Keywords
Hepatitis B virus (HBV); vaccine; adjuvants; CpG ODNs
-
Views
-
Downloads
How to cite this article
ADEDJOBI TKSN, Kariuki D and Kimotho J. Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces stronger immune response in BALB/c mice [version 1; peer review: awaiting peer review]. F1000Research 2024, 13:404 (https://doi.org/10.12688/f1000research.145766.1)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Export Citation
Sciwheel
EndNote
Ref. Manager
Bibtex
ProCite
Sente
▬
✚
Research Article
Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces stronger immune response in BALB/c mice
[version 1; peer review: awaiting peer review]
PUBLISHED 26 Apr 2024
OPEN PEER REVIEW
REVIEWER STATUS
Abstract
Corresponding author:
Titilayo Kemi Sophia Nelly ADEDJOBI
Competing interests:
No competing interests were disclosed.
Grant information:
This research was funded by the African Union through the Pan African University Institute for Basic Sciences, Technology, and Innovation (PAUISTI).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Copyright:
© 2024 ADEDJOBI TKSN et al.
This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
How to cite: ADEDJOBI TKSN, Kariuki D and Kimotho J. Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces stronger immune response in BALB/c mice [version 1; peer review: awaiting peer review]. F1000Research 2024, 13:404 (https://doi.org/10.12688/f1000research.145766.1)
First published: 26 Apr 2024, 13:404 (https://doi.org/10.12688/f1000research.145766.1)
Latest published: 26 Apr 2024, 13:404 (https://doi.org/10.12688/f1000research.145766.1)
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
1. Introduction
Infectious diseases pose a significant threat to human health.1 The etiological agent of both acute and chronic hepatitis B virus infections in humans is the Hepatitis B Virus (HBV), a partly double-stranded hepatotropic DNA virus. After six months of infection, serum Hepatitis B Surface Antigen (HBsAg; the viral glycoprotein) indicates a chronic HBV infection.2 Currently, about 250 million people have chronic HBV infection globally, and every year, almost 800,000 people die from liver illnesses linked to HBV.3 African regions have the highest prevalence of chronic HBV infection.2 According to a dashboard from the World Health Organization, over 91 million Africans have Hepatitis B or C infections and almost 70% of all HBV infections occur there (WHO Africa, 2021). Although antiviral medications have advanced, primary prevention by immunization remains the most effective and cost-efficient public health intervention.4 The introduction of immunization has greatly reduced the prevalence and death rate of infectious diseases.1 Therefore, the best method to prevent HBV infection is vaccination.
There are certain drawbacks to the current HBV vaccine. The delivery of recombinant HBV vaccines to nations where infection is widespread is a challenge because of the high cost of vaccine production and a small percentage of vaccine recipients are not developing protective immunity even after receiving more than the recommended three doses of the vaccine.5 Also, in the five years following immunization, 8-42% of those who had protective antibodies lost immunity.6
Adjuvants are added to vaccines to stabilize and increase the potential of triggering a strong immune response.7 They have been shown to reduce the amount of antigen needed to trigger a particular degree of immunological response.8 For example, MF59 increased the effectiveness of the flu vaccine by 5-8 times.9 Based on their characteristics, adjuvants can be divided into several groups, such as those that are based on aluminum salts, oil emulsions, or toll-like receptor (TLR) agonists.8 Synthetic CpG Oligodeoxynucleotides (ODNs) show promise as adjuvants in vaccines.10 Typically, they are single-stranded DNA molecules synthesized with specific sequence settings, notably containing unmethylated CpG dinucleotides, known as CpG motifs.11 They can trigger an innate immune response in cells expressing TLR9, such as human plasmacytoid dendritic cells and B cells, resulting in the production of T helper 1 cells and proinflammatory cytokines.12 In addition to being potent vaccine adjuvants, synthetic CpG oligodeoxynucleotides (CpG ODNs) are TLR9 agonists and mimic the function of naturally occurring CpG motifs found in bacterial DNA.8 Alongside boosting the function of proficient antigen-presenting cells like B cells, macrophages, dendritic cells, T cells, and natural killer cells, the simultaneous administration of CpG ODNs with vaccines facilitates the augmentation of both humoral and cellular immune responses targeted towards the vaccine. Furthermore, it enhances the efficacy of specialized antigen-presenting cells.13 Recent studies have consistently shown that CpG ODN serves as a more potent Th1-like adjuvant in comparison to the “gold standard,” complete Freund’s adjuvant (CFA). This superiority is evident in its ability to enhance the development of cytotoxic T lymphocytes (CTL) and T cells that secrete interferon (IFN). Furthermore, other research has indicated that CpG ODN can achieve heightened levels of antigen-specific activation without eliciting the severe local inflammatory reactions associated with CFA.14
This study established the effects of CpG ODNs adjuvanted HBV vaccine on immunological response in BALB/c mice.
