https://orcid.org/0000-0002-3755-1637
Figures
Abstract
Aeromonas hydrophila is one of the major pathogenic bacteria responsible for causing severe outbreaks at fish farms and is also a major global public health concern. This bacterium harbors many virulence genes. The current study was designed to evaluate the antidrug and virulence potential of A. hydrophila by amplifying its antimicrobial resistance and virulence genes using PCR and examining their effects on fish tissues and organs. A total of 960 fish samples of Channa marulius and Sperata sarwari were collected from four sites of the rivers of the Punjab, Pakistan. A. hydrophila isolates were subjected to biochemical identification and detection of virulence and antimicrobial resistance (AMR) genes by PCR. We retrieved 181 (6.46%) A. hydrophila isolates from C. marulius and 177 (6.25%) isolates from S. sarwari. Amplification through PCR revealed the incidence of virulence genes in 95.7% of isolates in C. marulius and 94.4% in S. sarwari. Similarly, amplification through PCR also revealed occurrence of AMR genes in 87.1% of isolates in C. marulius and 83.9% in S. sarwari. Histopathological examination revealed congestion (5.2%) and hepatocyte necrosis (4.6%) in liver, lamellar fusion (3.3%) and the presence of bacterial colonies (3.7%) in gills, fin erosion (6%), and the presence of biofilms (3.5%) in tail fins of infected fish. Phylogenetic tree analysis of 16S rRNA and gyrB gene of A. hydrophila revealed 100% and 97% similarity, respectively, with 16S rRNA gene and gyrB of A. hydrophila isolated in previous studies. The results of antimicrobial susceptibility testing showed that all isolates demonstrated resistance to sulfamethoxazole, ampicillin, neomycin, and norfloxacin, while susceptibility to gentamicin, chloramphenicol, and tetracycline, and intermediate resistance was observed against cefotaxime. The results concluded that examined fish samples were markedly contaminated with virulent and multidrug strains of A. hydrophila which may be of a potential health risk. The study emphasizes the responsible antimicrobial use in aquaculture and the urgent need for effective strategies to control the spread of virulence and antimicrobial resistance genes in A. hydrophila.
Citation: Mahmood S, Rasool F, Hafeez-ur-Rehman M, Anjum KM (2024) Molecular characterization of Aeromonas hydrophila detected in Channa marulius and Sperata sarwari sampled from rivers of Punjab in Pakistan. PLoS ONE 19(3): e0297979. https://doi.org/10.1371/journal.pone.0297979
Editor: RAJA AADIL HUSSAIN BHAT, ICAR - Directorate of Coldwater Fisheries Research, INDIA
Received: October 11, 2023; Accepted: January 15, 2024; Published: March 29, 2024
Copyright: © 2024 Mahmood et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are included in the article and its Supporting Information files. The minimal dataset is available in the Figshare repository (DOI: https://doi.org/10.6084/m9.figshare.25329460.v3).
Funding: The author(s) received no specific funding for this work.
Competing interests: The authors have declared that no competing interests
Introduction
The fast-growing aquaculture industry plays a vital role in global food security, offering high-quality protein, economic benefits, and jobs opportunities [1,2]. It also provides essential nutrients and a variety of food products [3,4]. In 2020, aquaculture contributed 122.6 million metric tons of aquatic products valued at USD 281.5 billion, with an annual growth rate of 6.7%. The current worldwide per capita fish consumption is 20.5 kg. Fish, in particular, is a cost-effective protein source, ranking second globally and accounting for 60% of protein intake [5]. It plays a crucial role in ensuring food security for the growing global population [6]. To meet demand, there has been a substantial increase in freshwater and marine fish production [7]. However, this expansion has intensified aquaculture systems, leading to water resource challenges and increased bacterial infections among cultivated aquatic organisms [8]. Despite these challenges, aquaculture remains a sustainable solution for global food security, helping mitigate food shortages driven by population growth [9].
Freshwater fish farming has been vital to the aquaculture industry’s growth, especially in Asia, providing food security, jobs, and economic benefits [10]. Various freshwater fish species like Labeo rohita, Cirrhinus mrigala, Cyprinus carpio, Channa marulius, Sperata sarwari, Catla catla, and Pangasianodon hypophthalmus have contributed to significant global commercial production [11]. These fish are prime candidates for aquaculture and have been widely cultivated [12,13]. However, it’s important to note that freshwater bodies, their primary habitat, also host the zoonotic pathogen Aeromonas hydrophila, which can infect fish, bivalves, amphibians, reptiles, and humans [14–16]. Two successful candidates in freshwater aquaculture are Sperata sarwari and Channa marulius, cultivated commercially in various regions, including Pakistan, India, Bangladesh, China, and Indonesia, where they are top producers [17].
Channa marulius, commonly known as the "Sole," thrives in diverse aquatic habitats like marshes, ponds, rivers, and rice fields, found in countries like China, India, Pakistan, Cambodia, and Thailand [18]. Belonging to the Channidae family, C. marulius is well-suited for intensive rearing systems due to its survival rate and rapid growth [19]. In Pakistan, it’s been introduced for commercial farming, standing out for its potential size of up to 30 kg [20,21]. In the Indus River, Sperata sarwari dominates the Bagridae catfishes, prized for its large size, valuable flesh, and low intramuscular bones [22]. Advances in aquaculture have enabled captive breeding for S. sarwari [23]. While most production relies on capturing, young S. sarwari occasionally enters the ornamental fish trade, easily distinguishable from other Bagridae catfish [24].
Aeromonas hydrophila is an emerging Gram-negative pathogen found in nature, belonging to the Aeromonadaceae family [25,26]. It is prevalent in aquatic environments, food sources, and mineral water bottles. This bacterium poses threats to both aquatic organisms, mainly fish, causing conditions like motile Aeromonas septicemia (MAS), ulcerative disease, and hemorrhagic septicemia [27], as well as humans, leading to wound infections, septicemia, and gastroenteritis. Factors contributing to its virulence include host susceptibility, environmental stressors, and virulence genes [28,29]. A. hydrophila is also a significant public health concern due to its potential for transferring virulence genes to humans. It can be found in various sources such as food, groundwater, wastewater, aquatic, and terrestrial animals [30,31]. Identification of A. hydrophila involves phenotypic methods and characterizing its 16S rRNA gene and virulence genes [32,33]. Typically, its identification relies on the presence of virulence genes like the aerolysin gene (aer), enterotoxin gene (ast), hemolysin A gene (hylA), and cytotoxic enterotoxin gene (act) [33]. These virulence factors cause histopathological effects in fish [34]. The potential pathogens are associated with serious zoonotic infections [35].
