HRSEM)

Both T. brucei PCF and MCF cells were fixed in 4% PFA 0.02% glutaraldehyde in 0.1M phosphate buffer (PA) for 30 minutes at RT, washed in PBS and attached to poly-L-lysine coverslips. Cells were blocked in 1% BSA PBS for 30 minutes and incubated with primary anti-MISP antibodies (1:50 in blocking solution) for 1 hour at RT. After washing, cells were incubated with secondary IgG goat anti-rabbit conjugated to 10nm gold nanoparticles (1:50 in blocking solution) for 1 hour at RT. Cells were washed and fixed in 2.5% glutaraldehyde 0.1M PA for 30 minutes at RT, washed in water and dehydrated in 30, 50, 70, 90 and 100% ethanol solutions progressively, for 10 minutes each. Cells were finally dried using a Tousimis automatic critical point dryer and coated in 4nm palladium using an Agar Sputter Coater. Samples were imaged in a merlin VP compact high-resolution scanning electron microscope (Zeiss) equipped with a 3View stage (Ametek) and an OnPoint back-scattered electron detector (Ametek). The samples were imaged under vacuum with Nitrogen gas. The microscope conditions were as follows: aperture 20μm, working distance 5-6mm, Z height 47mm, EHT (accelerating voltage) 10kv, BSD of very high gain, brightness 46.9% and contrast 87.7%.

Generation of ^HA-eGFPMISP360 and misp^RNAi PCF transgenic cell lines

To create a cell line expressing ectopic MISP360 tagged with an HA-epitope and eGFP at N-terminus (^HA-eGFPMISP360), the nucleotide sequence coding for the mature Tb427.07.360 protein lacking the signal peptide (Asp¹⁸ to Phe³⁸²) was obtained by PCR (Q5 high-fidelity, New England Biolabs) from T. b. brucei (strain AnTat 1.1 90:13) genomic DNA using the following primer sequences: 5’-GCGTCTAGAGACTCCATAATTGAGGAAGG-3’ and 5’-GCGAGATCTTTAAAAATGTGCGGCAGC-3’ with XbaI and BglII restriction enzyme targets (underlined), respectively. The Tb927.7.360 signal peptide (Met¹ to Ala¹⁷) coding sequence was separately obtained by annealing the oligonucleotides 5’-CGCAAGCTTATGACTAGCCCGTTTTTTGTGCTTGCTTGCTATACTTACGTATGTCACCGCCAAGCTTCGC-3’ and 5’- GCGAAGCTTGGCGGTGACATACGTAAGTATAGCAAG

CAAGCACAAAAAACGGGCAGTCATAAGCTTGCG-3’ with HindIII at both ends, and the HA epitope coding sequence was obtained by annealing the oligonucleotides 5’-CGCAAGCTTTATCCATATGACGTGCCGGATTATGCGACTAGTCGC-3’ and 5’-GCGACTAGTCGCATAATCCGGCACGTCATATGGATAAAGCTTGCG-3’ with HindIII and SpeI. The pDEX-577 plasmid [94] for the tetracycline-inducible ectopic gene expression under a T7 promoter, was digested with HindIII and SpeI and ligated with HindIII/SpeI-digested HA sequence. The resultant plasmid was digested with HindIII, dephosphorylated with recombinant shrimp alkaline phosphatase and the HindIII-digested signal peptide coding sequence was inserted. The construct was then digested with XbaI and BamHI to ligate the Tb927.7.360 (lacking the signal peptide) coding sequence digested with XbaI and BglII. The resultant construct was linearized using NotI high-fidelity (New England Biolabs) and transfected into T. b. brucei (strain AnTat 1.1 90:13) PCF using an Amaxa 4D nucleofector, program FI-115 in Tb-BSF buffer [95]. Clonal transfectant lines were selected with 10 μg/mL zeocin. To create a cell line for the RNAi knockdown of misp (misp^RNAi), a short unique 494 bp sequence highly conserved in all misp homologs was manually selected and obtained by PCR (Q5 high-fidelity NEB) using the primers 5’-CTACCACTACAGCAATTCGG-3’ and 5’- GCCTCTCGCAATTCGTCTTG-3’ with the restriction target pairs XhoI/BamHI or NdeI/HindIII respectively. By digesting with the corresponding restriction enzymes, the two amplicons were sequentially inserted in sense and antisense directions into the plasmid pALC14 [55] for a tetracycline-inducible transcription of a short hairpin double-stranded RNA. The plasmid was linearized (NotI high-fidelity) and transfected into AnTat 1.1 90:13 PCF as described above, and clonal transfectant cell lines were selected with 1 μg/mL puromycin. Transgene insertions were checked by PCR.