2. Methods
2.1 Study approval
Ethical clearance was granted by the Mount Kenya University Review Committee (Approval number 2196 on 16th of September 2023) and approval to carry out this study was obtained from KEMRI- Animal Care and Use Committee (KEMRI-ACUC/03.07.2023 on 28th of July 2023). All animal experimentation adhered to the national and international standards as approved by the KEMRI-Animal Care and Use Committee and as specified in the above protocol number. The Engerix B vaccine was solely utilized for research purposes in this study and was neither altered nor commercialized.
2.2 Animal model
Female BALB/c mice, weighing 20 ± 2 grams each, were purchased from the Institute of Primate Research (IPR) in Kenya. The mice acclimated for seven (7) days in a standard facility at KEMRI, during which they were provided with commercial pellets for food and had unrestricted access to water. Every effort was made to adhere to the principles of the 3Rs (replacement, reduction, and refinement) to minimize their injury and suffering.15
2.3 Sample stratification and immunization
This study was conducted at KEMRI, Innovation & Technology Transfer Division (ITTD) and followed a laboratory-based experimental study. The sample size was determined using the “resource equation (E)”.16 A total of 36 female BALB/c mice were used in this study. Mice for the experiments were clustered into 12 groups and immunized intramuscularly. Group 1 was immunized with 0.67 μM of CpG ODN 18281-1 alone, group 2 with 1 μg of Engerix B vaccine plus 0.67 μM CpG ODN 18281-1, group 3 with 0.67 μM of CpG ODN 18281-2 alone, group 4 with 0.67 μM of CpG ODN 18281-2 plus 1 μg of Engerix B vaccine, group 5 with 0.67 μM of CpG ODN 18289 alone, group 6 with 0.67 μM of CpG ODN 18289 plus 1 μg of Engerix B vaccine, group 7 with 0.67 μM of CpG ODN 1826 S alone, group 8 with 0.67 μM of CpG ODN 1826 S plus 1 μg of Engerix B vaccine, group 9 with 0.67 μM of CpG ODN 2395 alone, group 10 with 0.67 μM of CpG ODN 2395 plus 1 μg of Engerix B vaccine, group 11 with 1 μg of Engerix B vaccine (GlaxoSmithKline, Version number: GDS015/IPI11) and group 12 with 50 μL of PBS (Thermo Fisher Scientific, Lot n°178050) as negative control. Each treatment group of mice received a booster dose on day 14, consisting of 1μg of the Engerix B vaccine and 0.67 μM of CpG ODNs (supplied by Macrogen Europe, Lot n°230620-002-C3-C7) (Table 1).
Table 1. Various CpG ODNs employed in the research.
| CpG ODNs (Macrogen) | Sequences |
|---|---|
| 18281-1 (22 mer) | 5’-T*C*C*A*T*G*A*C*G*T*T*C*T*A*C*T*G*A*C* G*T*T-3’ |
| 18281-2 (23 mer) | 5’-T*GA*CTGT*GAACGTTCGGATGAT*T-3’ |
| 18289 (22 mer) | 5’-T*CCATGACGTTC*TACTGACGT*T-3’ |
| 1826 S (20 mer) | 5'-T*CC* AT*G A*CG* TTC* CTG A*CG TT-3' |
| 2395 (22 mer) | 5’-TC*G T*CG TTT TC*G GCG C*GC G*CC G-3’ |
2.4 Samples collection
Mice were blood-sampled on days 14 and 28 post-vaccination. The collected blood underwent processing to obtain plasma or remained as whole blood. Tail bleeding was used for plasma collection, while cardiac puncture was employed for obtaining whole blood. Tail blood was mixed with 50 μL of heparin (Kilitch Drugs India Ltd. Batch No: KLRC1004) in a 1.25 mL cryovial tube, and then centrifuged at 4000 rpm for 20 minutes to collect the supernatant. Before collecting whole blood, mice were euthanized with CO2, and approximately 700 μL was drawn into 1.5 mL Ethylenediaminetetraacetic acid (EDTA)-containing tubes. Plasma was stored at -20°C, while whole blood was stored at -80°C. Spleen tissues were dissected from the mice and placed in sterile 1.5 mL Eppendorf tubes on ice. These spleen samples were stored at -80°C until they were utilized for total RNA extraction and subsequent experiments.
