Figures
Abstract
Bacterial endosymbionts are abundantly found in both hard and soft ticks. Occidentia massiliensis, a rickettsial endosymbiont, was first identified in the soft tick Ornithodoros sonrai collected from Senegal and later was identified in a hard tick Africaniella transversale. In this study, we noted the presence of Occidentia species, designated as Occidentia-like species, in a soft tick O. turicata americanus. Sequencing and phylogenetic analyses of the two genetic markers, 16S rRNA and groEL confirmed the presence of Occidentia-like species in O. turicata americanus ticks. The Occidentia-like species was noted to be present in all developmental stages of O. turicata americanus and in different tick tissues including ovaries, synganglion, guts and salivary gland. The levels of Occidentia-like species 16S rRNA transcripts were noted to be significantly higher in ovaries than in a gut tissue. In addition, Occidentia-like species groEL expression was noted to be significantly higher in tick synganglion than in ovaries and gut tissues. Furthermore, levels of Occidentia-like species 16S rRNA transcripts increased significantly upon O. turicata americanus blood feeding. Taken together, our study not only shows that Occidentia-like species is present in O. turicata americanus but also suggests that this bacterium may play a role in tick-bacteria interactions.
Citation: Liu L, Sonenshine DE, Sultana H, Neelakanta G (2022) Identification of a rickettsial endosymbiont in a soft tick Ornithodoros turicata americanus. PLoS ONE 17(12): e0278582. https://doi.org/10.1371/journal.pone.0278582
Editor: Brian Stevenson, University of Kentucky College of Medicine, UNITED STATES
Received: August 23, 2022; Accepted: November 19, 2022; Published: December 6, 2022
Copyright: © 2022 Liu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This study was supported by University of Tennessee, Knoxville, Start-up funds to HS and GN and in part by funding from National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH) (Award number: R01AI130116) to GN. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
In the United States, soft ticks Ornithodoros turicata and Ornithodoros hermsi are the primary vectors for Borrelia turicatae and Borrelia hermsii, respectively, the causative agents of tick-borne relapsing fever (TBRF) in humans [1–4]. Recent reports suggest that O. turicata was also noted to be a potential vector that could transmit African swine fever virus (ASFV) to pigs (Sus scrofa) [5, 6]. These ticks are opportunistic, nidicolous feeders that feed rapidly and take a complete blood meal within 60 minutes [7–10]. Some of the recognized hosts for O. turicata ticks includes gopher tortoise, squirrels, snakes, cattle, pigs, and prairie dogs [7–10]. The developmental stages in the life cycle of O. turicata includes eggs, larvae, nymphs, and adults [7–10]. After mating with a male, female O. turicata ticks lay eggs that hatch into 6-legged larvae which feed on a small vertebrate host and molt into first-instar 8-legged nymphs [7–10]. Unlike hard ticks, O. turicata female ticks can mate and lay hundreds of eggs several times [7–11]. After a blood meal, the first-instar nymphs molt into second-instar stage nymphs [7–10]. Ornithodoros turicata has up to seven nymphal stages [7–10]. Ticks continue through multiple instar stages until molting into the adult stage where sexual differentiation occurs [7–10]. Laboratory studies have indicated that these ticks can survive extreme periods of starvation between blood meals and adult ticks can survive up to 10 years with a regular blood feeding [11].
In addition to harboring several human pathogens, both hard and soft ticks harbor many rickettsial bacteria, most of which are noted to be non-pathogenic [12–19]. Rickettsia is a genus comprised of diverse obligate intracellular gram-negative bacteria that are primarily transmitted by various arthropods, including ticks [20]. Rickettsia spp. are reported to be the most common endosymbionts in Ixodes, Amblyomma, and Dermacentor ticks, although less prevalent in the genera of Rhipicephalus, Haemaphysalis, and Hyalomma [21, 22]. Studies have reported that rickettsial endosymbionts play an important role in the physiological fitness, population dynamics, and vector competence of their tick hosts [13, 17, 23–25]. In addition, interaction between a rickettsial endosymbiont and another Rickettsia influences the transmission of pathogens and the distribution of the endosymbionts [26–28]. While these studies are mostly focused on hard ticks, fewer studies have focused on addressing the presence or interactions of rickettsial bacteria with soft ticks.
Occidentia is a new genus within the family Rickettsiaceae, along with Rickettsia and Orientia [29]. Currently, the only species in the genus Occidentia is Occidentia massiliensis, which was isolated and characterized from a soft tick Ornithodoros sonrai, collected in Senegal [29]. Occidentia massiliensis is a gram-negative, obligate intracellular, rod-shaped bacillus with a genome size of 1,469,252 bp [29]. This bacterium has no plasmids but has one chromosome [29]. In addition to their presence in O. sonrai, Oc. massiliensis was identified in another soft tick, Argas japonicus, collected in Japan [30]. In another recent study, Oc. massiliensis was identified for the first time in hard ticks, Africaniella transversale [31]. These studies suggest that Oc. massiliensis could be a common endosymbiont in both hard and soft ticks. In this study, we determined whether we could detect Occidentia species in O. turicata americanus. Our study indicates that Occidentia-like species was evident in different development stages of O. turicata americanus, indicating vertical transmission, and in different tick tissues. In addition, we noted that blood feeding induces Occidentia-like species 16S rRNA expression in these ticks.