Generation of MISP knockout and addback cell lines using CRISPR/Cas9

All ten misp alleles (5 paralogue genes) were knocked out in two consecutive rounds of CRISPR/Cas9 in AnTat 1.1 Cas9 as previously described [80], using the LeishGEdit toolkit [96], except for transfections being carried out in PCF cells obtained by in vitro differentiation from cultured BSF in DTM medium containing 6mM cis-aconitate at 27°C. Briefly, dsDNA encoding for two different sgRNA targeting universal sequences upstream and downstream the coding sequence of all misp paralogs, were produced by PCR and co-transfected as described above with two donor DNA, consisting of either neomycin or hygromycin resistance genes flanked by homology regions found beyond the CRISPR-targeted sites. The addback cell line was generated by complementing the MISP KO clone 3 cell line with a pDEX377 plasmid containing the misp360 gene for its tetracycline-inducible ectopic expression.

Expression and purification of recombinant MISP360 and BARP for structural analyses

The nucleotide sequence encoding Tb427.07.360 (MISP360) (Gly²⁴ to Ala²³⁴) and BARP ABB49055.1 (Glu²³ to Gly²³⁸) were synthesized by GenScript and codon-optimized for E. coli. The constructs were sub-cloned into a modified pET32a vector (Novagen) containing N-terminal thioredoxin (Trx) and hexa-histidine (His₆) tags separated from the gene of interest by a TEV protease site. Sequencing confirmed that no mutations were introduced. E. coli Rosetta-gami 2 (DE3) cells (Novagen) were transformed with the plasmid and grown in autoinduction medium (Invitrogen) from a 5% inoculum. Following four hours of growth at 37°C and 64 hours at 16°C, cells were harvested, and the pellet re-suspended in 20 mM HEPES pH 8.3, 1 M NaCl, 30 mM imidazole and 5mM β-mercaptoethanol. Cells in suspension were lysed using a French Press, insoluble material was removed by centrifugation, and soluble fraction allowed to batch-bind with Ni-agarose beads at 4°C for 1 hour. Recombinant MISP360 and BARP were eluted with the same buffer as before supplemented with 250 mM imidazole, and fractions were analyzed by SDS-PAGE and pooled based on purity. The Trx-His₆ tag was removed by TEV cleavage overnight at 291 K, and the proteins were further purified by size exclusion chromatography (SEC) (Superdex 16/60 200) in HEPES buffered saline (HBS) with 1mM DTT. Protein concentration was determined by absorbance at 280 nm with calculated extinction coefficients of 10220 M^-1 cm^-1 (MISP360), and 12740 M^-1 cm^-1 (BARP).

Crystallization and data collection of MISP360

Crystals of purified MISP360 were initially identified in the Index screen (Molecular Dimensions) using the sitting drop method at 18°C. The final drops consisted of 0.3 μL of MISP360 at 20 mg ml^-1 with 0.3 μL of reservoir solution and were equilibrated against 60 μL of reservoir solution. Diffraction-quality crystals grew in 48 hours in 25% PEG, 1500. A single crystal was looped, cryopreserved in 12.5% glycerol for 20 seconds, and flash-cooled to 100 K directly in the cryostream. Diffraction data were collected on beamline 9–2 at Stanford Synchrotron Radiation Laboratory (SSRL) at a wavelength of 0.9795 Å.

MISP360 structure data processing, solution, and refinement

Diffraction data to 1.82 Å resolution were processed using Imosflm [97] and Scala [98] in the CCP4 suite of programs [99]. Initial phases were obtained by molecular replacement using PHASER [100] with one copy of GARP [48] (PDB 2Y44; 15% identity over 210 residues). Solvent molecules were selected using COOT [101] and refinement carried out using Phenix Refine [102]. The overall structure of MISP360 was refined to an R_free of 20.43%. Stereo-chemical analysis performed with PROCHECK and SFCHECK in CCP4 [99] showed excellent stereochemistry with more than 99% of the residues in the favored conformations and no residues modelled in disallowed orientations of the Ramachandran plot. Overall, 5% of the reflections were set aside for calculation of R_free. Data collection and refinement statistics are presented in S7 Table. The atomic coordinates and structure factors have been deposited in the Protein Data Bank under the code 5VTL.

In silico homology modelling of BARP

For modelling BARP, the crystal structure of GARP (PDB: 2Y44) and MISP360 were used as the templates, with 24 and 28% identity, respectively. Using Modeller 9v18 [43], 10 models of BARP were generated and the best model was chosen based on the low value of normalised discrete optimized protein energy (DOPE). The assessment of the final model was carried out with Ramachandran statistics [103], QMEAN [104], and ProSA [105].

