Vitellogenin family gene expression does not increase Drosophila lifespan or fecundity

Drosophila stocks and maintenance

The GeneSwitch driver strain S106 (w¹¹¹⁸; P{Switch1}106) and UAS-GFP strain (P{UAS-GFP.VALIUM10}attP2) were obtained from Bloomington Drosophila Stock Center. To control for position effects, we used two different transgenic strains for both Vg and CG31150, with the transgene inserted onto different chromosomes: CG31150-2 (w¹¹¹⁸, UAS-CG31150-2/FM6), CG31150-4 (w¹¹¹⁸, UAS-CG31150-4/TM3), Vg-1 (w¹¹¹⁸, UAS-Apis VGD13-1/FM6), Vg-2 (w¹¹¹⁸, UAS-Apis VGD13-2/TM3). These constructs were created by Eric Spana at the Duke University Model Systems Genomics Core Facility as follows. For the Vg constructs, four cDNAs were identified as Apis Vg from database searches, and obtained from RIKEN. All four were sequenced on both strands, and one, BH10008D13 was chosen for subsequent cloning as it matched the published sequence best. Site directed mutagenesis was used to remove an ATG from the parental cloning vector (CATTATACGAAGTTAGGGATCAGGCCAAATCGGCCG where the underlined G marks the nucleotide that was changed from a T) so that a NotI/KpnI double digest would excise the Vg cDNA from the vector and not contain an incorrect start codon. The NotI/KpnI fragment was then ligated into a NotI/KpnI linearized pUAST. The subsequent clone was verified by sequencing on both strands, and pUAST-Apis_Vg was then transformed into Drosophila as described below. For the CG31150 constructs, cDNA GH05619 was available in the “Gold Clone” collection and was obtained from Robin Wharton (Duke University Medical Center). The cDNA was excised from GH05619 using EcoRV & XhoI and ligated into pUAST that had been digested by EcoRI, filled in with Klenow to make a blunt end, and then digested with XhoI to make compatible ends with the insert. The pUAST-CG31150 plasmid insert was sequenced on both strands. pUAST-Apis Vg and pUAST-CG31150 plasmid inserts were transformed into w¹¹¹⁸ by Model System Genomics of Duke University by standard techniques. All transgenic flies were mapped and balanced. Transgene sequences are shown in Supplementary Table S1.

Overexpression of the target gene in each of the four genotypes was achieved by crossing each transgenic stock with the GeneSwitch strain S106. Strain S106 drives expression specifically in the fat body and also in the digestive system³². This driver has been widely used in aging studies; for example, over-expression of dfoxo and dilp6 using this driver have been shown to increase lifespan^36,37. To produce female flies that expressed the target transgene, virgin females from the S106 stock were crossed to males from each of the UAS-transgenic strains. Half of the female offspring from this cross were reared with RU486-supplemented media throughout adult life (see below), thus inducing transgene expression, but only during the adult stage. The remaining females from each cross were reared on media supplemented only with RU486 vehicle (ethanol), and should not have expressed the transgene. Therefore each group of flies that expressed one of the target transgenes had a genotype-matched control that differed only with respect to whether or not it was fed RU486 or vehicle.

To determine if RU486 exposure (or the GAL4 expression it induced) caused any change in lifespan or fecundity in these flies, we used an additional set of controls. We crossed the S106 driver strain to UAS-GFP flies, and exposed half of the female offspring to RU486 and half only to the ethanol vehicle. GFP is widely used as a reporter in D. melanogaster, and is believed to be non-toxic and not to influence endogenous gene expression at any stage during fly development³⁸. Flies were kept on a 12:12 light: dark cycle at 25°C for their entire lifespan.

Media preparation

An RU486 (Mifepristone, Sigma, St. Louis, MO, USA) stock solution of 25mg/ml was made in 100% ethanol. Appropriate volumes of the stock were diluted with water to reach a final concentration of 65µg/ml, and 300µl of the diluted solution was added onto the surface of standard fly food (1.6% yeast, 0.92% soy flour, 6.76% cornmeal, 4.28% malt, 0.61% agar, 0.25% tegosept, 7.12% corn syrup, 0.61% propionic acid and 77.85% water).