Results
PCR amplification with Rickettsia 16S rRNA oligonucleotides showed presence of Occidentia-like species in O. turicata americanus ticks
Rickettsial endosymbionts have been detected in a wide variety of ticks [16, 31–34]. To address whether O. turicata americanus ticks harbor any Rickettsia, total DNA was isolated from uninfected unfed adult O. turicata americanus ticks. This DNA was used as a template for PCR amplification with published [35] Rickettsia 16S rRNA oligonucleotides (Fig 1). A band at approximately 1500 bp was evident in the DNA samples generated from both male and female O. turicata americanus ticks (Fig 1A and 1C). Two other prominent PCR amplified bands between 300–500 bp were also evident in the DNA samples generated from both male and female O. turicata americanus ticks (Fig 1A). All three bands from female ticks were sequenced from both ends. Sequencing of the 1500 bp band gave a 98% match to O. massiliensis 16S rRNA (Fig 1B, S1A and S2A Figs). We designated this bacterium as Occidentia-like species due to its high identity with Oc. massiliensis. The sequencing results of the lower bands (1000–500 bp) showed weak sequencing peaks. The BLAST searches revealed low sequence coverage and showed non-Rickettsia-specific matches (eg. Human transcription factor SREBF1). The 16S rRNA partial sequence from Occidentia-like species found in O. turicata americanus ticks is shown in S3 Fig and submitted to GenBank (accession no. OP799373). Furthermore, to address whether Ixodes scapularis ticks also harbor Occidentia-like species, total DNA was isolated from uninfected unfed female adult ticks. PCR amplification with 16S rRNA resulted in a band around 750 bp (Fig 1C). Sequencing of this band revealed mixed sequences (Fig 1D and S2B Fig) that showed 83–84% identity with several Rickettsia species such as R. tamurae subp. buchneri strain ISO7, R. monacensis strain Bel-4113 and 77% identity with O. massiliensis. Overall, these results suggest that Occidentia-like species are present in O. turicata americanus.
Agarose gel image showing PCR amplification of 16S rRNA gene fragment from total DNA isolated from unfed O. turicata americanus adult male or female (A) and unfed O. turicata americanus adult female or unfed I. scapularis female tick (C). M indicates DNA marker. NTC indicates no-template control. Arrow in A and C indicates 16S rRNA product in O. turicata americanus ticks. Sequencing analysis of partial Occidentia-like species 16S rRNA sequence from unfed O. turicata americanus female (B) or I. scapularis female (D) tick is shown.
PCR amplification with Oc. massiliensis-specific groEL oligonucleotides confirmed presence of Occidentia-like species in O. turicata americanus ticks
To further confirm if Occidentia-like species are present in O. turicata americanus ticks, we performed PCRs with Oc. massiliensis groEL specific primers [31]. PCR analysis showed an intense band around 650bp in DNA samples generated from both male and female O. turicata americanus ticks (Fig 2A). Sequencing analysis revealed a clear sequence with 92% match to Oc. massiliensis groEL gene sequence (Fig 2B and S1B and S4A Figs). The partial sequence of Occidentia-like species groEL was submitted to GenBank (accession no. OP802357). PCR analysis with Oc. massiliensis specific primers and DNA sample from I. scapularis female ticks showed a faint band around 650bp (Fig 2C). Sequencing of this PCR product revealed a sequence with 98–99% identity with the groEL gene of several Rickettsia species (S4B and S5 Figs). The groEL partial sequence for Occidentia-like species found in O. turicata americanus ticks is shown in S6 Fig. Collectively, these results indicate that Occidentia-like species are present as endosymbionts in O. turicata americanus ticks.
Agarose gel image showing PCR amplification of groEL gene fragment from total DNA isolated from unfed O. turicata americanus adult male and female (A) and unfed O. turicata americanus female or I. scapularis female tick (C). M indicates DNA marker. NTC indicates no-template control. Arrow in A and C indicates groEL PCR product. Sequencing analysis of partial Occidentia-like species groEL sequence from unfed O. turicata americanus female (B) or I. scapularis female (D) is shown.
Comparison of Occidentia-like species 16S rRNA and groEL sequences with Oc. massiliensis and other species in the Rickettsiaceae family
Fourteen rickettsial species were selected for the comparison of the nucleotide sequence for 16S rRNA gene, which have the highest identity to Occidentia-like species. Similarly, 13 rickettsial species and Buchnera aphidocola were selected for groEL gene, as the groEL gene of Buchnera has unusually high identity to that of Occidentia-like species. All nucleotide sequences were downloaded from GenBank [National Center for Biotechnology Information (NCBI)] and processed for alignment and phylogenetic analysis using DNASTAR software with ClustalW method. We noted that the sequence of 16S rRNA of Occidentia-like species is highly conserved, sharing 98.8% identity with Oc. massiliensis and above 91% identity with Orientia chuto, O. tsutsugamushi and 11 other Rickettsia spp. (S1A Fig). The phylogenetic analysis showed that the 16S rRNA sequence from Occidentia-like species shares a same clade with Oc. massiliensis and these two organisms were close to the clade shared by Orientia chuto and O. tsutsugamushi (Fig 3A). The other analyzed rickettsial species formed a different clade (Fig 3A). The Occidentia-like species groEL sequence was 92.7% identical to that of Oc. massiliensis (S1B Fig) and between 67.8% to 74% identity with Orientia chuto, O. tsutsugamushi, Buchnera aphidicola, and ten other similar Rickettsia spp. (S1B Fig). The phylogenetic analysis of groEL sequence from Occidentia-like species revealed that this bacterium falls within the same clade as Oc. massiliensis, and these two bacteria seem to form a clade close to Orientia chuto and O. tsutsugamushi, divergent from a clade formed by ten Rickettsia spp. (Fig 3B). Buchnera aphidicola forms a totally divergent clade from all other analyzed species (Fig 3B).
Phylogenetic trees showing relatedness of Occidentia-like species 16S rRNA (A) and groEL (B) with Occidentia massiliensis, Orientia chuto, Orientia tsutsugamushi, Buchnera aphidicola and other Rickettsia spp. is shown. MAFFT (v6.240) was used as the method for multiple sequence alignment and RAxML (v8.2.12) was used to construct the phylogenetic tree. GenBank accession numbers are provided along with the species names.