SDS-PAGE and western blotting

Trypanosome lysates were prepared by pelleting 10⁶ cells and heat-denaturing (98°C for 10 minutes) in Laemmli buffer. Samples were resolved on a 12.5% SDS-PAGE gel using the Bio-Rad mini-Protean system at 50V for 30 minutes followed by 2 hours at 120V. Proteins were transferred from the gel to a polyvinylidene fluoride (PVDF) membrane. After transfer at 90V for 1 hour, membranes were blocked (PBS-Tween 0.5% v/v, 5% w/v skim milk powder) for 1 hour at RT and incubated with primary anti-HA (1:10,000; Thermofisher) or anti-Sodalis Hsp60 mAb 1H1 [106] (mouse anti-symbiont GroEL; 1:10 dilution) overnight at 4°C. The membranes were then washed in PBS-Tween (0.5% v/v) and probed at RT for 1 hour with secondary goat-anti-rabbit or goat-anti-mouse IgG horseradish peroxidase-conjugated antibodies (1:25,000 dilution; Thermofisher). The membranes were washed and probed with Super Signal West Dura substrate (Thermo Scientific) and the signal transferred onto X-ray Amersham Hyperfilm (GE Healthcare). Membranes were lastly stained in 0.2% (w/v) nigrosine in PBS for 15 minutes for loading control. Alternatively, recombinant protein samples (S23 Fig) were denatured in LDS sample buffer with DTT reducing agent for 10 minutes at 70°C, run in precast 4–12% Bolt SDS-PAGE gels (Thermofisher) in MES buffer, dry-transferred onto PVDF membranes, blocked with 1% BSA in TBS, and incubated with primary antibodies for 1 hour at RT (anti-MISP 1:2,000; anti-BARP 1:2,000; anti-VSG 1:5,000). After washing, membranes were incubated with secondary Alexa Fluor Plus 800 anti-rabbit IgG antibodies (1:10,000, Thermofisher) for 1 hour at RT before imaging the membrane using an Oddysey Fc Imager.

MISP and BARP vaccine formulation, mouse immunization and tsetse challenge

For immunization, the N-terminal ectodomain of MISP360 (Asp¹⁸-Glu²³⁷) was recombinantly expressed in E. coli Rosetta 2 (BL21) cells (Merk), fused to a 6xHis-tag at C-terminus. The recombinant BARP used in immunization was identical to that used for crystallization (see above). Recombinant proteins were purified through a Ni-NTA column and SEC-FPLC and depleted from endotoxins using the Pierce high-capacity endotoxin removal resin (Thermo Scientific). Endotoxin levels were then determined using the Pierce Chromogenic endotoxin quant kit (Thermo Scientific). Vaccines were formulated in liposomal-monophosphoryl-Lipid A (L-MPLA) as previously described [107,108]. Briefly, 1,2-dimyristoyl-sn-glycero-3-phosphocholine, cholesterol, and 1,2-dimyristoyl-sn-glycero-3-phospho-rac-(1-glycerol) (Avanti Polar Lipids, Alabaster, AL) were dissolved in freshly distilled chloroform stabilized with 0.75% ethanol (9:7.5:1 molar ratio) along with MPLA (Sigma-Aldrich, St. Louis, MO) for a final concentration of 100 μg/mL. Liposomes were dried under nitrogen stream and placed overnight in a desiccator containing silica-gel desiccant beads to obtain a white pellet (Thermo Fisher Scientific), and then vortexed to resuspend at 10 μg/100 μL Lipid A per dose using sterile PBS (pH 7.4) containing either 5 μg of rMISP360, 5 μg of rBARP, 10⁵ whole frozen metacyclics T. b. brucei Antat 1.1 in PBS, or PBS alone until completely dissolved. Vaccines were filtered (0.2-μm) before immunization and administered to groups of ten BALB/c 6–8 weeks old female mice three times at days 0, 10 and 21 by sub-cutaneous injection at the base of the tail. Pre-immune sera were collected for each individual 5 days before the first vaccine was delivered. Mice were then anaesthetized with ketamine (100mg/kg) and xylazine (20mg/kg) and challenged 12 days after the last booster (day 33) with the bite of tsetse flies pre-selected for positive T. b. brucei AnTat 1.1 salivary gland infections, by allowing individual tsetse to bite on the mouse ear dermis. Parasitaemia development was monitored by microscopic analysis using Uriglass disposable slides (Menarini Diagnostics) from day 4 post-challenge onwards. The tsetse flies used for this challenge were infected by providing a first blood meal after emergence (<48 hours) containing 10⁶/mL T. b. brucei AnTat 1.1 pleiomorphic bloodstream forms in defibrinated horse blood supplemented with 10 mM reduced L-glutathione to increase trypanosome infection establishment. Flies were then maintained by feeding every 2–3 days on uninfected defibrinated horse blood. Salivary gland infected flies were pre-selected by induced probing on pre-warmed glass slides that were microscopically examined for the presence of metacyclic trypanosomes. To confirm the efficacy of vaccines in raising a specific IgG response against the antigens, we performed western blotting on recombinant MISP, BARP and metacyclic cell lysates probing with mouse antisera collected at day 30 post-vaccination (3 days pre-challenge). Briefly, samples were denatured in sample buffer and run in 10% SDS-PAGE gels, transferred onto nitrocellulose membranes, blocking in TBS-T 5% skim milk blocking buffer and probed with mouse anti-serum (1:200 dilution in blocking buffer) during 1 hour at RT. Membranes were then probed with anti-mouse IgG conjugated with HRP (1:20,000 dilution in blocking buffer) at 1 hour at RT, and antibodies detected using TMB-membrane peroxidase substrate (Seracare).