The close interaction between naturally resistant bacteria in terrestrial and aquatic environments facilitates the rapid transfer of antimicrobial resistance (AMR) genes to pathogenic fish bacteria [36,37], making fish a vehicle for AMR bacteria and genes dissemination [38]. This results from fish farmers frequently using multiple antimicrobials to combat AMR bacteria [39], which, unfortunately, leads to an increase in antimicrobial-resistant (AMR) bacteria and their genes in aquaculture [40,41]. Addressing antimicrobial resistance within the One Health framework is crucial due to its interconnected impact on human, animal, and environmental health, requiring collaborative efforts for comprehensive solutions [42]. The emergence of AMR bacteria poses a significant challenge to public health [43,44], as they employ genetic strategies to resist antimicrobials [45]. Meanwhile, pathogenic bacterial diseases are a major cause of mass fish mortality in both cultured and farmed species [46], driven by virulence genes controlling factors like enzyme production [47], biofilm formation [48], immune system suppression, bloodstream infections [49], host-pathogen interactions [50], adaptation to various conditions [51], specificity to hosts [52], and epithelial cell lesions [53]. These factors directly impact nutrition, oxygen levels [54], growth phases [55], temperature [56], and pH in fish environments [57]. Regular monitoring and investigation of physicochemical parameters play a crucial role in controlling the prevalence of pathogenic bacteria [34,58].
The current study was designed to evaluate the antidrug and virulence potential of A. hydrophila by amplifying its antimicrobial resistance and virulence genes using PCR and examining their effects on fish tissues and organs.
Materials and methods
Ethical approval and, fish sampling
All protocols and procedures were approved by the Guidelines for the Care and Use of Laboratory Animals Committee of the University of Veterinary and Animal Sciences, Lahore, Pakistan (DAS/358, 02-03-2023). A total of 960 fish samples (480 from each of C. marulius and S. sarwari) were collected using a nylon drag net from four selected sites: Head Baloki (BL-H), Head Taunsa (TA-H), Head Chashma (CH-H), and Head Trimmu (TR-H) of the riverine system of Punjab, Pakistan. Sampling was conducted from April 2022 to December 2022, categorized seasonally as 280 in summer, 120 in autumn, and 80 in winter. 120 fish samples of each species were collected from each sampling site. Soon after netting, the fish samples were measured for weight and length parameters outdoors. Water temperature of BL-H was measured as 25.42°C, 26.62°C at TR-H, 24.79°C at TA-H, and 22.98°C at CH-H. The sampling sites for the current study are depicted in Fig 1. The fish samples were placed in plastic containers with ice packs and transported directly (within 24 hours) to the laboratory of the Department of Zoology, University of Education, Faisalabad Campus, Pakistan.
Isolation, phenotypic, morphological, and biochemical characterization of Aeromonas hydrophila
The collected fish was disinfected by rinsing with clean water and sodium hypochlorite following regulations and guidelines a recommended by Noga, [59]. The internal organs (skin, stomach, kidney, liver, intestine, spleen, and gills) of the collected fish were subjected to bacteriological examination. Swabs were randomly collected from suspected organs and were inoculated onto Trypticase soy agar (TSA LAB, UK) media by plate streaking method and were incubated at 37°C overnight according to the method described by Lima, and Muratori, [60,61]. A single colony from freshly obtained bacterial culture was inoculated onto Trypticase soy agar (TSA LAB, UK) media plates to obtain a pure culture of A. hydrophila, which was then incubated at 37°C for 24 h following the method recommended by Muratori, [61]. Pure culture of A. hydrophila was subjected to Gram-staining and viewed microscopically (Euromex, 100X). Colony morphology, culture, and microscopic characteristics of A. hydrophila were observed according to the protocol recommended by Muratori, and Xiao, [61,62]. The isolates of A. hydrophila were characterized by biochemical tests like indole, motility, oxidase, H2S production, catalase, and urease tests as for identification as previously performed by Fang, [63].
DNA extraction
DNA was isolated using a Genomic DNA Purification Kit (Thermo Scientific, GeneJET, USA) and DNA samples were evaluated by gel electrophoresis on 1% agarose gel stained with ethidium bromide (Sigma-Aldrich E7637, USA) and utilizing a standard-sized molecular marker [1Kb DNA Ladder RTU (Ready-to-Use) GeneDireX, Taiwan]. Isolated DNA was stored at -20°C for further use.
Amplification, sequencing, and phylogenetic tree analysis of 16S rRNA and gyrB gene of A. hydrophila
One microliter of template DNA was added into a total of 25 μl reaction solution for PCR containing two primers of 16S rRNA; 1 μl forward primer (27F): AGAGTTTGATCCTGGCTCAG, 1 μl reverse primer (1492R): GGTTACCTTGTTACGACTT, 10 μl PCR-grade water, and 12 μl GoTaq Green Master Mix (Promega, USA) (Table 1). Similarly, gyrB gene was also amplified by species-specific primers. PCR products were electrophoresed in 1% agarose gel stained with ethidium bromide (Sigma-Aldrich E7637, USA) and utilizing a standard-sized molecular marker (1Kb DNA Ladder RTU, GeneDireX). PCR products revealing the thickest bands were sequenced by Sanger’s method at BGI Hong Kong Co. Ltd. China. The obtained sequences were analyzed and compared for taxonomic identification using National Centre for Biotechnology Information-Basic Local Alignment Search Tool (NCBI-BLAST), and subsequently, submitted to the GenBank® database. To determine the phylogenetic relationship of A. hydrophila, a phylogenetic tree analysis was conducted on the 16S rRNA and gyrB genes of A. hydrophila. This analysis employed the bootstrap method with 1,000 bootstrap replications, and it was carried out using MEGA 11.0 (Molecular Evolutionary Genetic Analysis), as described by Chen, [64].
Molecular identification of virulence and antimicrobial resistance (AMR) genes of A. hydrophila
Virulence genes of A. hydrophila (including hemolysin (hylA), aerolysin (aerA), and cytotoxic enterotoxin (act)) and antimicrobial resistance genes (such as sul1, sul3, qnrA, qnrB, blaTEM, and tetA) of A. hydrophila were identified through PCR analysis using species-specific primers (Macrogen, Korea) and were compared with a standard-sized molecular marker DNA ladder (Table 1). A total of 25 μl of PCR reaction solution, comprising 1 μl of template DNA, 1 μl forward primer, 1 μl reverse primer, 10 μl PCR-grade water, and 12 μl GoTaq Green Master Mix (Promega, USA), was utilized for the detection of the AMR genes in A. hydrophila (Table 1). Amplified PCR products were analyzed on 1% agarose gel stained with ethidium bromide (Sigma-Aldrich E7637, USA) and utilizing a standard-sized molecular marker (1Kb DNA Ladder RTU, GeneDireX). PCR products revealing the thickest bands were sequenced by Sanger’s method at BGI Hong Kong Co. Ltd., China as previously analyzed by Wang, [73].
Minimal inhibitory concentration (MIC) and antimicrobial susceptibility testing of A. hydrophila
A. hydrophila isolates were subjected to microtiter plates and Kirby Bauer disc diffusion method for antimicrobial sensitivity testing on Mueller-Hinton agar plates according to the method carried out by Bauer, [74] using antimicrobials norfloxacin, streptomycin, gentamicin, chloramphenicol, ciprofloxacin, doxycycline, ampicillin, flumequine, neomycin, tetracycline, sulfamethoxazole, and cefotaxime. The plates were incubated for twenty-four hours at 37°C. Diameter of the inhibition zone were measured and interpreted to classify bacteria as resistant, moderately susceptible, and susceptible according to clinical and laboratory standards institute (CLSI), [75].