Detection of Occidentia-like species in different developmental stages of O. turicata americanus ticks
We then analyzed if Occidentia-like species is present in different developmental stages of O. turicata americanus ticks. Total DNA was isolated from five individual nymphal ticks, five adult female ticks, three adult male ticks, and pool of eight eggs laid by one tick. PCR analysis revealed the presence of Occidentia-like species in all five nymphal ticks, four out of five female ticks, two out of three male ticks, and the eggs (Fig 4A and S7A Fig). In addition, sequencing of the representative PCR products confirmed the presence of Occidentia-like species in these O. turicata americanus developmental stages (S7B Fig). Furthermore, quantitative-real time PCR (QRT-PCR) analysis showed no significant differences (P>0.05) in the levels of Occidentia-like species between nymphs and female ticks (Fig 4B). These results indicate that Occidentia-like species is present in all developmental stages of O. turicata americanus ticks.
A) Agarose gel image showing PCR amplification of 16S rRNA gene fragment from total DNA isolated from individual (indicated with numbers) unfed O. turicata americanus nymphs or adult male and female ticks. Eight eggs were pooled and processed together as one sample for total DNA extraction followed by PCR. M indicates DNA marker; PC indicates positive control and NTC indicates no-template control. Full gel image is shown in S7 Fig. Amplification of O. turicata americanus 28S rRNA serves as a template control. B) QRT-PCR analysis showing levels of Occidentia-like species in O. turicata americanus nymphs and adult females. Occidentia-like species 16S rRNA levels were normalized to O. turicata americanus 28S rRNA levels. Each triangle or circle represents data from sample generated from one tick. Statistical analysis was performed with Student’s t test and P value less than 0.05 was considered as significant.
16S rRNA transcripts of Occidentia-like species are abundantly expressed in tick ovaries than in gut tissue of O. turicata americanus ticks
To analyze whether transcripts of Occidentia-like species are detected in various tick tissues, total RNA from synganglion, ovaries, guts, or salivary glands from five individual fed female ticks was isolated. The RT-PCR with 16S rRNA and groEL primers followed by agarose gel electrophoresis confirmed the presence of 16S rRNA and groEL transcripts of Occidentia-like species in synganglion, ovaries, gut, and salivary gland tissues (Fig 5A and S8 Fig). Sequencing of representative PCR products confirmed presence of transcripts of Occidentia-like species in all tested organs (S9 and S10 Figs). RT-PCR results showed variable levels of 16S rRNA and groEL transcripts of Occidentia-like species in the four tested tissues (Fig 5A). We noted that QRT-PCR showed significantly (P<0.05) increased Occidentia-like species 16S rRNA transcripts in ovaries when compared to the levels noted in guts (Fig 5B). However, no significant differences in the Occidentia-like species 16S rRNA transcripts were evident between other tested tissue samples (Fig 5B). Furthermore, QRT-PCR showed significantly (P<0.05) increased expression of Occidentia-like species groEL in O. turicata americanus synganglion compared to the levels noted in ovaries or gut tissues (Fig 5C). However, no significant difference in the expression of Occidentia-like species groEL was observed between synganglion or salivary glands (Fig 5C). In addition, no significant difference in the Occidentia-like species groEL expression was noted between guts or salivary glands (Fig 5B). These results indicate that 16S rRNA transcripts of Occidentia-like species are abundantly expressed in O. turicata americanus ovaries.
Agarose gel image showing PCR amplification of 16S rRNA gene fragment from total RNA isolated from synganglion, ovaries, salivary glands, and guts from individual fed O. turicata americanus female ticks. PC indicates positive control and NTC indicates no-template control. Full gel image is shown in S8 Fig. Amplification of O. turicata americanus 28S rRNA serves as a template control. No positive control was included in 28S rRNA PCR analysis. QRT-PCR analysis with RNA showing Occidentia-like species 16S rRNA (B) and groEL (C) transcripts in different O. turicata americanus tissues. Occidentia-like species 16S rRNA levels were normalized to O. turicata americanus 28S rRNA levels. Levels of Occidentia-like species groEL transcripts were normalized to levels of Occidentia-like species 16S rRNA. Each diamond/square/circle/triangle represents data from one individual adult tick tissue. Statistical analysis was performed with Student’s t test and P value less than 0.05 was considered as significant.
Blood feeding induces 16S rRNA transcripts of Occidentia-like species in O. turicata ticks
To address whether blood feeding has any impact on Occidentia-like species transcription, 5 nymphal soft ticks were fed on tick-naïve mice. The repleted ticks were processed for RNA, and cDNA synthesis. QRT-PCR analysis showed a significant (P<0.05) increase in Occidentia-like species 16S rRNA transcripts in fed O. turicata americanus ticks when compared to the levels noted in unfed controls (Fig 6A). Furthermore, QRT-PCR analysis revealed no significant difference in the Occidentia-like species groEL expression between unfed and fed O. turicata americanus ticks (Fig 6B). These results suggest that blood meal induces Occidentia-like species 16S rRNA expression in O. turicata americanus ticks.
QRT-PCR analysis with RNA showing levels of Occidentia-like species 16S rRNA (A) and groEL (B) transcript levels in unfed and fed O. turicata americanus nymphal ticks. Occidentia-like species 16S rRNA levels were normalized to O. turicata americanus 28S rRNA levels. Levels of Occidentia-like species groEL transcripts were normalized to levels of Occidentia-like species 16S rRNA. Each open and closed circle represents data from one individual tick. Statistical analysis was performed with Student’s t test and P value less than 0.05 was considered as significant.
Discussion
Rickettsial bacteria are the most common endosymbionts in various tick species [13, 18, 22, 25, 33, 34]. These bacteria show remarkable diversity in different hosts [36]. Some rickettsial bacteria are transovarially transmitted in ticks [13, 18, 22, 25, 33, 34]. Ticks are suggested to be a possible ancestral host for these bacteria [37]. In this study, we report the identification of a rickettsial endosymbiont Occidentia-like species in all developmental stages of O. turicata americanus ticks, including eggs, suggesting a possible transovarially transmitted bacteria in these soft ticks. We noted variable presence of Occidentia-like species were noted in adult stages.
