Ribo-Seq and RNA-Seq of TMA46 (DFRP1) and GIR2 (DFRP2) knockout yeast strains

Yeast strains, cell maintenance, RNA-Seq and Ribo-Seq library preparation

RNA-Seq and Ribo-Seq сDNA libraries were prepared from total RNA samples or ribosome-bound RNA samples, respectively, for the wild-type BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0) yeast strain and five knockout strains. The data were obtained in two independent series. The first one included the wild-type BY4742 yeast strain (wt) and strains with individually deleted YGR054W (eIF2A), STM1, and TMA46 genes, which were obtained from the Yeast Gene Deletion Collection.¹³ The second one included the wild-type BY4742 yeast strain and strains lacking GIR2 and PUB1, which were created during this study. KanMX disruption cassettes were obtained via polymerase chain reaction (PCR) using the primers (GIR2 - 5′-CAATTGTAAAATCAGCAGGCA-3′; 5′-AAACTTGTCTATTTCCTTCTTC-3′; PUB1 - 5′-TTGTCCTTCATTTTCCTCTCGT-3′; 5′-AGGCCCTTTTATTTTTCGAGC-3′) and genomic DNA of the corresponding deletion collection strains as a template. Phusion HF polymerase (TFS F-530L) was used as recommended by the supplier. PCR protocol: 95°С – 5 min, [95°С – 30 sec, 64°С – 30 sec, 72°С – 60 sec] x 28 cycles, 72°С – 90 sec. The resulting cassettes were used to transform the BY4742 strain. The correctness of the integration was checked using pairs of verification primers (GIR2-5′-GAAAAAGAAAGAAGAAAAATTTGGG-3′; PUB1-5′-ACGACCACAAAGGATCCAGGGCTT-3′; Universal primer inside the KanMX cassette - 5′-CTGCAGCGAGGAGCCGTAAT-3′).

Here we focus on wt, tma46Δ, and gir2Δ strains. The data from the other strains were used to correct for batch effects within each series. The libraries were sequenced, resulting in 31 RNA-Seq and 28 Ribo-Seq data sets, including 18 RNA-Seq and 16 Ribo-Seq data sets for wt, gir2Δ, and tma46Δ strains. Supplementary Table 1 in the Extended data¹⁴ summarizes information about the sequencing experiments.

The experimental procedure followed the ribosome profiling protocol described in.¹⁵ Briefly, yeast cells were grown to exponential phase (OD = 0.5-0.6) in yeast extract peptone dextrose (YPD) media (1% yeast extract, 2% peptone, 2% glucose). Cells were harvested by filtration, scraped into liquid nitrogen, and ground using a liquid nitrogen-cooled mortar and pestle with drop-by-drop addition of polysome lysis buffer (20 mM Tris-HCl pH 8.0, 140 mM KCl, 1.5 mM MgCl₂, 0.1 mg/ml cycloheximide, 1% Triton). Cell lysates were clarified by two sequential centrifugation steps - 3000g, 5 minutes, 4°С, and 20000g, 10 minutes, 4°С. The cell lysate was partially used for mRNA isolation using oligo (dT) beads. Another portion was treated with ribonuclease I for polysome disassembly and applied to a linear 10-50% sucrose gradient in fractionation buffer (20 mM Tris pH 8.0, 140 mM KCl, 15 mM MgCl₂, 1 mM DTT, 0.1 mg/ml cycloheximide, 1% Triton) and separated on a SW-41 rotor (Beckman) at 35000 rpm, 3 hours, 4°С. Subsequently, ribosome-bound RNA fragments were collected from the monosome fraction. Ribosome-bound RNA was isolated using acidic-phenol extraction. Further Ribo-Seq and RNA-Seq library preparations were performed as described previously.¹²