2.5 Assessment of humoral immune responses to the vaccine
Assessment of humoral immune responses to the vaccine involved utilizing the Enzyme-Linked Immunosorbent Assay (ELISA) to measure HBV antibody levels. The Mouse HBV Surface Antibody (HBsAb) Qualitative Test Kit ELISA, along with its protocol, was employed for this purpose (manufactured by Solarbio Science & Technology Co., Ltd, China). ELISA plates were analyzed at a wavelength of 450nm using the ELISA Microplate Reader (manufactured in California, USA). Samples from each group were tested in triplicate, and the average Optical Density (OD) value was utilized to determine antibody levels.
2.6 Evaluating expression of Tumor necrosis factor alpha (TNF-α) and Interleukin 6 (IL-6) in immunized mice
2.6.1 Preparation of total RNA from spleen tissues and cDNA synthesis
Spleen tissue samples were processed to extract total RNA employing the Total RNA Extraction Kit (manufactured by Solarbio Science & Technology Co., Ltd, China), following the provided instructions. The concentration and purity of the RNA were evaluated using the spectrophotometer (manufactured by Thermo Fisher Scientific, Waltham, Massachusetts, USA) at absorbance 260/280. The samples were then stored at -80°C for subsequent experiments. Subsequently, cDNA synthesis from the extracted total RNA samples was performed utilizing the Universal RT-PCR Kit and its associated protocol (manufactured by Solarbio Science & Technology, Beijing, China).
2.6.2 Quantitative Polymerase Chain Reaction (qPCR)
A 2X SYBR Green quantitative PCR Mastermix (manufactured by Solarbio Science & Technology Co., Ltd, China) was utilized in a total reaction volume of 25μL. Amplification was carried out on the Applied Biosystems Quant Studio 5 qPCR platform (manufactured by PE Applied Biosystems, USA) using the PCR thermal profile detailed in Table 2. The primers employed for amplifying TNF-α, Il-6, and the housekeeping gene are listed in Table 3. The relative quantification of gene expression was determined using the delta-delta threshold cycle (∆∆Ct) formula, ∆Ct = Ct (gene of interest) – Ct (housekeeping gene), by Medrano et al.17
Table 2. Thermal profile for Quantitative Real-Time PCR.
| Step | Time | Temperature | Cycles |
|---|---|---|---|
| Pre-Denaturation | 10 Minutes | 95oC | 1 |
| Denaturation | 15 Seconds | 95oC | 45 |
| Annealing/Extension | 1 Minute | 60oC |
Table 3. Primer sequences used and anticipated amplicon sizes for TNF-α and Il-6 analysis.
| Cytokine | Forward Primer 5′--3′ | Reverse Primer 5′--3′ | NCBI | Size of Amplicon | Reference |
|---|---|---|---|---|---|
| Tumor necrosis factor alpha (TNF-α) | CTCCAGGCGGTGCCTATGT | GAAGAGCGTGGTGGCCC | NM_013693.3 | 76 bp | 18 |
| Interleukin 6 (IL-6) | GAGGATACC ACTCCCAAC AGACC | AAGTGCATC ATCGTTGTTCATACA | XM_021163844.1 | 141 bp | 18 |
| HPRT1 (Hypoxanthine guanine phosphoribosyl transferase 1) | TCCTCCTCAGACCGCTTTT | CCTGGTTCATCATCGCTAATC | NM_013556.2 | 90 bp | 17 |
2.7 Evaluation of hematological parameters and biochemical analyses
Analysis of the complete blood count in whole blood was conducted utilizing the HumaCount 30TS hematology analyzer machine (manufactured by Human Diagnostics Worldwide, Germany) by the provided protocol. Additionally, the serum levels of Aspartate Transaminase (AST), Alanine Transferase (ALT), Creatinine, and Urea were assessed using the Reflotron colorimetric test strips (manufactured by Woodley Equipment Company, England) following the prescribed protocols.
2.8 Data analysis
The Signal-to-noise ratio values (OD at 450 nm/PBS) calculated from the ELISA optical densities and the quantification cycle (Ct) values were recorded and analyzed in Microsoft Excel (2016). Relative mRNA expression levels of the target genes were normalized to HPRT 1 using the 2-ΔΔCt method. The data obtained for the hematological and biochemical parameters were expressed as mean values using Microsoft excel (2016). Statistical significance of differences was determined through One-way ANOVA and Student’s t-tests, with a p-value <0.05 being considered as statistically significant for all performed tests.