Ticks feed on various vertebrate hosts including but not limited to cattle, deer, tortoise, squirrels, snakes, pigs, and prairie dogs [7–10, 38]. The origin of Occidentia-like species identified in O. turicata americanus ticks is currently not known. The identification of Oc. massiliensis in O. sonrai ticks collected from rodent burrows [29], in Africaniella transversale collected from Python regius [31], in Argas japonicus collected from nest of Red-rumped swallow (Hirundo daurica) [30] and O. turicata americanus ticks originally collected from burrows of Gopher tortoise used in this current study suggests a complex evolutionary origin of this endosymbiont in different ticks. Currently, the presence of Occidentia species in other vertebrate animals or in birds has not been reported. Therefore, the hypothesis on the co-evolution of some ticks with Occidentia species, perhaps as an endosymbiont, cannot be ruled out.
The use of two genetic markers (16S rRNA and groEL) confirmed the presence of Occidentia-like species in O. turicata americanus ticks. In particular, the oligonucleotides used for groEL amplification was specifically designed for the Oc. massiliensis gene as reported in a previous publication [31]. The authors noted that these oligonucleotides may also amplify Orientia tsutsugamushi groEL gene [31]. These oligonucleotides were designed based on the alignment of groEL sequences [31]. Phylogenetic analysis performed in this study revealed that the groEL sequence of Occidentia-like species (identified in this study) is closer to Oc. massiliensis than to the O. tsutsugamushi sequence. In addition, the use of 16S rRNA oligonucleotides also resulted in clearly different sequencing peaks that suggests the dominance of Occidentia-like species in O. turicata americanus ticks. Therefore, it is reasonable to assume that the authentic Occidentia-like species are present in these ticks.
We noted that Occidentia-like species is present in different tick tissues including the synganglion. The presence of bacteria in synganglion is not surprising. A recent study showed that Ehrlichia muris-like agent was found to be present in several tick tissues including the synganglion [39]. The role of Occidentia-like species in O. turicata americanus tick synganglion is currently not known. The expression of Occidentia-like species groEL was significantly upregulated in synganglion compared to the expression noted in guts and ovaries. The GroEL performs chaperonin activity including proper folding of the misfolded proteins [40]. Higher levels of groEL suggests active Occidentia-like species protein turnover in O. turicata americanus synganglion. We also noted increased Occidentia-like species 16S rRNA levels upon O. turicata americanus feeding. It is reasonable to hypothesize that Occidentia-like species in O. turicata americanus may use certain nutrients from the blood meal or use energy from arthropod mitochondria to replicate and prepare for transstadial/transovarial transmission in these ticks. It has been reported that levels of endosymbiont Candidatus Midichloria mitochondrii was induced upon I. ricinus blood feeding [41]. In addition, a previous report showed that higher number of Oc. massiliensis was present close to mitochondria in tick cell line [29]. An extensive literature has shown important contributions by similar endosymbionts in diverse blood feeding arthropods, including various tick species [42]. Endosymbionts contribute in arthropod blood feeding, vector fitness and pathogen interactions [42]. Some of the endosymbionts provide nutrients that are missing in the vertebrate host blood and vitamins to their vector host [42]. Endosymbionts such as Coxiella are critical for A. americanum survival and overall vector fitness [42]. In addition, presence of Coxiella is reported to impair transmission of Ehrlichia chaffiensis from these ticks [42]. Some endosymbionts are also essential for pathogen development in vectors [42]. Currently, it is not known what biological benefits, if any, that the presence of this endosymbiont provides for its tick host.
In summary, our study shows the presence of Occidentia-like species in O. turicata americanus ticks. The observation of Occidentia-like species in O. turicata americanus opens interesting insights to understand interaction between this rickettsial bacterium and its tick host.
Methods
Ticks and mice organism information
Ornithodoros turicata americanus nymphs, adult female and male ticks, and eggs were collected from continuously maintained colonies at Old Dominion University, Norfolk, VA. The O. turicata americanus ticks were originally collected from burrows of the gopher tortoise (Gopherus polyphemus) in Florida, U.S.A. These ticks were donated by Dr. J.H. Oliver, Jr., The director of the tick lab at Georgia Southern University in Statesboro, GA., to one of the authors (Dr. Daniel Sonenshine). Dr. J.H. Oliver, Jr., identified these ticks as O. turicata, Florida strain. However, in view of the findings from Mans et al., [43] we accept the suggestion, originally proposed by Beck et al [11] that O. turicata from Florida should be considered as a subspecies, O. turicata americanus. Therefore, throughout the manuscript we have referred to this species as O. turicata americanus. These ticks were housed in the controlled environment chamber (Parameter Generation and Control, Black Mountain, NC) at 23°C with 95% relative humidity and a 14/10 h light/dark photoperiod regiment. All experiments involving animals were performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institute of Health [44]. The protocol used in this study (permit number: 10–018) was approved by the Old Dominion University Institutional Animal Care and Use Committee (Animal Welfare Assurance Number: A3172-01). Unfed larvae, nymphs or adult ticks were fed on 6–8 weeks old CD1 mice (Charles River Laboratories, USA). Before tick placement, animals were tranquilized with acepromazine to minimize distress and/or discomfort prior to or during tick feeding. Upon feeding, repleted ticks were collected and processed for DNA or RNA extractions.
PCR and sequencing
Ornithodoros turicata americanus DNA or cDNA was used as templates for the amplification of 16S rRNA and groEL gene. Following are the published oligonucleotides used for the PCR amplification of 16S rRNA gene (F 5’ TAAGGAGGTAATCCAGCC 3′ and R 5′ CCTGGCTCAGAACGAA 3′) and groEL gene (F 5’ AAAAAAGAAATGTTAGAAGATATTGC 3’ and R 5’ GTACGTACWACTTTAGTTGG 3’) [31, 35]. PCR was performed using the following conditions for the amplification of 16S rRNA gene: initial denaturation at 94 degrees for 5 min followed by 30 cycles of steps including 94 degrees for 1 min, 55 degrees for 1 min, and 72 degrees for 2 min. PCR for groEL gene was performed according to the following protocol: initial denaturation at 95 degrees for 5 min followed by 40 cycles of steps including 95 degrees for 30 sec, 45 degrees for 30 sec, and 72 degrees for 1 min. PCR products were later run on 1.2% agarose gels and corresponding bands (~1500 bp for 16S rRNA gene and ~650 for groEL gene) were purified using Qiagen QIAquick Gel Extraction Kit (Qiagen, Valencia, USA). PCR products were sequenced from both ends at the Simple Seq core facility (Eurofins MWG Operon Inc., Huntsville, USA).