Histopathological effect of A. hydrophila
Tissue samples were collected from the liver, stomach, spleen, and small intestine of infected C. marulius and S. sarwari. These collected tissue specimens were disinfected and preserved in a 10% neutral buffered formalin solution with a 1:10 ratio (formalin and distilled water, respectively) in plastic sample containers, labeled against each respective tissue specimen. The preserved tissue samples were submitted to the laboratory of the Department of Pathology, City Campus, University of Veterinary and Animal Sciences (UVAS) Lahore, and examined for histopathological changes due to A. hydrophila infection, specifically motile Aeromonas septicemia (MAS). The obtained slides were viewed under a light microscope (Euromex 100X, Netherlands) to observe histopathological changes caused by A. hydrophila and stored for future use.
Results
Physicochemical parameters, analysis of weight and length of C. marulius and S. sarwari
Maximum and minimum temperature was recorded as 26.62°C (TR-H) and 22.98°C (CH-H) respectively. Maximum and minimum pH was recorded as 8.23 (CH-H) and 7.18 (TR-H) respectively. Samples of S. sarwari collected from CH-H showed maximum weight (307 g) and minimum by fish collected from TR-H (303.8 g) while maximum length (27.4 cm) was shown by samples of S. sarwari collected from TR-H and minimum length (25.6 cm) by fish collected from BL-H. Similarly, samples of C. marulius collected from CH-H showed maximum weight (175 g) and minimum by fish collected from BL-H (151.2 g) while maximum length (34.2 cm) was shown by samples of C. marulius collected from CH-H and minimum length (27.4 cm) by fish collected from BL-H. Results of physicochemical parameters, weight and length of C. marulius and S. sarwari are shown in S1 Table.
Isolation, phenotypic and biochemical characterization
We collected swabs from the organs of 480 fish samples of each of S. sarwari and C. marulius. We isolated A. hydrophila by direct plating on TSA plates. We recovered A. hydrophila in 31 fish samples of C. marulius and 30 of S. sarwari collected from all sampling sites. Phenotypic characterization of A. hydrophila showed rod-shaped, round, smooth, and grayish-white colored colonies on TSA media plates. Biochemical characterization of A. hydrophila isolates revealed it as motile, Gram-negative, rod-shaped, and facultatively anaerobic bacterium bearing Peritrichous flagella, by biochemical tests. All the isolates of A. hydrophila were found positive against catalase, oxidase, glucose, sucrose, lactose, urease, indole, and H2S production tests represented in S2 Table.
Prevalence of A. hydrophila
Overall prevalence of A. hydrophila was recorded as 6.35% in fish samples of both fish species. The maximum prevalence of A. hydrophila, 6.46% was observed in the intestine of infected C. marulius while, the minimum prevalence, 4.17% was noted in gills of infected S. sarwari (Table 2). Overall A. hydrophila infected 15 fish samples (12.5%) of S. sarwari collected from BL-H while, the minimum infection rate, 1.67% was observed in C. marulius collected from CH-H. Among the fish, A. hydrophila infected 9.78% of males in C. marulius and 4.7% of females in S. sarwari. Furthermore, A. hydrophila infected 6.43% and 5.71% of fish samples of S. sarwari and C. marulius respectively during the summer while 5% and 6.25% of S. sarwari and C. marulius respectively during the winter Table 3.
Occurrence of virulence and antimicrobial resistance genes of A. hydrophila
Virulence genes (aerA, hylA, and act) and antimicrobial resistance genes (sul1, sul3, qnrA, qnrB, tetA, and blaTEM) of A. hydrophila were amplified by PCR. Among all the AMR genes, maximum occurrence, 6.04% of tetA gene was recorded in A. hydrophila isolates isolated from C. marulius (Table 4). Similarly, among all the virulence genes, maximum occurrence, 6.46% of aerA gene was recorded in A. hydrophila isolates isolated from C. marulius. The chi-square test of independence showed insignificant difference (P>0.05) in occurrence of antimicrobial resistance (AMR) genes Table 5.
Multiple-drug resistance (MDR) and antimicrobial susceptibility testing
Antimicrobial susceptibility testing was performed on a total of 30 S. sarwari and 31 C. marulius isolates of A. hydrophila. All the isolates of A. hydrophila demonstrated resistance to amoxicillin, ampicillin, sulfamethoxazole, erythromycin, flumequine, ciprofloxacin, neomycin, and norfloxacin. In contrast, A. hydrophila isolates demonstrated susceptible to gentamicin, doxycycline, chloramphenicol, and tetracycline, with intermediate resistance observed against cefotaxime and streptomycin shown in Tables 6–8.
Phylogenetic tree analysis
Phylogenetic tree of 16S rRNA gene A. hydrophila revealed 100% similarity among all the A. hydrophila strains isolated in the current study, as well as with strains isolated in earlier studies (Fig 2). Furthermore, phylogenetic tree analysis of gyrB gene of A. hydrophila revealed 97% similarity among all the A. hydrophila strains isolated in the current study, as well as with strains previously isolated (Fig 3).
Histopathological effect of A. hydrophila
Histopathological examination revealed various abnormalities in the infected fish. In the liver, findings included congestion (5.2%), hepatocyte necrosis (4.6%), granuloma formation (4.3%), and inflammation (5%). The gills exhibited epithelial hyperplasia (3.5%), lamellar fusion (3.3%), edema (3%), and the presence of A. hydrophila colonies (3.7%). Tail fins displayed issues such as fin erosion (6%), hemorrhage (6.2%), loss of fin rays (4.8%), and the presence of biofilms (3.5%). A. hydrophila infection also led to fibrosis (4%), abscess formation (3.7%), fatty degeneration (3.5%), and the infiltration of inflammatory cells (4.7%) in spleen (Fig 4).
Discussion
Fish is one of the most important sources of food that provides easy digestion, high palatability, and high nutritional value. However, it is also considered an important vehicle for many types of pathogens, raising public health concerns. The prevalence of A. hydrophila is directly proportional to an increase in temperature, but there is no association between its prevalence and the weight and length of the fish. In the current study, overall 61 A. hydrophila (6.3%) were recovered in both fish species, C. marulius and S. sarwari. The intestine and stomach were reported as the organs with a high prevalence of A. hydrophila, as 31 isolates of intestine (6.5%) from C. marulius and 30 isolates of stomach (6.2%) from S. sarwari showed the maximum prevalence. An increase in temperature during the summer also favors a higher prevalence, as 34 isolates were recorded during this season (3.5%). A. hydrophila affects males more than females, as the maximum prevalence was recorded in 40 (4.2%) male fish samples from both species. Additionally, the highest prevalence was found in 28 fish samples (2.9%) at Head Baloki (BL-H) in Kasur.