Similar drug concentration and delivery methods have been widely used in aging studies^32,35,36, and our pilot data indicated that this concentration produced robust expression levels in the range that we desired (5–15 fold increase over non-induced controls). For the control food, an equal amount of 100% ethanol was diluted with water and added to the surface of standard fly food. Each type of food was made fresh twice per week. The vials were allowed to air dry for 48 hours prior to each transfer.

Lifespan assay

For each genotype tested, female offspring were collected within 24 hours of emergence and split equally into experimental and control groups. For each genotype, 96 females were reared on media supplemented with RU486, and 96 were reared on control media. Flies were housed in standard rearing vials (VWR) at a density of 6 females per vial. All rearing vials were placed randomly in 10 × 10 vial racks to control for possible position effects. The flies were transferred to new media twice per week, and were counted nearly every day. In addition, 3 replicates of 10 females each from each treatment group per genotype were collected separately to be assayed for target gene expression. For these replicates, flies were sampled at 7 days post eclosion; GFP/S106 flies were examined for GFP expression using Zeiss LSM 5 PASCA fluorescent microscopy (Zeiss, Germany), and Vg/S106 and CG31150/S106 flies were flash frozen on dry ice for quantitative PCR assays.

Fecundity assay

Females described above were placed in vials with males from a wild-type laboratory strain (described Remolina et al.³⁹) when the females were 1 day old. 6 virgin females and 4 males were placed into each vial. The males were removed after 3 days, and females were transferred to new vials. Flies were transferred twice per week. After each transfer, the old vials were kept at 25°C, and all offspring eclosing within 14 days after the adults were removed and counted.

Quantitative PCR

For each genotype, we pooled 10 flies from each replicate and homogenized whole flies using cordless motors (VWR) and RNase-free pellet pestles (Kimbel Chase). Total RNA was extracted from whole bodies using a PicoPure RNA isolation kit (Arcturus), according to the manufacturer's recommended protocol. RNA purity and quantity were measured using a Nanodrop spectrophotometer (Thermo Scientific). RNA was DNase-treated with a DNA-free RNA kit (Zymo Research) and reverse transcribed using the Superscript III (Invitrogen). We conducted qRT-PCR using SYBR green master mix (Applied Biosystems), and ribosomal gene Rp49 as an endogenous control. The primer sequences were:

Rp49: F ‘TCGAACCAGGCGGGCATATTGT’, R ‘TCGAACCAGGCGGGCATATTGT’;

Vg: F ‘AGCTGGTCGGGGCTACGTCC’, R ‘TAAGGGCGTCGGAGGGGACC’;

CG31150: F ‘ACGGACACCGACTTCTGTCCCA’, R ‘TCGAACCAGGCGGGCATATTGT’

For transgenic GFP flies (UAS-GFP/S106), expression of GFP was assessed by fluorescent microscopy.

Statistical analysis

For each transgenic line, we compared Kaplan–Meier (product-limit) survival estimates between RU486- and vehicle-fed flies by using log-rank and generalized Wilcoxon chi-square tests of the homogeneity of survival functions between groups. These tests were conducted using JMP Pro 10 statistical software (SAS Institute Inc., Cary, North Carolina, United States). Log-rank tests are more sensitive to survival differences that occur late in life while Wilcoxon tests are more sensitive to differences earlier in life⁴⁰. Results of both tests were consistent in all the analyses reported here, so we report only the log-rank test results. To determine if activation of transgene expression by RU486 had different effects in different genotypes, we use used Cox proportional hazard models with predictor variables that included genotype, RU486 treatment, and genotype-by-treatment interaction. A significant interaction in this model would indicate that genotypes responded differently to RU486 treatment. These tests were conducted using the phreg procedure of SAS v. 9.3. Flies that died accidentally or escaped during transfers were recorded as censored on the day they died or escaped. For fecundity assays, the mean age-specific fecundity for each vial was calculated by dividing the number of offspring by the number of female parents alive in the vial. We then compared fecundity among genotypes and treatment groups using repeated-measures ANOVA of mean fecundity, with age of the females as the repeated measure. These analyses were conducted in JMP Pro 10.