Agarose gel electrophoresis
Agarose (Sigma-Aldrich, St. Louis, USA) was dissolved in 1X TAE (Tris-acetate-EDTA) buffer to make agarose gels in 10-centimeter-long trays. We used 1.2% and 1.5% agarose gels to separate and purify PCR products and QRT-PCR products, respectively. After loading each well with PCR or QRT-PCR reaction mix, electrophoresis was performed for ~30 minutes under 80 V.
Quantitative real-time PCR (QRT-PCR) analysis
QRT-PCR analysis was performed as with CFX OPUS instrument (BioRad, USA) with conditions as described in our previous studies [45–47]. Briefly, total DNA from individual nymphal or adult ticks or pool of eight eggs was extracted with the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Valencia, USA) according to the manufacturer’s instruction. The extracted DNA was used as a template for quantifying the 16S rRNA gene of Occidentia-like species using oligonucleotides (10 μM/reaction) (5’ GTTAGAAGTGAAATCCCGAA 3’ and 5’ GAACTGAAGAAAAGCGTCTCCGC 3’. To normalize the amount of template, O. turicata americanus 28S rRNA gene was quantified as an internal control using oligonucleotides 5’ GATTCCCACTGTCCCTATCTACTATCT 3’ and 5’ GCGACCTCCCACTTATGCTACA 3’. Total RNA from synganglion, ovaries, guts, and salivary glands of adult female ticks was generated using the Bio-Rad Aurum Total RNA Mini Kit (Bio-Rad, Hercules, USA) following the manufacturer’s instruction. RNA was converted to cDNA using Bio-Rad iScript cDNA Synthsis Kit (BioRAD, Hercules, USA). The generated cDNA was used as a template for quantifying the 16S rRNA gene transcripts and Occidentia-like species groEL gene transcripts using the above-mentioned oligonucleotides with the same internal control to normalize the amount of template. The groEL transcripts of Occidentia-like species were quantified using oligonucleotides 5’ CACGCTGCGCTCAGATTCGTGAA 3’ and 5’ CACGATCTTTACGTTCTTTTTGC 3’. The protocol for the preparation of cDNA includes priming at 25 degrees for 5 min, reverse transcription at 46 degrees for 20 min, inactivation of reverse transcriptase at 95 degrees for 1 min and holding at 4 degrees. The same QRT-PCR protocol was used for both genes: initial denaturation at 95 degrees for 3 min, 40 cycles of steps including 95 degrees for 10 sec, 58 degrees for 10 sec, and 72 degrees for 30 sec, and melting curve step from 65 degrees to 95 degrees with a 0.5-degree increment for every 5 sec. QRT-PCR was performed using iQ-SYBR Green Supermix (Biorad, USA). A standard curve was generated using 10-fold serial dilutions starting from 1 ng to 0.00001 ng of known quantities of 16S rRNA, groEL or 28S rRNA fragments.
Sequence alignment and phylogenetic analysis
GenBank accession numbers for the sequences used for 16S rRNA are: Occidentia massiliensis (NR_149220.1), Orientia chuto (NR_117903.1), Orientia tsutsugamushi (AF062074.1), Rickettsia limoniae (AF322442.1), R. bellii (L36103.1), R. prowazekii (NR_044656.2), R. typhi (NR_074394.1), R. massiliae (NR_025919.1), R. slovaca (L36224.1), R. rhipicephali (NR_025921.1), R. monteiroi (NR_133040.1), R. honei (NR_025967.1), R. raoultii (MK304546.1), R. aeschlimannii (NR_026042.1). GenBank accession numbers for the sequences used for groEL are: Occidentia massiliensis (KJ395314.1), Orientia tsutsugamushi (KC485338.2), Orientia chuto (NZ_LANP01000014.1), Rickettsia prowazekii (CP014865.1), R. africae (CP001612.1), R. parkeri (CP003341.1), R. philipii (CP003308.1), R. raoultii (MH932040.1), R. conorii (AE006914.1), R. aeschlimannii (MH932044.1), R. japonica (KY073364.1), R. helvetica (DQ442911.1), R. rickettsii (AJ293326.1) and Buchnera aphidicola (CP034885.1). These sequences were downloaded from GenBank and processed with MegAlign Pro (v17.3.1) by DNASTAR software for the alignment and for the phylogenetic analysis. MAFFT (v6.240) was used as the method for multi-alignment of the sequences selected, using the sequence of both genes of Occidentia-like species as the reference sequence. RAxML (v8.2.12) was used as a maximum likelihood method for the phylogenetic analyses, using 100 iterations for bootstrapping. The substitution model used is GTR plus optimization of substitution rates, plus GAMMA model of rate heterogeneity with estimate of proportion of invariable sites (GTR + GAMMA + I).
Tick dissection
Ornithodoros turicata americanus synganglion, ovaries, gut and salivary gland tissues were dissected from freshly fed individual adult female ticks in sterile 1x phosphate buffer saline. All dissected organs were washed 3 times in sterile 1X PBS and then placed in RNA lysis solution. Soon after dissection, tick salivary glands, synganglion and ovaries were placed in a sterile 1X PBS and washed for an additional three times before placing in RNA lysis solution. Guts were ruptured on a separate slide to release all luminal contents including blood and then washed 3 times in 1x PBS and placed in RNA lysis solution (Bio-Rad Aurum Total RNA Mini Kit, BioRad, USA). All samples were processed for RNA extractions. RNA samples were later converted to cDNA followed by QRT-PCR analysis.