Phenotypic characterization in the current study confirmed A. hydrophila isolates as circular, smooth, Gram-negative, rod-shaped, motile, and facultatively anaerobic bacteria bearing peritrichous flagella. Biochemical tests showed that all A. hydrophila isolates were positive for catalase, oxidase, glucose, sucrose, lactose, urease, indole, and H2S production tests. In a previous study, Wamala, [76] identified A. hydrophila isolates as Gram-negative, motile, and positive in catalase, oxidase, and indole production tests in Uganda. However, they observed negative results in urease and H2S production tests, which contradicted our findings. Li, [77] in a study conducted in China, observed positive results in glucose and H2S production tests but negative results in the urease test, again differing from our findings.
In the current study, we detected three virulence genes, namely aerolysin (aerA), hemolysin (hylA), and cytotoxic enterotoxin (act) genes, in A. hydrophila isolates recovered from a total of 31 samples (6.25%) of C. marulius and 30 samples (6.46%) of S. sarwari. Specifically, we observed aerA gene in 31 isolates (6.45%), hylA gene in 30 isolates (6.25%), and act gene in 28 isolates (5.83%) of infected C. marulius. Similarly, we recorded aerA gene in 30 isolates (6.25%), hylA gene in 28 isolates (5.8%), and act gene in 27 isolates (5.6%) of infected S. sarwari. In a recent study, Morshdy, [78] recovered A. hydrophila in 20% of catfish samples in Egypt. They also detected aerolysin and hemolysin genes in 25% and 75% of retail fish samples, respectively. The main reason behind the high prevalence of A. hydrophila was contamination caused by marketing and transportation. Similarly, El-Hossary, [79] detected aerolysin (aerA) and hemolysin (hylA) genes in A. hydrophila isolated from infected Nile tilapia (Oreochromis niloticus) collected from local fish markets in Egypt. They found A. hydrophila in 28.8% of market fish samples. The variations in the prevalence of A. hydrophila could be attributed to various factors, including sampling conditions (such as location and time), post-capture contamination, fish species, handling, water type, geographic location, manipulations during capture, storage, marketing, and transportation. Moreover, Thaotumpitak, [80] recovered 15 isolates (5.39%) of A. hydrophila in hybrid tilapia collected from cage culture in Thailand. They also detected aerolysin (aerA) and hemolysin (hylA) genes in A. hydrophila in infected hybrid tilapia. Additionally, Suresh and Pillai, [29] recovered A. hydrophila from 27% of samples of Indian major carps (Cirrhinus mrigala, Labeo rohita, and Catla catla) in India. They identified ten virulence genes, including aerolysin (aerA), hemolysin (hylA), and cytotoxic enterotoxin (act) genes, in the infected fish. The variation in the prevalence of A. hydrophila could be attributed to stress, which allows the opportunistic pathogen A. hydrophila to cause infections.
As an opportunistic pathogen, A. hydrophila infects fish under conditions of stress, high temperature, low water quality, high organic content, and stocking density. In a recent study, Abdella, [28] detected 312 virulence genes in A. hydrophila strains, including aerA, hylA, and act genes in Egypt. In another study, by Nhinh, [81] 46.4% of A. hydrophila isolates were recovered from 506 diseased (moribund) tilapia, carps (common carp and grass carp), and channel catfish of Vietnam. They also detected the aerA gene in 80.1% of cases and the act gene in 80.5% of cases. Similarly, Saleh, [82] recovered 53.4% (187/350) of A. hydrophila isolates from infected Nile tilapia in Egypt. They detected the act and aerA genes in virulent A. hydrophila strains. In a similar study, Ahmed, [83] found A. hydrophila in 34 isolates (7.1%) isolated from Nile tilapia (O. niloticus) and Mugil cephalus in Egypt. They also identified four virulence genes, including hly, aer, and act genes, in infected fish samples. Additionally, Azzam-Sayuti, [84] recovered 20% of A. hydrophila isolated from 270 healthy cultured Clarias batrachus, P. hypophthalmus, and O. niloticus in Malaysia. They detected eight virulence genes, including aerA, hylA, and act genes. Moreover, Abu-Elala, [85] recovered 20 out of 24 (83.3%) A. hydrophila isolates from infected fish in Egypt. They detected 45.45% of virulence genes in A. hydrophila isolates, including the aer and act genes. Similarly, Roges, [86] reported a 92.7% occurrence of virulence genes in 110 A. hydrophila isolates isolated from fish, animals, and humans, including the act, aer, and hyl genes in Brazil. The major reasons behind these significant variations in results may include contaminated water, severe environmental conditions, bacterial strains, and low water quality parameters.
A. hydrophila is a multiple antimicrobial-resistant bacterium and one of the most significant pathogens in fish, causing Aeromonas septicemia (MAS) in various freshwater fish species. Its antimicrobial resistance against multiple drugs has made it a global health risk. In the current study, we identified the presence of blaTEM, sul1, sul3, qnrA, qnrB, and tetA genes in A. hydrophila isolated from both C. marulius and S. sarwari. Specifically, we recorded a 6.46% prevalence of the tetA gene, 6.25% for blaTEM, 5.83% for sul1, 5.42% for sul3, 5% for qnrA, and 4.17% for qnrB gene in 31, 30, 28, 26, 24, and 20 samples of infected C. marulius, respectively. Similarly, in S. sarwari, we recorded a 6.25% prevalence of the tetA gene, 6.04% for blaTEM, 5.21% for sul1, 4.79% for sul3, 4.58% for qnrA, and 4.37% for qnrB gene in 30, 29, 25, 23, 22, and 21 samples of infected fish, respectively.
We observed that all A. hydrophila isolates were resistant to amoxicillin, ampicillin, sulfamethoxazole, neomycin, and norfloxacin, while they were susceptible to gentamicin, chloramphenicol, and tetracycline. Additionally, they showed intermediate resistance to cefotaxime. In a recent study, Eid, [87] reported a 53.85% prevalence of A. hydrophila collected from Mediterranean seawater in Egypt. They identified sul1, blaTEM, and tetA genes in A. hydrophila isolated from M. cephalus (striped mullet) in Egypt and also detected the act gene in antimicrobial-resistant A. hydrophila. These isolates were resistant to β-lactams and sulfonamides (100%), oxytetracycline (90%), and streptomycin (62.22%), but completely susceptible to cefotaxime. In a recent study, Thaotumpitak, [80] identified six antimicrobial resistance genes in A. hydrophila isolated from hybrid red tilapia cultured in cages in Thailand, including blaTEM, sul1, sul3, qnrA, qnrB, and tetA. All A. hydrophila isolates were resistant to ampicillin, oxytetracycline, tetracycline, trimethoprim, and oxolinic acid. Similarly, Fauzi, [88] reported the presence of drug resistance genes in A. hydrophila isolated from freshwater fish in Malaysia. They identified sul1, blaTEM, and tetA genes in A. hydrophila. These isolates were resistant to ampicillin, kanamycin, nalidixic acid, neomycin, oxytetracycline, streptomycin, tetracycline, and sulfamethoxazole. Additionally, they showed intermediate resistance to gentamicin, ciprofloxacin, norfloxacin, and doxycycline, while they were susceptible to chloramphenicol and nitrofurantoin.