3. Results
3.1 Signal-to-noise ratio values generated within different experimental groups
After the first immunization with the Engerix B vaccine supplemented with CpG-ODNs, the presence of antibodies in the plasma of all the immunized mice was observed. At day 14, it was shown that there was a statistically significant difference (p < 0.0001) in Signal Noise ratio (S/N) values among the vaccinated groups supplemented with CpGs (Figure 1).19 Moreover, the findings demonstrated that the CpG 18281-1, CpG 18281-2, CpG 18289, and CpG 1826 supplemented groups exhibited 1.2, 1.8, 1.1, and 1.6-fold increases respectively with signal-to-noise ratio values (2.5, 3.8, 2.2 and 3.3 respectively) compared to vaccine group only (S/N = 2.1).
Figure 1. Immunostimulating activity of CpG ODNs on day 14 after administration of Engerix B vaccine, and CpG ODNs in BALB/c mice.
Key: CpG 18281-1Vac = CpG ODN 18281-1+Vaccine. CpG 18281-2Vac = CpG ODN 18281-2+Vaccine. CpG 18289Vac = CpG ODN 18289+Vaccine. CpG 1826SVac = CpG ODN 1826S+Vaccine. CpG 2395Vac = CpG ODN 2395+Vaccine. PBS = Negative control (** p < 0.01; **** p < 0.0001).
On the 28th day, the signal-to-noise (S/N) ratio values were markedly elevated in all treated groups compared to those on day 14 (p < 0.0001). Notably, the groups supplemented with CpG 2395 showed a substantial 4.4-fold increase, reaching a signal-to-noise ratio value of 14.1 compared to the vaccine group only (S/N = 3.22). This was notably higher than the corresponding values for other CpG ODNs combined with the vaccine (Figure 2). Specifically, CpG 18281-1, CpG 18281-2, CpG 18289, and CpG 1826 supplemented groups exhibited increases of 1.6, 2, 1.2, and 3.6-fold, respectively, with signal-to-noise ratio values of 5.1, 6.4, 3.9, and 11.7, respectively. These findings underscore that CpG ODN 2395 demonstrated the most significant effectiveness when combined with the Engerix B vaccine.
Figure 2. Immunostimulating activity of CpG ODNs on day 28 after administration of Engerix B vaccine, and CpG ODNs in BALB/c mice.
Key: CpG 18281-1Vac = CpG ODN 18281-1+Vaccine. CpG 18281-2Vac = CpG ODN 18281-2+Vaccine. CpG 18289Vac = CpG ODN 18289+Vaccine. CpG 1826SVac = CpG ODN 1826S+Vaccine. CpG 2395Vac = CpG ODN 2395+Vaccine. PBS = Negative control (**** p < 0.0001).
3.2 Effect of vaccine and CpG ODNs on IL-6 and TNF-α expression
The groups of mice that received CpG ODNs-only exhibited lower levels of IL-6 compared to the expression level observed for the group treated with 1μg of vaccine. The Fold Change in Transcription (FCT) for CpG 18281-1 was 0.41, for CpG 18281-2 was 0.34, for CpG 18289 was 0.40, for CpG 1826 S was 0.35, and for CpG 2395 was 0.28 against 0.96 (Figure 3A). However, the levels of IL-6 expressed in mice immunized with CpG ODNs plus vaccine are higher compared to the group of mice given the vaccine alone. The FCT for the CpG ODN 18281-1 + Vaccine group was 2.57, for the CpG ODN 18281-2 + Vaccine group was 2.16, for the CpG ODN 18289 + Vaccine group was 1.20, for the CpG ODN 1826 S + Vaccine group was 1.31, for the CpG ODN 2395 + Vaccine group was 2.77, and for the vaccine alone was 0.96 (Figure 3A).
Figure 3. Relative expression of IL-6 and TNF-α 28 days after administration of Engerix B vaccine, and CpG ODNs in BALB/c mice.
Key: Vacc alone: Vaccine alone. CpG 18281-1+Vacc = CpG ODN 18281-1+Vaccine. CpG 18281-2+Vacc = CpG ODN 18281-2+Vaccine. CpG 18289+Vacc = CpG ODN 18289+Vaccine. CpG 1826+Vacc = CpG ODN 1826S+Vaccine. CpG 2395+Vacc = CpG ODN 2395+Vaccine. PBS = Negative control. (A) IL-6 gene expression, (B) TNF-α gene expression.