Statistical analysis
All quantitative data were evaluated for statistical analysis using GraphPad Prism 9 software and Microsoft Excel. To compare two means, a non-paired Student’s t test was performed and P values of <0.05 were considered significant. Wherever necessary, statistical test and P values used are reported.
Supporting information
S1 Fig. Nucleotide sequence divergence and percent identity of Occidentia-like species 16S rRNA and groEL with other rickettsial bacteria.
Percent identity (horizontally above black box) and divergence (vertically below black box) of Occidentia-like species 16S rRNA (A) and groEL (B) in comparison to other rickettsial bacteria is shown. Percent identity and divergence was generated based on MAFFT (v6.240) multiple sequence alignment. GenBank accession numbers are provided along with the species names.
https://doi.org/10.1371/journal.pone.0278582.s001
(TIF)
S2 Fig. Sequence analysis of Occidentia-like species 16S rRNA sequence from O. turicata americanus and I. scapularis.
Sequencing chromatograms for Occidentia-like species 16S rRNA from O. turicata americanus (A) and I. scapularis (B) are shown.
https://doi.org/10.1371/journal.pone.0278582.s002
(TIF)
S3 Fig. Sequence of Occidentia-like species 16S rRNA.
The partial nucleotide sequence of Occidentia-like species 16S rRNA obtained by sequencing PCR products with total DNA isolated from adult female O. turicata americanus is shown.
https://doi.org/10.1371/journal.pone.0278582.s003
(TIF)
S4 Fig. Sequence analysis of Occidentia-like species groEL from O. turicata americanus and I. scapularis.
Sequencing chromatograms for Occidentia-like species groEL from O. turicata americanus (A) and I. scapularis (B) is shown.
https://doi.org/10.1371/journal.pone.0278582.s004
(TIF)
S5 Fig. BLAST search performed with groEL sequence form I. scapularis.
BLAST search with groEL sequence from I. scapularis showed sequences related to several Rickettsia with 98–92% identity.
https://doi.org/10.1371/journal.pone.0278582.s005
(TIF)
S6 Fig. Sequence of Occidentia-like species groEL.
The partial nucleotide sequence of Occidentia-like species groEL obtained by sequencing PCR products with total DNA isolated from adult female O. turicata americanus is shown.
https://doi.org/10.1371/journal.pone.0278582.s006
(TIF)
S7 Fig. 16S rRNA sequence from different developmental stages of O. turicata americanus ticks.
Full agarose gel image showing amplification of Occidentia-like species 16S rRNA (A) and O. turicata 28S rRNA (B) in O. turicata americanus nymphs, eggs, adult male and female is shown. C) Representative sequencing chromatograms are shown. Partial gel image is shown in Fig 4A.
https://doi.org/10.1371/journal.pone.0278582.s007
(TIF)
S8 Fig. PCR amplification of 16S rRNA from different O. turicata americanus tissues.
Full agarose gel image showing amplification of Occidentia-like species 16S rRNA and groEL and O. turicata 28S rRNA in O. turicata americanus synganglion (SY), ovaries (OV), guts (MG) and salivary glands (SG) is shown. Partial image is shown in Fig 5A.
https://doi.org/10.1371/journal.pone.0278582.s008
(TIF)
S9 Fig. Sequence analysis of Occidentia-like species 16S rRNA sequence from O. turicata americanus tissues.
Sequencing chromatograms for Occidentia-like species 16S rRNA in O. turicata americanus synganglion (SY), ovary (OV), gut (MG) and salivary glands (SG) is shown.
https://doi.org/10.1371/journal.pone.0278582.s009
(TIF)
S10 Fig. Sequence analysis of Occidentia-like species groEL sequence from O. turicata americanus tissues.
Sequencing chromatograms for Occidentia-like species groEL in O. turicata americanus synganglion (SY), ovary (OV), gut (MG) and salivary glands (SG) is shown.
https://doi.org/10.1371/journal.pone.0278582.s010
(TIF)
Acknowledgments
The following reagent was provided by Centers for Disease Control and Prevention for distribution by BEI Resources, NIAID, NIH: Ixodes scapularis Adult (Live), NR-42510.
References
- 1. Cutler SJ. Relapsing fever—a forgotten disease revealed. J Appl Microbiol. 2010;108(4):1115–22. Epub 20091020. pmid:19886891.
- 2. Dworkin MS, Schwan TG, Anderson DE Jr. Tick-borne relapsing fever in North America. Med Clin North Am. 2002;86(2):417–33, viii-ix. pmid:11982310.
- 3. Estrada-Peña A, Jongejan F. Ticks feeding on humans: a review of records on human-biting Ixodoidea with special reference to pathogen transmission. Exp Appl Acarol. 1999;23(9):685–715. pmid:10581710.
- 4. Lopez JE, McCoy BN, Krajacich BJ, Schwan TG. Acquisition and subsequent transmission of Borrelia hermsii by the soft tick Ornithodoros hermsi. Journal of medical entomology. 2011;48(4):891–5. Epub 2011/08/19. pmid:21845950.
- 5. Golnar AJ, Martin E, Wormington JD, Kading RC, Teel PD, Hamer SA, et al. Reviewing the Potential Vectors and Hosts of African Swine Fever Virus Transmission in the United States. Vector Borne Zoonotic Dis. 2019;19(7):512–24. Epub 20190219. pmid:30785371; PubMed Central PMCID: PMC6602103.
- 6. Hess WR, Endris RG, Haslett TM, Monahan MJ, McCoy JP. Potential arthropod vectors of African swine fever virus in North America and the Caribbean basin. Vet Parasitol. 1987;26(1–2):145–55. pmid:3326244.
- 7. Davis GE. Ornithodoros turicata: The Male; Feeding and Copulation Habits, Fertility, Span of Life, and the Transmission of Relapsing Fever Spirochetes. Public Health Reports (1896–1970). 1941;56(36):1799–802.
- 8. Anderson JF, Magnarelli LA. Biology of ticks. Infect Dis Clin North Am. 2008;22(2):195–215, v. pmid:18452797.
- 9.