Regular exposure to antimicrobials facilitates the spread of slowly curable infections caused by A. hydrophila. In a previous study, Elkenany, [89] recovered 14.3% of A. hydrophila isolated from aquatic seafood organisms such as shrimp, crab, squid, and octopus in Egypt. They detected the aer and hylA genes in A. hydrophila. Additionally, they observed that A. hydrophila was resistant to amoxicillin, ceftriaxone, chloramphenicol, trimethoprim-sulfamethoxazole, and tetracycline. In a recent study, Lee, [90] detected antimicrobial resistance (AMR) genes such as sul1, in A. hydrophila in Norway. They also found A. hydrophila isolates resistant to erythromycin and florfenicol, with reduced susceptibility to oxolinic acid. Another study by Gharieb, [91] reported an overall 40.67% prevalence of A. hydrophila from Tilapia nilotica and M. cephalus in Egypt. They observed that A. hydrophila was resistant to carbenicillin and ampicillin, but susceptible to chloramphenicol, amikacin, ciprofloxacin, cefoxitin, cefotaxime, trimethoprim/sulfamethoxazole, and tetracycline. Moreover, Roges, [86] observed that A. hydrophila was highly resistant to cefoxitin, nalidixic acid, and tetracycline, with intermediate resistance to cefotaxime, imipenem, and ceftazidime. However, it was least resistant to amikacin, gentamicin, sulfamethoxazole-trimethoprim, ciprofloxacin, and nitrofurantoin. Similarly, Saleh, [82] observed that A. hydrophila was resistant to chloramphenicol, amikacin, and gentamicin, while highly susceptible to meropenem, ciprofloxacin, amoxicillin-clavulanic acid, and trimethoprim-sulfamethoxazole.
Virulence genes of pathogenic A. hydrophila cause serious histopathological effects in infected fish. In the current study, congestion (5.2%), hepatocyte necrosis (4.6%), granuloma formation (4.3%), and inflammation (5%) were observed in liver of infected fish. Epithelial hyperplasia (3.5%), lamellar fusion (3.3%), edema (3%), and the presence of A. hydrophila colonies (3.7%) in the gills. Fin erosion (6%), hemorrhage (6.2%), loss of fin rays (4.8%), and the presence of biofilms (3.5%) were observed in tail fins. Fibrosis (4%), abscess formation (3.7%), fatty degeneration (3.5%), and the infiltration of inflammatory cells (4.7%) were observed in spleen of infected fish. Histopathological effects of A. hydrophila infection were not studied in any previous study.
In the current study, we observed 100% and 97% similarity in the phylogenetic relationships of the 16S rRNA and gyrB genes of A. hydrophila, respectively, among all the A. hydrophila strains isolated in this study, as well as with strains isolated in earlier studies. In a previous study, Wamala, [76] also analyzed the phylogenetic relationships through tree analysis of the 16S rRNA and gyrB genes, revealing 100% and 99% similarity, respectively. Similarly, Esteve, [92] compared the phylogenetic relationships in Spain using the phylogenetic tree of the 16S rRNA and gyrB genes of A. hydrophila, showing 100% similarity, consistent with our findings. Likewise, Li, [77] found 100% similarity in the phylogenetic relationships of the 16S rRNA gene of A. hydrophila in China. In a recent study, Sani, [93] also observed 100% similarity in the phylogenetic relationships of the 16S rRNA gene of A. hydrophila in Malaysia, which corroborated our results.
Conclusion
Our examination of fish samples unveiled a concerning level of contamination with virulent and multidrug-resistant strains of A. hydrophila, highlighting the potential health risks associated with this contamination. The presence of pathogenic A. hydrophila results in significant histological changes in infected fish. The study underscores the importance of responsible antimicrobial use in aquaculture and the pressing need for effective strategies to curb the spread of virulence and antimicrobial resistance genes in A. hydrophila. Further research is imperative to delve into the mechanisms of virulence and resistance of A. hydrophila in fish.
Supporting information
S1 Table. Mean ± S.E of physico-chemical parameters of indus riverine system in Punjab.
https://doi.org/10.1371/journal.pone.0297979.s001
(DOCX)
S2 Table. Phenotypic and biochemical characteristics of A. hydrophila.
https://doi.org/10.1371/journal.pone.0297979.s002
(DOCX)
Acknowledgments
Mr. Ghulam Muhayyodin (Lecturer, Department of Wildlife and Ecology, UVAS Ravi Campus Pattoki) and Dr. Khalil Ahmad (School of Ecological and Environmental Sciences, East China Normal University, Shanghai 200241, China) designed GIS maps. Dr. Kashif Manzoor and Dr. Mati-Ullah (Lecturer, Department of Zoology, University of Education Faisalabad Campus) guided my research in the lab, warmly teaching molecular techniques in a very friendly atmosphere.
References
- 1. Boyd CE, McNevin AA, Davis RP. The contribution of fisheries and aquaculture to the global protein supply. Food Secur. 2022;14. pmid:35075379
- 2. Manage PM. Heavy use of antibiotics in aquaculture: Emerging human and animal health problems–A review. Sri Lanka J Aquat Sci. 2018;23.
- 3. Kibria G. Sustainable Energy for Rural Development in Bangladesh -Economic, Social and Environmental Benefits of Renewable Energy. Sydneybashi-Bangla; Aust Sci Technol Artic. 2015;37.
- 4. Chiu CN, Chen C, Muggleton NG. Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. Prog Brain Res. 2017;234.
- 5.
FAO. The State of World Fisheries and Aquaculture 2020. Sustainability in action. FAO. 2020. https://doi.org/10.4060/ca9229en.
- 6. Pech ZG H, Chavez MR C, Reynoso F L. Pathogenic Bacteria in Oreochromis niloticus Var. Stirling Tilapia Culture. Fish Aquac J. 2017;08.
- 7. Marinho-Neto FA, Claudiano GS, Yunis-Aguinaga J, Cueva-Quiroz VA, Kobashigawa KK, Cruz NRN, et al. Morphological, microbiological and ultrastructural aspects of sepsis by Aeromonas hydrophila in Piaractus mesopotamicus. PLoS One. 2019;14. pmid:31539396
- 8. Soares MP, Cardoso IL, Ishikawa MM, de Oliveira A da SS, Sartoratto A, Jonsson CM, et al. Effects of Artemisia annua alcohol extract on physiological and innate immunity of Nile tilapia (Oreochromis niloticus) to improve health status. Fish Shellfish Immunol. 2020;105. pmid:32693158
- 9. Froehlich HE, Runge CA, Gentry RR, Gaines SD, Halpern BS. Comparative terrestrial feed and land use of an aquaculture-dominant world. Proc Natl Acad Sci U S A. 2018;115. pmid:29712823
- 10. Buentello JA, Reyes-Becerril M, Romero-Geraldo MDJ, Ascencio-Valle FDJ. Effects of dietary arginine on hematological parameters and innate immune function of channel catfish. J Aquat Anim Health. 2007;19: 195–203. pmid:18201061
- 11. Cai W, Willmon E, Burgos FA, Ray CL, Hanson T, Arias CR. Biofilm and Sediment are Major Reservoirs of Virulent Aeromonas hydrophila (vAh) in Catfish Production Ponds. J Aquat Anim Health. 2019;31: 112–120. pmid:30549304
- 12. SS M. Present Status of Fish Disease Management in Freshwater Aquaculture in India: State-of-the-Art-Review. Aquac Fish. 2017;1: 1–9.