Regarding TNF-α expression, mice treated with CpGs-only and CpG 18281-1 + Vaccine, CpG 18281-2 + Vaccine, CpG 2395 + Vaccine, and vaccine group-only exhibited lower levels of TNF-α (FCT < 1.00) compared to the non-treated PBS group (FCT=1.00). Only the groups that received vaccine + CpG 18289 and CpG 1826 expressed a high level of TNF-α, with FCT values of 2.29 and 4.96, respectively (Figure 3B).
3.3 Assessment of hematological and biochemical parameters
The hematological characteristics of female BALB/c mice inoculated with 1 μg of vaccine alongside CpG ODN 2395 and PBS alone are presented in Table 4. The Neutrophil counts in the group of vaccine supplemented with CpG ODN 2395 and vaccine alone were lower than the untreated group (PBS). All the parameters for White Blood Cells, Lymphocytes, Monocytes, Eosinophils, Basophils, Red Blood Cells, HB, HCT, MCV, and Platelets were within the normal range. Higher MCHC counts were found in all treated and untreated groups. Also, higher MCH was observed in the vaccine group.
Table 4. Results from hematological profiles.
The comprehensive analysis revealed no statistically significant difference (p ≥ 0.33) between the mice receiving treatment and those not receiving treatment.
Biochemical analysis of female BALB/c mice immunized with 1μg of vaccine plus CpG ODN 2395 and PBS alone are presented in Figure 4. Results for ALT, AST, Creatinine, and urea showed no statistical difference between treated and non-treated groups (p ≥ 0.85).
Figure 4. Results of Biochemical analysis.
Key: ALT = Alanine transaminase (U/L); AST = Aspartate aminotransferase (U/L); Creatinine (mg/dl); Urea (mg/dl).
4. Discussion
This study has demonstrated that including CpG ODN 2395 in the HBV vaccine increases the immune-potentiating effect of the vaccine. CpG ODN 2395 is a class C CpG that combines the characteristics of both CpG-A and CpG-B ODNs. The CpG-A ODNs cause pDCs to produce high levels of IFN-α and TNF-α. They weakly stimulate TLR9 and IL-6 production. The CpG-B ODNs increase B-cell activation, maturation, and proliferation. They also induce IL-6, IFN-α, and TNF-α production.20 Strong immune-boosting effects of CpG-C ODNs have been demonstrated; nevertheless, certain sequence characteristics are required.20 For example, ODN 2395 includes two key features in its sequence that could be contributing to its adjuvant character. First, a palindromic sequence with several CpG motifs at the 3′-end of the ODN, followed by one or more TCG elements at the 5′-end of the ODN. It has been shown that the hexameric motif 5′ GTCGTT in ODN 2395 is the ideal sequence for CpG-C ODN activities.20
Other studies have demonstrated that the addition of CpG ODN to the HBV vaccine increased the titers of antibodies against HBsAg (anti-HBs).21,22 Due to its immunostimulatory properties, many studies support the use of CpG DNA-based trials for immunotherapy against infectious disorders.23 In this study, groups of mice treated with 1 μg of Engerix B vaccine plus CpG ODNs showed substantial levels of S/N ratio values compared to groups treated with vaccine alone after 14 and 28 days of vaccination (**** p ˂ 0.0001). This supports the study conducted by Jurk et al24 who showed that CpG ODNs are potent inducers of the innate immune system. Our findings also confirm those of25 who showed that J&J vaccination against SARS-CoV-2 at low and high doses in combination with CpG ODN 18281-1, CpG ODN 18281-2, and CpG ODN 18289 generated higher levels of specific IgG than the vaccine alone. On the other hand,26 demonstrated that the majority of antibodies were IgG2a in mice injected with HBsAg containing CpG ODN (1826), indicating a potent Th1-type response. Surprisingly, the CpG ODN 1826 generated substantially more IgG2a than IgG1 even when paired with alum, showing that the effects of CpG ODN 1826 dominate over those of alum about T-cell help.26 The findings of,27 show that CpG ODN 1826 can induce ten times more anti-HBs titers in an alum-adjuvanted HBsAg vaccination compared to vaccine plus alum only. In addition, following immunization with the combined adjuvant rather than alum alone, elevated antibody titers manifest at a significantly earlier time point and are more Th1-biased.27 His study concludes that ODNs with cytosine guanine dinucleotides are immunomodulatory and stimulate both professional B cells and Antigen antigen-presenting cells.