Sonenshine DE. The Biology of Tick Vectors of Human Disease. In Tick-Borne Diseases of Human, DTD Jesse L Goodman, Daniel E Sonenshine, Editor American Society for Microbiology: Washington DC. 2005:12–35.
- 10.
Sonenshine DE, Roe R. Biology of Ticks, Second Edition. Oxford University Press. 2014;2.
- 11. Beck AF, Holscher KH, Butler JF. Life cycle of Ornithodoros turicata americanus (Acari: Argasidae) in the laboratory. Journal of medical entomology. 1986;23(3):313–9. pmid:3735335.
- 12. Laukaitis HJ, Macaluso KR. Unpacking the intricacies of Rickettsia-vector interactions. Trends Parasitol. 2021;37(8):734–46. Epub 2021/06/25. pmid:34162522; PubMed Central PMCID: PMC8344978.
- 13. Noda H, Munderloh UG, Kurtti TJ. Endosymbionts of ticks and their relationship to Wolbachia spp. and tick-borne pathogens of humans and animals. Appl Environ Microbiol. 1997;63(10):3926–32. Epub 1997/11/05. pmid:9327557; PubMed Central PMCID: PMC168704.
- 14. Karim S, Kumar D, Budachetri K. Recent advances in understanding tick and rickettsiae interactions. Parasite Immunol. 2021;43(5):e12830. Epub 2021/03/14. pmid:33713348; PubMed Central PMCID: PMC8058325.
- 15. Parola P, Paddock CD, Raoult D. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev. 2005;18(4):719–56. Epub 2005/10/15. pmid:16223955; PubMed Central PMCID: PMC1265907.
- 16. Ponnusamy L, Gonzalez A, Van Treuren W, Weiss S, Parobek CM, Juliano JJ, et al. Diversity of Rickettsiales in the microbiome of the lone star tick, Amblyomma americanum. Appl Environ Microbiol. 2014;80(1):354–9. Epub 2013/10/29. pmid:24162580; PubMed Central PMCID: PMC3910995.
- 17. Bonnet SI, Binetruy F, Hernandez-Jarguin AM, Duron O. The Tick Microbiome: Why Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission. Front Cell Infect Microbiol. 2017;7:236. Epub 2017/06/24. pmid:28642842; PubMed Central PMCID: PMC5462901.
- 18. Hussain S, Perveen N, Hussain A, Song B, Aziz MU, Zeb J, et al. The Symbiotic Continuum Within Ticks: Opportunities for Disease Control. Front Microbiol. 2022;13:854803. Epub 20220317. pmid:35369485; PubMed Central PMCID: PMC8969565.
- 19. Tahir D, Socolovschi C, Marie JL, Ganay G, Berenger JM, Bompar JM, et al. New Rickettsia species in soft ticks Ornithodoros hasei collected from bats in French Guiana. Ticks Tick Borne Dis. 2016;7(6):1089–96. Epub 2016/09/19. pmid:27639932.
- 20. Perlman SJ, Hunter MS, Zchori-Fein E. The emerging diversity of Rickettsia. Proc Biol Sci. 2006;273(1598):2097–106. pmid:16901827; PubMed Central PMCID: PMC1635513.
- 21. Burgdorfer W, Brinton LP, Hughes LE. Isolation and characterization of symbiotes from the Rocky Mountain wood tick, Dermacentor andersoni. J Invertebr Pathol. 1973;22(3):424–34. pmid:4202564.
- 22. Rounds MA, Crowder CD, Matthews HE, Philipson CA, Scoles GA, Ecker DJ, et al. Identification of endosymbionts in ticks by broad-range polymerase chain reaction and electrospray ionization mass spectrometry. Journal of medical entomology. 2012;49(4):843–50. pmid:22897044; PubMed Central PMCID: PMC3535486.
- 23. Childs JE, Paddock CD. Passive surveillance as an instrument to identify risk factors for fatal Rocky Mountain spotted fever: is there more to learn? Am J Trop Med Hyg. 2002;66(5):450–7. pmid:12201575.
- 24. Kagemann J, Clay K. Effects of infection by Arsenophonus and Rickettsia bacteria on the locomotive ability of the ticks Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis. Journal of medical entomology. 2013;50(1):155–62. pmid:23427665.
- 25. Ahantarig A, Trinachartvanit W, Baimai V, Grubhoffer L. Hard ticks and their bacterial endosymbionts (or would be pathogens). Folia Microbiol (Praha). 2013;58(5):419–28. Epub 20130122. pmid:23334948.
- 26. Macaluso KR, Sonenshine DE, Ceraul SM, Azad AF. Rickettsial infection in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of a second Rickettsia. Journal of medical entomology. 2002;39(6):809–13. pmid:12495176.
- 27. Carmichael JR, Fuerst PA. A rickettsial mixed infection in a Dermacentor variabilis tick from Ohio. Ann N Y Acad Sci. 2006;1078:334–7. pmid:17114734.
- 28. Bonnet SI, Pollet T. Update on the intricate tango between tick microbiomes and tick-borne pathogens. Parasite Immunol. 2021;43(5):e12813. Epub 20201220. pmid:33314216.
- 29. Mediannikov O, Nguyen TT, Bell-Sakyi L, Padmanabhan R, Fournier PE, Raoult D. High quality draft genome sequence and description of Occidentia massiliensis gen. nov., sp. nov., a new member of the family Rickettsiaceae. Stand Genomic Sci. 2014;9:9. Epub 20141208. pmid:25780502; PubMed Central PMCID: PMC4334944.
- 30. Moustafa MAM, Mohamed WMA, Lau ACC, Chatanga E, Qiu Y, Hayashi N, et al. Novel symbionts and potential human pathogens excavated from argasid tick microbiomes that are shaped by dual or single symbiosis. Comput Struct Biotechnol J. 2022;20:1979–92. Epub 2022/05/07. pmid:35521555; PubMed Central PMCID: PMC9062450.