- 13. SS M P C, J D, SN S, A B, BS G, et al. Status of Aqua-medicines, Drugs and Chemicals Use in India: A Survey Report. Aquac Fish. 2017;1: 1–15.
- 14. Abdella B, El-Wazzan E, El-Sersy NA, Sabry SA, El-Helow ER. Pathogenicity and antibiotic susceptibility of two bacterial pathogens associated with the clam Tapes decussatus in some Egyptian fisheries. Ege J Fish Aquat Sci. 2017;34.
- 15. Tekedar HC, Abdelhamed H, Kumru S, Blom J, Karsi A, Lawrence ML. Comparative genomics of Aeromonas hydrophila secretion systems and mutational analysis of hcp1 and vgrG1 genes from T6SS. Front Microbiol. 2019;10. pmid:30687246
- 16. El-Wazzan E, Ghareeb DA, Abdella B. Pre-induction of Hsp70 expression to protect the grooved carpet shell clam, Ruditapes decussatus, against Micrococcus luteus: A trained immunity strategy. Egypt J Aquat Res. 2020;46.
- 17. Shirajum Monir M, Yusoff SM, Mohamad A, Ina-Salwany MY. Vaccination of Tilapia against Motile Aeromonas Septicemia: A Review. J Aquat Anim Health. 2020;32. pmid:32331001
- 18. Rahman MA, Arshad A, Amin SMN, Shamsudin MN. Growth and survival of fingerlings of a threatened snakehead, Channa striatus (bloch) in earthen nursery ponds. Asian J Anim Vet Adv. 2013;8: 216–226.
- 19. Nelson JS, Grande TC, Wilson MVH. Fishes of the World: Fifth Edition. Fishes of the World: Fifth Edition. 2016.
- 20. Rüber L, Tan HH, Britz R. Snakehead (Teleostei: Channidae) diversity and the Eastern Himalaya biodiversity hotspot. J Zool Syst Evol Res. 2020;58.
- 21. Nazir S, Khan N, Azmat H, Saima , Ramzan MM, Davies SJ. Effect of vitamin C (L-ascorbic acid) feed supplementation on the proximate composition, amino acids, and fatty acids profile of bullseye snakehead Channa marulius. Pakistan J Agric Sci. 2022;59.
- 22. Mohanty BP, Paria P, Das D, Ganguly S, Mitra P, Verma A, et al. Nutrient profile of giant river-catfish Sperata seenghala (Sykes). Natl Acad Sci Lett. 2012;35.
- 23. Rahman MA, Arshad A, Yusoff FM, Amin SMN, Marimuthu K, Ara R. Development of captive breeding and seed production techniques for Giant River Catfish Sperata seenghala. N Am J Aquac. 2014;76.
- 24. ALI MR. Pond Culture and Reproductive Performance of Seengharee, Sperata Seenghala (Sykes). 2015. Available: https://core.ac.uk/download/pdf/132561411.pdf.
- 25. Igbinosa IH, Igumbor EU, Aghdasi F, Tom M, Okoh AI. Emerging Aeromonas species infections and their significance in public health. Sci World J. 2012;2012. pmid:22701365
- 26. Ormen O, Granum PE, Lassen J, Figueras MJ. Lack of agreement between biochemical and genetic identification of Aeromonas spp. Apmis. 2005;113: 203–207. pmid:15799764
- 27. Bargui H, Marzouk M, Hannachi N, Boukadida J. Antimicrobial resistance and molecular determination of virulence genes of Aeromonas isolates from clinical patients and hydric samples. Euro-Mediterranean J Environ Integr. 2023.
- 28. Abdella B, Abozahra NA, Shokrak NM, Mohamed RA, El-Helow ER. Whole spectrum of Aeromonas hydrophila virulence determinants and the identification of novel SNPs using comparative pathogenomics. Sci Rep. 2023;13. pmid:37173388
- 29. Suresh K, Pillai D. Prevalence and characterization of virulence-associated genes and antimicrobial resistance in Aeromonas hydrophila from freshwater finfish farms in Andhra Pradesh, India. Biologia (Bratisl). 2023.
- 30. Preena PG, Dharmaratnam A, Swaminathan TR. Antimicrobial Resistance analysis of Pathogenic Bacteria Isolated from Freshwater Nile Tilapia (Oreochromis niloticus) Cultured in Kerala, India. Curr Microbiol. 2020;77. pmid:32776225
- 31. Neamat-Allah ANF, Mahmoud EA, Mahsoub Y. Effects of dietary white mulberry leaves on hemato-biochemical alterations, immunosuppression and oxidative stress induced by Aeromonas hydrophila in Oreochromis niloticus. Fish Shellfish Immunol. 2021;108: 147–156. pmid:33301933
- 32. Fernández-Bravo A, Figueras MJ. An update on the genus Aeromonas: Taxonomy, epidemiology, and pathogenicity. Microorganisms. 2020. pmid:31963469
- 33. El-Bahar HM, Ali NG, Aboyadak IM, Khalil SAES, Ibrahim MS. Virulence genes contributing to Aeromonas hydrophila pathogenicity in Oreochromis niloticus. Int Microbiol. 2019;22. pmid:30989358
- 34. Naseem S, Ghaffar A, Hussain R, Khan A. Inquisition of Toxic Effects of Pyriproxyfen on Physical, Hemato-Biochemical and Histopathological Parameters in Labeo rohita Fish. Pak Vet J. 2022;42.
- 35. Aguilar-Marcelino L, Bautista-Garfias CR, Zaheer T, Maqsood A, Bamarni SSI, Abdullah BH, et al. Potential of Anisakiasis in Foodborne Zoonosis. Pak Vet J. 2022;42: 433–444.
- 36. Cantas L, Shah SQA, Cavaco LM, Manaia CM, Walsh F, Popowska M, et al. A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front Microbiol. 2013;4. pmid:23675371
- 37. Malik F, Nawaz M, Anjum AA, Firyal S, Shahid MA, Irfan S, et al. Molecular Characterization of Antibiotic Resistance in Poultry Gut Origin Enterococci and Horizontal Gene Transfer of Antibiotic Resistance to Staphylococcus aureus. Pak Vet J. 2022;42.