Quantitative PCR confirmed that Vg and CG31150 were overexpressed by the GeneSwitch system

Flies carrying S106 GAL4 driver and each of the target genes, Vg-1, Vg-2, CG31150-2, CG31150-4, that were fed on RU486 had a >5 fold increase in target mRNA expression compared with their genetically matched controls (Table 1). In addition, all 30 GFP/S106 flies that were fed on RU486 showed fluorescent green under the fluorescent microscope while none of their genetically matched controls did (data not shown).

Increasing Vg and CG31150 expression does not extend lifespan in Drosophila

To test whether Vg or CG31150 overexpression affected lifespan in Drosophila, we examined survival of flies with overexpression of Apis Vg and Drosophila CG31150. Contradictory to the hypothesis that an increase in the target gene expression would increase lifespan, we observed no significant differences between control and overexpression flies for any of the four experimental genotypes tested (Table 2, Figure 1a–1d). A proportional-hazards model indicated that there were no significant differences among the four Vg and CG31150 genotypes in their response to transgene activation (χ² = 0.97, df=3, p=0.81 for genotype-by-RU486 treatment interaction). As an additional control, we assessed whether the RU486 treatment itself was associated with changes in lifespan by comparing RU486-fed and vehicle-fed UAS-GFP/S106 flies. Surprisingly, the RU486-fed flies had a significantly longer lifespan than the controls in this comparison, indicating that RU486 itself (or the GAL4 expression induced by it) had a positive effect on lifespan in this assay (Table 2, Figure 1e). Thus, the lack of lifespan-extending effects of Vg and CG31150 transgene expression were not due to confounding effects of the method of induction because this method appeared to increase, rather than decrease lifespan in this experiment.

Figure 1. Survival curves for flies either fed RU486 (red) or vehicle only (black, control).

No significant lifespan difference was observed between Vg or CG31150 overexpressed flies and their genetically matched control (a–d). The negative control GFP/S106 had significantly longer lifespan when fed with RU486 (e).

To determine if transgene expression had any effect on lifespan in the Vg and CG31150 lines, after accounting for the lifespan-extending effects of RU486 exposure, we compared the effects of RU486 across all genotypes. Proportional hazards models indicated that there was significant heterogeneity among genotypes in their response to RU486 treatment overall (χ² = 11.2, df=4, p=0.02), with RU486 exposure associated with significantly higher mortality in the Vg and CG3115 transgenic flies than in the GFP transgenic flies in each pairwise comparison (χ² = 6.5, df=1, p=0.01, hazard ratio = 1.77 for CG31150-2 vs GFP; χ² = 7.8, df=1, p=0.005, hazard ratio = 1.85 for CG31150-4 vs GFP; χ² = 8.23, df=1, p<0.005, hazard ratio = 1.87 for Vg-1 vs GFP; χ² = 4.0, df=1, p<0.05, hazard ratio = 1.56 for Vg-2 vs GFP). These results suggest that Vg and CG31550 transgene over-expression decrease fly lifespan because (1) GFP over-expression is unlikely to increase lifespan, and in one study was shown to decrease lifespan⁴¹, and (2) if transgene expression had no effect in Vg and CG31550 lines, we should have observed a similar increase in lifespan in the RU486-fed flies driven solely by lifespan-extending effects of RU486 and/or GAL4 expression.

Increasing Vg and CG31150 expression does not increase fecundity in Drosophila

To investigate whether overexpression of Vg or CG31150 increased fecundity in Drosophila, we compared age-specific and lifetime fecundity between flies overexpressing these genes and genetically matched controls. We observed a significant overall reduction in fecundity of the RU486-fed flies in all UAS/S106 genotypes, including the control genotype GFP/S106 (Table 3, Figure 2). The difference between treatments was greatest during mid-life at ages of peak egg-laying, and less at early and late ages (significant age-by-treatment effects were observed in every genotype, Table 3, Figure 2).

Figure 2. Fecundity experiments on flies either fed on +RU486 (blue) or –RU486 (red).

For all of the 5 genotypes tested, the overexpression flies had lower lifetime fecundity than the control. Age × treatment effects were also significant for all phenotypes.

In two-way ANOVA models that included all genotypes, there was no significant genotype-by-treatment interaction (F=0.111, df=4,149, p=0.978) indicating that all transgenic lines, including GFP/S106, responded similarly to RU486 exposure. It therefore appears likely that the decline in fecundity in transgene-expressing flies is caused by RU486 itself or by the expression of GAL4, rather than target-gene overexpression.