The CpG-ODNs upregulate MHC II and other co-stimulatory molecules. They cause the secretion of cytokines such as TNF-α, and IL-6 and the production of immunoglobulins by B cells.27 The IL-6 molecule is a pleiotropic cytokine predominantly expressed in activated monocytes or macrophages, but also fibroblasts or activated endothelial cells of inflamed tissues. IL-6 is inducible by LPS, TNF-α, and some interferons. Regarding the biological effects, IL-6 not only induces acute inflammation but also elicits anti-inflammatory effects. Furthermore, IL-6 induces terminal differentiation of B cells to plasma cells, which led to the descriptive name B-cell differentiation factor.15 This study showed that all groups treated with vaccine plus CpG ODNs expressed Il-6 except the group treated with vaccine only (FCT = 0.96). This study observed no statistical difference in levels of IL-6 between treated and untreated groups (p ≥ 0.2). This finding agrees with that of28 who showed that both untreated and HBV vaccine-only treated groups produced less IL-6 at 0.603- and 1.469-fold changes in transcription (FCT) respectively.
TNF-α is a non-glycosylated 17-kDa protein that is mostly produced by macrophages, CD4+, CD8+, activated NK cells, neutrophils, and CD8+ T cells.15 In this study, TNF-α levels in the untreated group (FCT: 1.00) were higher compared to treated groups. Although these differences were not statistically significant (p ≥ 0.2), except for the treated groups of vaccine plus CpG 18289 and CpG 1826, which expressed TNF-α at FCT values of 2,29 and 4.96 respectively. This finding does not agree with the study by Ref. 28 which showed that mice treated with the HBV vaccine expressed higher levels of TNF-α than the untreated group at 28.84 – and 1.00 FCT respectively. These results showed that CpG ODNs enhance the secretion of Il-6, and only CpG 18289 and CpG 1826 had effect on the expression of TNF-α (Figure 3).
The body weight, behavior, and body features were normal in mice treated with CpG ODN 2395. There was also no evidence of toxicity. Results of the hematological study showed that values were normal in all parameters analyzed in both treated and untreated groups. As observed by Ref. 29 RBC, Hemoglobin, MCV, monocyte, eosinophil, basophil, platelet, and lymphocyte levels were within the normal range. Though value differences were observed between treated groups regarding Neutrophils and HCT in the CpG ODN 2395 group, MCHC in all groups, and MCH in the HBV vaccine-only group, differences were not significant (p ≥ 0.05) (Table 4).
Blood biochemical profiles are a useful diagnostic tool since they show the animal’s physiological condition.25 Urea and creatinine levels were determined to check kidney function and, ALT and AST levels were also determined to check liver function in mice immunized with the vaccine + CpG ODN 2395. This study observed no significant difference in values of these parameters between the treated groups and the untreated group (p ≥ 0.05) (Figure 4).
As a result, the findings indicated that the ALT, AST, urea, and creatinine parameters were within normal ranges.
Conclusion
Based on the results, we conclude that the HBV vaccine with CpG ODN 2395 has a higher potential of inducing body antibody and IL-6-based protection against HBV infection and is not toxic.
Institutional review board statement
Ethical clearance has been obtained by the Mount Kenya University Review Committee (Approval number 2196 on 16/09/2023).
Author roles
Titilayo Kemi Sophia Nelly Adedjobi: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Resources, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing; Daniel Kariuki: Conceptualization, Formal Analysis, Supervision, Writing – Review & Editing; James Kimotho: Conceptualization, Formal Analysis, Supervision, Writing – Review & Editing.
Download
Export To
metrics
| Views | Downloads | |
|---|---|---|
| F1000Research | - | - |
|
PubMed Central
Data from PMC are received and updated monthly.
|
- | - |
Citations
CITE
how to cite this article
ADEDJOBI TKSN, Kariuki D and Kimotho J. Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces stronger immune response in BALB/c mice [version 1; peer review: awaiting peer review] F1000Research 2024, 13:404 (https://doi.org/10.12688/f1000research.145766.1)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.
Open Peer Review
Current Reviewer Status:
AWAITING PEER REVIEW
AWAITING PEER REVIEW
Key to Reviewer Statuses
VIEW
HIDE
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations
A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Comments on this article Comments (0)