- 38. Marti E, Variatza E, Balcazar JL. The role of aquatic ecosystems as reservoirs of antibiotic resistance. Trends in Microbiology. 2014. pmid:24289955
- 39. Schar D, Klein EY, Laxminarayan R, Gilbert M, Van Boeckel TP. Global trends in antimicrobial use in aquaculture. Sci Rep. 2020;10. pmid:33318576
- 40. Cabello FC, Godfrey HP, Buschmann AH, Dölz HJ. Aquaculture as yet another environmental gateway to the development and globalisation of antimicrobial resistance. The Lancet Infectious Diseases. 2016. pmid:27083976
- 41. Abbas R, Nawaz Z, Siddique AB, Aslam R, Rafique A, Zahoor MA, et al. Molecular Detection of Biofilm Production among Multidrug Resistant Isolates of Pseudomonas aeruginosa from Meat Samples. Pak Vet J. 2022;42: 505–510.
- 42. Velazquez-Meza ME, Galarde-López M, Carrillo-Quiróz B, Alpuche-Aranda CM. Antimicrobial resistance: One Health approach. Veterinary World. 2022. pmid:35497962
- 43. Woo SJ, Kim MS, Jeong MG, Do MY, Hwang SD, Kim WJ. Establishment of Epidemiological Cut-Off Values and the Distribution of Resistance Genes in Aeromonas hydrophila and Aeromonas veronii Isolated from Aquatic Animals. Antibiotics. 2022;11. pmid:35326806
- 44. Ullah M, Rasool F, Khan N, Ali S, Sheikh AA. Pakistan Veterinary Journal Antibiotic Resistance and its Gene Profile in Escherichia coli Isolated from Diseased Farm-Raised Carps in Punjab, Pakistan.
- 45. Munita JM, Arias CA. Mechanisms of antibiotic resistance. Virulence Mech Bact Pathog. 2016; 481–511. pmid:27227291
- 46. Pérez-Sánchez T, Mora-Sánchez B, Balcázar JL. Biological Approaches for Disease Control in Aquaculture: Advantages, Limitations and Challenges. Trends Microbiol. 2018;26: 896–903. pmid:29801773
- 47. Liu Y, Liu B, Yang P, Wang T, Chang Z, Wang J, et al. LysR-type transcriptional regulator OvrB encoded in O island 9 drives enterohemorrhagic Escherichia coli O157:H7 virulence. Virulence. 2019;10. pmid:31502495
- 48. Mannion A, Shen Z, Fox JG. Comparative genomics analysis to differentiate metabolic and virulence gene potential in gastric versus enterohepatic Helicobacter species 06 Biological Sciences 0604 Genetics. BMC Genomics. 2018;19. pmid:30458713
- 49. Daga AP, Koga VL, Soncini JGM, De Matos CM, Perugini MRE, Pelisson M, et al. Escherichia coli Bloodstream Infections in Patients at a University Hospital: Virulence factors and clinical characteristics. Front Cell Infect Microbiol. 2019;9. pmid:31245301
- 50. Niu C, Yu D, Wang Y, Ren H, Jin Y, Zhou W, et al. Common and pathogen-specific virulence factors are different in function and structure. Virulence. 2013;4. pmid:23863604
- 51. Jubelin G, Desvaux M, Schüller S, Etienne-Mesmin L, Muniesa M, Blanquet-Diot S. Modulation of enterohaemorrhagic Escherichia coli survival and virulence in the human gastrointestinal tract. Microorganisms. 2018. pmid:30463258
- 52. Pan X, Yang Y, Zhang JR. Molecular basis of host specificity in human pathogenic bacteria. Emerg Microbes Infect. 2014;3: 0. pmid:26038515
- 53. Cepeda-Molero M, Berger CN, Walsham ADS, Ellis SJ, Wemyss-Holden S, Schüller S, et al. Attaching and effacing (A/E) lesion formation by enteropathogenic E. coli on human intestinal mucosa is dependent on non-LEE effectors. PLoS Pathog. 2017;13. pmid:29084270
- 54. Paytubi S, Cansado C, Madrid C, Balsalobre C. Nutrient composition promotes switching between pellicle and bottom biofilm in Salmonella. Front Microbiol. 2017;8. pmid:29163440
- 55. Koohsari H, Ghaemi EA, Mozaffari NA, Moradi A, Sadegh-Sheshpoli M, Javid SN. The effect of adding blood on the virulence genes expression of Staphylococcus aureus in exponential and stationary growth phase. Jundishapur J Microbiol. 2017;10.
- 56. Guijarro JA, Cascales D, García-Torrico AI, García-Domínguez M, Méndez J. Temperature-dependent expression of virulence genes in fish-pathogenic bacteria. Frontiers in Microbiology. 2015. pmid:26217329
- 57. Do H, Makthal N, VanderWal AR, Saavedra MO, Olsen RJ, Musser JM, et al. Environmental pH and peptide signaling control virulence of Streptococcus pyogenes via a quorum-sensing pathway. Nat Commun. 2019;10. pmid:31197146
- 58. Manzoor K, Sciences A, Rasool F, Khan N, Sciences A. Prevalence and Molecular Detection of Edwardsiella tarda in Cultured Tilapia Species of Fish Farms of Punjab in Pakistan and their Postmortem Examination. 2023.
- 59.
Edward J.Noga. Fish Disease: Diagnosis and Treatment, Second Edition. Wiley-Blackwell. 2010.
- 60. Lima LC, Fernandes AA, Costa AAP, Velasco FO, Leite RC, Hackett JL. Isolation and characterizaton of Edwardsiella tarda from pacu Myleus micans. Arq Bras Med Vet e Zootec. 2008;60.
- 61. Muratori MCS, Martins NE, Peixoto MTD, Oliveira AL, Ribeiro LP, Costa APR, et al. Edwardsiella septicemia mortality in tilapia-integrated with pig in fish farming. Arq Bras Med Vet e Zootec. 2001;53.
- 62. Xiao J, Wang Q, Liu Q, Wang X, Liu H, Zhang Y. Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China. Aquac Res. 2008;40.
- 63. Fang H, Zhang X, Chen C, Jin X, Wang X. Studies on the edwardsiellosis and characterization of pathogenic bacteria from diseases flounder (Paralichthys olivaceus L.) and turbot (Scophthalmus maximus L.). Acta Oceanol Sin. 2006;25.
- 64. Chen M, Lan X, Zhu L, Ru P, Xu W, Liu H. PCR Mediated Nucleic Acid Molecular Recognition Technology for Detection of Viable and Dead Foodborne Pathogens. Foods. 2022. pmid:36076861
- 65. Armougom F. Exploring Microbial Diversity Using 16S rRNA High-Throughput Methods. J Comput Sci Syst Biol. 2009;02.
- 66. Persson S, Al-Shuweli S, Yapici S, Jensen JN, Olsen KEP. Identification of clinical aeromonas species by rpoB and gyrB sequencing and development of a multiplex pcr method for detection of Aeromonas hydrophila, A. caviae, A. veronii, and A. media. J Clin Microbiol. 2015;53. pmid:25411168
- 67. Wimalasena SHMP De Silva BCJ, Hossain S Pathirana HNKS, Heo GJ. Prevalence and characterisation of quinolone resistance genes in Aeromonas spp. isolated from pet turtles in South Korea. J Glob Antimicrob Resist. 2017;11. pmid:28743647
- 68. Sedek A, Abd El Tawab A, El-Hofy F, El-Gohary M. Antibiotic resistance genes of Edwardesiella tarda isolated from Oreochromis niloticus and Claris gariepinus. Benha Vet Med J. 2020;38.