- 31. Hornok S, Kontschán J, Takács N, Chaber A-L, Halajian A, Szekeres S, et al. Rickettsiaceae in two reptile-associated tick species, Amblyomma exornatum and Africaniella transversale: First evidence of Occidentia massiliensis in hard ticks (Acari: Ixodidae). Ticks and Tick-borne Diseases. 2022;13(1):101830. pmid:34624588
- 32. Kumar D, Downs LP, Adegoke A, Machtinger E, Oggenfuss K, Ostfeld RS, et al. An Exploratory Study on the Microbiome of Northern and Southern Populations of Ixodes scapularis Ticks Predicts Changes and Unique Bacterial Interactions. Pathogens. 2022;11(2). Epub 2022/02/27. pmid:35215074; PubMed Central PMCID: PMC8880235.
- 33. Mumcuoglu KY, Arslan-Akveran G, Aydogdu S, Karasartova D, Kosar N, Gureser AS, et al. Pathogens in ticks collected in Israel: I. Bacteria and protozoa in Hyalomma aegyptium and Hyalomma dromedarii collected from tortoises and camels. Ticks Tick Borne Dis. 2022;13(1):101866. Epub 2021/11/20. pmid:34798529.
- 34. Hensley JR, Zambrano ML, Williams-Newkirk AJ, Dasch GA. Detection of Rickettsia Species, and Coxiella-Like and Francisella-Like Endosymbionts in Amblyomma americanum and Amblyomma maculatum from a Shared Field Site in Georgia, United States of America. Vector Borne Zoonotic Dis. 2021;21(7):509–16. Epub 2021/05/07. pmid:33956519.
- 35. Phan JN, Lu CR, Bender WG, Smoak RM 3rd, Zhong J. Molecular detection and identification of Rickettsia species in Ixodes pacificus in California. Vector Borne Zoonotic Dis. 2011;11(7):957–61. Epub 20110317. pmid:21413886; PubMed Central PMCID: PMC3129645.
- 36. Weinert LA, Werren JH, Aebi A, Stone GN, Jiggins FM. Evolution and diversity of Rickettsia bacteria. BMC Biol. 2009;7:6. Epub 2009/02/04. pmid:19187530; PubMed Central PMCID: PMC2662801.
- 37. Weinert LA, Araujo-Jnr EV, Ahmed MZ, Welch JJ. The incidence of bacterial endosymbionts in terrestrial arthropods. Proc Biol Sci. 2015;282(1807):20150249. Epub 2015/04/24. pmid:25904667; PubMed Central PMCID: PMC4424649.
- 38. Allan BF, Goessling LS, Storch GA, Thach RE. Blood meal analysis to identify reservoir hosts for Amblyomma americanum ticks. Emerg Infect Dis. 2010;16(3):433–40. Epub 2010/03/06. pmid:20202418; PubMed Central PMCID: PMC3322017.
- 39. Lynn GE, Oliver JD, Nelson CM, Felsheim RF, Kurtti TJ, Munderloh UG. Tissue distribution of the Ehrlichia muris-like agent in a tick vector. PLoS One. 2015;10(3):e0122007. Epub 2015/03/18. pmid:25781930; PubMed Central PMCID: PMC4363788.
- 40. Radford SE. GroEL: More than Just a folding cage. Cell. 2006;125(5):831–3. Epub 2006/06/06. pmid:16751091.
- 41. Sassera D, Lo N, Bouman EA, Epis S, Mortarino M, Bandi C. "Candidatus Midichloria" endosymbionts bloom after the blood meal of the host, the hard tick Ixodes ricinus. Appl Environ Microbiol. 2008;74(19):6138–40. Epub 2008/08/12. pmid:18689508; PubMed Central PMCID: PMC2565945.
- 42. Sonenshine DE, Stewart PE. Microbiomes of Blood-Feeding Arthropods: Genes Coding for Essential Nutrients and Relation to Vector Fitness and Pathogenic Infections. A Review. Microorganisms. 2021;9(12). Epub 2021/12/25. pmid:34946034; PubMed Central PMCID: PMC8704530.
- 43. Mans BJ, Featherston J, Kvas M, Pillay KA, de Klerk DG, Pienaar R, et al. Argasid and ixodid systematics: Implications for soft tick evolution and systematics, with a new argasid species list. Ticks Tick Borne Dis. 2019;10(1):219–40. Epub 2018/10/13. pmid:30309738.
- 44.
National Research Council (U.S.). Committee for the Update of the Guide for the Care and Use of Laboratory Animals., Institute for Laboratory Animal Research (U.S.), National Academies Press (U.S.). Guide for the care and use of laboratory animals. Washington, D.C.: National Academies Press,; 2011. Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050, ebrary http://site.ebrary.com/id/10443276, National Academies Press http://www.nap.edu/catalog.php?record_id=12910, National Academies Press http://www.nap.edu/catalog.php?record_id=12910#toc, http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=nap12910, http://grants.nih.gov/grants/olaw/Guide-for-the-Care-and-use-of-laboratory-animals.pdf.
- 45. Taank V, Dutta S, Dasgupta A, Steeves TK, Fish D, Anderson JF, et al. Human rickettsial pathogen modulates arthropod organic anion transporting polypeptide and tryptophan pathway for its survival in ticks. Sci Rep. 2017;7(1):13256. Epub 20171016. pmid:29038575; PubMed Central PMCID: PMC5643405.
- 46. Ramasamy E, Taank V, Anderson JF, Sultana H, Neelakanta G. Repression of tick microRNA-133 induces organic anion transporting polypeptide expression critical for Anaplasma phagocytophilum survival in the vector and transmission to the vertebrate host. PLoS Genet. 2020;16(7):e1008856. Epub 20200702. pmid:32614824; PubMed Central PMCID: PMC7331985.
- 47. Khanal S, Taank V, Anderson JF, Sultana H, Neelakanta G. Rickettsial Pathogen Perturbs Tick Circadian Gene to Infect the Vertebrate Host. Int J Mol Sci. 2022;23(7). Epub 20220324. pmid:35408905; PubMed Central PMCID: PMC8998576.