Sequencing data processing and analysis

Reads were trimmed using cutadapt v. 2.10¹⁶ with the following parameters for RNA-Seq (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC –minimum-length 20 -q 20) and Ribo-Seq samples (-a CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC –trimmed-only -q 20). Additionally, for Ribo-Seq, the reads were deduplicated with seqkit rmdup v. 0.10.1,¹⁷ and unique barcodes were then removed with cutadapt v. 2.10 (-q 20 –minimum-length 20 -u -4). Afterwards, reads were aligned against eukaryotic rRNA sequence set obtained from silva-euk¹⁸ and rfam¹⁹ databases using bowtie2 v. 1.2.3.²⁰ Only unmapped non-rRNA reads were used in the further analysis. Read mapping and counting against the Saccharomyces_cerevisiae.R64-1-1.95 (Ensembl)²¹ genome assembly was performed with STAR v. 2.7.9a.²² We estimated the position of the P-site for each dataset from the 5′ end of the reads on the basis of the length of each footprint using plastid v0.5.1.²³ Fraction of reads in each phase and read length distribution were also obtained with plastid, see Figure S1 in the Extended data.²⁴ The results show that almost 90% 28nt reads are in 0 phase through the annotated coding sequences (CDSs). Then we produced BedGraph profiles from SAM data with samtools v. 1.10²⁵ and bedtools v2.27.1.²⁶ Coverage profiles were normalized using normalization factor and library size estimates from differential expression analysis (see below) separately for each bedGraph profile. Finally, we visualized coverage tracks in the modified genomic loci using svist4get.²⁷ Figure S2 in the Extended data²⁴ shows that the read counts originating from the mRNA encoded by the knockout gene in the corresponding strain are negligible. The coverage of the neighboring genes remains unaltered, i.e. there are no indications of the so-called neighboring gene effect (NGE).²⁸

Differential expression and Gene Ontology (GO) enrichment analysis

Statistical analyses were performed in R v. 4.1.2 using edgeR Bioconductor package.²⁹ As mentioned above, the data were produced in two independent series which were analyzed separately. Genes not reaching 10 read count per million (CPM) in at least 4 RNA-Seq and 4 Ribo-Seq libraries were excluded from the analysis. Then, we performed the batch correction using ComBat-seq R package.³⁰ Principal component analysis (PCA) plots of the raw and batch corrected expression profiles are shown in Figure S3 in the Extended data.²⁴ A generalized linear model (glmQLFit, glmQLFTest of the edgeR package) was used to detect differentially expressed genes (for RNA-Seq, Ribo-Seq, and ribosome occupancy (RO) defined as the Ribo-Seq coverage of a CDS normalized to its RNA-Seq coverage) with the strain as a categorical variable. The false discovery rate (FDR < 0.05) was used for identification of differential expressed genes. We also performed Gene Ontology (GO) enrichment analysis for upregulated and downregulated genes with yeastmine.³¹ The results are shown in Figure 1.

Figure 1. Differential gene expression upon deletions of GIR2 and TMA46.

(A) Total number of differentially expressed genes (passing FDR < 0.05) in each test. (B) and (C) Scatter plots illustrating expression changes at the level of transcription (X-axis, RNA-Seq) and translation (Y-Axis, Ribo-Seq) in the gir2Δ and tma46Δ strains, respectively. Translationally upregulated or downregulated (FDR < 0.05) genes marked in pink/blue, respectively. (D-G) Results of Gene Ontology (GO) enrichment analysis of RNA-Seq (D-E) and ribosome occupancy (RO) (F-G) considering upregulated (D, F) and downregulated (E, G) genes in gir2Δ vs. wt comparison. The numbers of differentially expressed genes with particular GO terms are shown in labels. X-axes show the enrichment P-value in log-scale.

Underlying data

NCBI Gene Expression Omnibus: RNA Sequencing and Ribosome profiling of TMA46, STM1 and YGR054W knockout yeast strains. Accession number GSE185458; https://identifiers.org/geo:GSE185458.

NCBI Gene Expression Omnibus: RNA Sequencing and Ribosome profiling of GIR2 and PUB1 knockout yeast strains. Accession number GSE185286; https://identifiers.org/geo:GSE185286.

Extended data

Figshare: Supplementary Table 1.csv https://doi.org/10.6084/m9.figshare.16818505.¹⁴

This project contains the following extended data:

Figshare: Supplementary Figures. https://doi.org/10.6084/m9.figshare.16818610.v1.²⁴

Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).