- 69. Öktem IMA, Gülay Z, Biçmen M, Gür D, Gültekin M, Öğünç D, et al. qnrA prevalence in extended-spectrum β-lactamase-positive enterobacteriaceae isolates from Turkey. Jpn J Infect Dis. 2008;61.
- 70. Kerrn MB, Klemmensen T, Frimodt-Möller N, Espersen F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J Antimicrob Chemother. 2002;50. pmid:12356795
- 71. Zhu D, Li A, Wang J, Li M, Cai T, Hu J. Correlation between the distribution pattern of virulence genes and virulence of Aeromonas hydrophila strains. Front Biol China. 2007;2.
- 72. Ahangarzadeh M, Najafabadi MG, Peyghan R, Houshmand H, Rohani MS, Soltani M. Detection and distribution of virulence genes in Aeromonas hydrophila isolates causing infection in cultured carps. Vet Res Forum. 2022;13. pmid:35601789
- 73. Wang K, Liu E, Song S, Wang X, Zhu Y, Ye J, et al. Characterization of Edwardsiella tarda RpoN: Roles in σ70 family regulation, growth, stress adaption and virulence toward fish. Arch Microbiol. 2012;194. pmid:22231477
- 74. Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45.
- 75. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing M100-ED30. Clinical and Laboratory Standards Institute. 2020.
- 76. Wamala SP, Mugimba KK, Dubey S, Takele A, Munang’andu HM, Evensen Ø, et al. Multilocus sequence analysis revealed a high genotypic diversity of Aeromonas hydrophila infecting fish in Uganda. J Fish Dis. 2018;41: 1589–1600. pmid:30074242
- 77. Li F, Wu D, Gu HR, Yin M, Ge HL, Liu XH, et al. Aeromonas hydrophila and Aeromonas veronii cause motile Aeromonas septicaemia in the cultured Chinese sucker, Myxocyprinus asiaticus. Aquac Res. 2019;50.
- 78. Morshdy AEMA Ahmed GE, El-Tahlawy AS El Bay-Omi RM, Mahmoud AFA. Virulence and Antimicrobial Resistance Profiling of Aeromonas hydrophila Recovered from Retail fish in Sharkia Province, Egypt. J Adv Vet Res. 2023;13: 1320–1324.
- 79. El-Hossary D, Mahdy A, Elariny EYT, Askora A, Merwad AMA, Saber T, et al. Antibiotic Resistance, Virulence Gene Detection, and Biofilm Formation in Aeromonas spp. Isolated from Fish and Humans in Egypt. Biology (Basel). 2023;12. pmid:36979113
- 80. Thaotumpitak V, Sripradite J, Atwill ER, Jeamsripong S. Emergence of colistin resistance and characterization of antimicrobial resistance and virulence factors of Aeromonas hydrophila, Salmonella spp., and Vibrio cholerae isolated from hybrid red tilapia cage culture. PeerJ. 2023;11. pmid:36855429
- 81. Nhinh DT, Le DV, Van K Van, Giang NTH, Dang LT, Hoai TD. Prevalence, virulence gene distribution and alarming the multidrug resistance of Aeromonas hydrophila associated with disease outbreaks in freshwater aquaculture. Antibiotics. 2021;10. pmid:34064504
- 82. Saleh A, Elkenany R, Younis G. Virulent and multiple antimicrobial resistance Aeromonas hydrophila isolated from diseased nile tilapia fish (Oreochromis niloticus) in egypt with sequencing of some virulence-associated genes. Biocontrol Sci. 2021;26. pmid:34556619
- 83. Ahmed HA, Mohamed MEM, Rezk MM, Gharieb RMA, Abdel-Maksoud SA. Aeromonas hydrophila in fish and humans; prevalence, virulotyping and antimicrobial resistance. Slov Vet Res. 2018;55.
- 84. Azzam-Sayuti M, Ina-Salwany MY, Zamri-Saad M, Yusof MT, Annas S, Najihah MY, et al. The prevalence, putative virulence genes and antibiotic resistance profiles of Aeromonas spp. isolated from cultured freshwater fishes in peninsular Malaysia. Aquaculture. 2021;540.
- 85. Abu-Elala N, Abdelsalam M, Marouf S, Setta A. Comparative analysis of virulence genes, antibiotic resistance and gyrB-based phylogeny of motile Aeromonas species isolates from Nile tilapia and domestic fowl. Lett Appl Microbiol. 2015;61. pmid:26280543
- 86. Roges EM, Gonçalves VD, Cardoso MD, Festivo ML, Siciliano S, Berto LH, et al. Virulence-Associated Genes and Antimicrobial Resistance of Aeromonas hydrophila Isolates from Animal, Food, and Human Sources in Brazil. Biomed Res Int. 2020;2020. pmid:32461959
- 87. Eid HM, El-Mahallawy HS, Shalaby AM, Elsheshtawy HM, Shetewy MM, Eidaroos NH. Emergence of extensively drug-resistant Aeromonas hydrophila complex isolated from wild Mugil cephalus (striped mullet) and Mediterranean seawater. Vet World. 2022;15: 55–64. pmid:35369605
- 88. Fauzi NNFNM, Hamdan RH, Mohamed M, Ismail A, Zin AAM, Mohamad NFA. Prevalence, antibiotic susceptibility, and presence of drug resistance genes in Aeromonas spp. isolated from freshwater fish in Kelantan and Terengganu states, Malaysia. Vet World. 2021;14. pmid:34566322
- 89. Elkenany rasha. Prevalence and antibiotic resistance of Aeromonas hydrophila and Staphylococcus aureus isolated from seafood in Egypt. Mansoura Vet Med J. 2020;21.
- 90. Lee H-J, Storesund JE, Lunestad B-T, Hoel S, Lerfall J, Jakobsen AN. Whole genome sequence analysis of Aeromonas spp. isolated from ready-to-eat seafood: antimicrobial resistance and virulence factors. Front Microbiol. 2023;14. pmid:37455746
- 91. ghareeb H, Zahran E, Elghany S. Occurrence, Molecular Characterization and Antimicrobial Resistance of Pathogenic Aeromonas hydrophila from Retail Fish. Alexandria J Vet Sci. 2019;62: 172.
- 92. Esteve C, Alcaide E, Blasco MD. Aeromonas hydrophila subsp. dhakensis isolated from feces, water and fish in Mediterranean Spain. Microbes Environ. 2012;27. pmid:22472298
- 93. Sani B, Yusoff MS, Yasin ISM, Karim MMA, Matori MF, Amal MNA, et al. Pathogenicity of Aeromonas hydrophila in High-value Native Pangasius Catfish, Pangasius nasutus (Bleeker). Pertanika J Trop Agric Sci. 2023;46.