- Split View
-
Views
-
Cite
Cite
Ting-Ting Huang, Mohammed Naeemuddin, Sailaja Elchuri, Mutsuo Yamaguchi, Heather M. Kozy, Elaine J. Carlson, Charles J. Epstein, Genetic modifiers of the phenotype of mice deficient in mitochondrial superoxide dismutase, Human Molecular Genetics, Volume 15, Issue 7, 1 April 2006, Pages 1187–1194, https://doi.org/10.1093/hmg/ddl034
- Share Icon Share
Abstract
Sod2−/− mice, which are deficient in the mitochondrial form of superoxide dismutase (MnSOD), have a short survival time that is strongly affected by genetic background. This suggests the existence of genetic modifiers that are capable of modulating the degree of mitochondrial oxidative damage caused by the MnSOD deficiency, thereby altering longevity. To identify these modifier(s), we generated recombinant congenic mice with quantitative trait loci (QTL) containing the putative genetic modifiers on the short-lived C57BL/6J genetic background. MnSOD deficient C57BL/6J mice with a QTL from the distal region of chromosome 13 from DBA/2J were able to survive for as long as those generated on the long-lived DBA/2J background. Within this region, the gene encoding nicotinamide nucleotide transhydrogenase (Nnt) was found to be defective in C57BL/6J mice, and no mature NNT protein could be detected. The forward reaction of NNT, a nuclear-encoded mitochondrial inner membrane protein, couples the generation of NADPH to proton transport and provides NADPH for the regeneration of two important antioxidant compounds, glutathione and thioredoxin, in the mitochondria. This action of NNT could explain its putative protective role in MnSOD-deficient mice.
INTRODUCTION
Mitochondria play a central role in energy metabolism and cellular survival. They are also the major sensors of cellular distress and the initiators of apoptotic cell death (1). Energy production in mitochondria generates reactive oxygen species (ROS) as toxic by-products, which leads to a greater opportunity for oxidative damage in mitochondrial macromolecules. The consequences of such oxidative damage include mutations in mitochondrial DNA, impaired protein functions and enzyme activities in the electron transport chain (ETC) and tricarboxylic acid (TCA) cycle, and oxidation of lipid components.
Mitochondrial dysfunction has been implicated in a number of degenerative diseases, including Parkinson disease (2,3), Alzheimer disease (4–6), Huntington disease as well as in cancer (7,8). Defects in mitochondrial energy metabolism have also been implicated in diabetes (9) and cardiomyopathy (10). Therefore, protecting mitochondria from ROS-mediated damage and maintaining their structural and functional integrity are essential in reducing or preventing age- and disease-related degenerative changes that may have far reaching consequences for the lifespan and health span of an organism.
A powerful demonstration of the deleterious effects of mitochondrial ROS is the early lethality observed in mutant mice deficient in the major mitochondrial ROS metabolizing enzyme, Mn superoxide dismutase (MnSOD) (11). Mice deficient in MnSOD (Sod2−/−tm1Cje) develop a wide spectrum of phenotypes and their longevity depends on their genetic background (12,13). Thus, congenic Sod2−/− mice on a C57BL/6J background (B6 Sod2−/−) develop a fetal form of dilated cardiomyopathy, and most of them die about day 15 (ED15) of gestation. On the other hand, Sod2−/− mice generated on a DBA/2J (D2 Sod2−/−) background develop normally through gestation and do not have dilated cardiomyopathy. However, these mice develop severe metabolic acidosis and have an average lifespan of 8 days. F1 mice (B6D2F1 Sod2−/−) generated from the two parental strains have a cardiac phenotype similar to that of D2 Sod2−/− mice, but with a milder form of metabolic acidosis. Consequently, these mice are able to survive for up to three weeks without any pharmacological intervention (13). Consistent with our observation, a different Sod2 mutant strain (SOD2m1BCM) generated on a B6/129 mixed genetic background was shown to survive for up to 3 weeks after birth and had a phenotype similar to that of B6D2F1 Sod2−/−tm1Cje (14).
The phenotypic variation of Sod2−/− mice on different genetic backgrounds suggest that genetic modifiers that co-segregate with the long-lived population in the D2 and B6D2F1 backgrounds have the ability to reduce mitochondrial damage caused by MnSOD deficiency and, consequently, to prolong the lifespan of the mutant mice. Identification of genetic factors that are capable of maintaining mitochondrial redox balance and cell survival under conditions of oxidative stress would have important implications for understanding the key biochemical pathways that are involved, and for devising effective approaches for bolstering mitochondrial defense mechanisms. In this study, we describe the generation of recombinant congenic Sod2−/− mice with a protective quantitative trait loci (QTL) and the identification of a putative genetic modifier that helps to protect MnSOD-deficient mitochondria.
RESULTS
Genetic modifiers of MnSOD mutant mice are dominant alleles encoded by nuclear genes
We established that the modifier alleles act in a dominant fashion and are not inherited from the mitochondrial genome from the lifespan studies with B6D2F1 and D2B6F1 Sod2−/− mice (12) and with Sod2−/− mice generated from the first generation backcross to B6 and D2 (N2 from B6 Sod2−/+ × B6D2F1 Sod2−/+ and D2 Sod2−/+ × B6D2F1 Sod2−/+). Thus, the mean lifespan of Sod2−/− mice generated from B6 Sod2−/+ × B6D2F1 Sod2−/+ and D2 Sod2−/+ × B6D2F1 Sod2−/+ was 10.3±0.5 days (mean±SEM; n=89) and 12.8±0.4 days (n=56), respectively, and the survival times of these two groups of Sod2−/− mice were not significantly different (P=0.08). Furthermore, a preliminary genome-wide screen using a selective genotyping approach on 17 long-lived (lifespan ≥15 days) and seven short-lived (≤4 days) Sod2−/− mice from the B6 Sod2−/+ × B6D2F1 Sod2−/+ backcross panel identified association of the long-lived phenotype with D2 alleles on chromosomes 9 (D9Mit182–D9Mit18), 13 (D13Mit213–D13Mit262) and 17 (D17Mit175–D17Mit16 and D17Mit122–D17Mit123) (P < 0.01).
Life spans of Sod2−/− mice in backcross generations remained stable
To identify definitively the chromosome regions containing potential modifier genes for lifespan extension in D2 and B6D2F1 Sod2−/− mice, we carried out serial backcross (introgress) of D2 into the B6 background to generate recombinant congenic Sod2 mice (B6cD2 Sod2). A total of 15, 33, 27 and 18 N2, N3, N4 and N5 B6cD2 Sod2−/+ mice, respectively, were used for the breeding. With the exception of N2, roughly 50% of the breeders sired long-lived Sod2−/− offspring (N2, 13/15; N3, 15/33; N4, 11/27; N5, 8/18). The mean life spans of Sod2−/− from the backcross generations were: N3, 9.2±0.5; N4, 8.3±0.4; N5, 9.8±1.1; N6, 10.8±0.9; N7, 9.7±1.0 days. Significant differences in the survival of Sod2−/− mice were observed between B6 Sod2−/− and long-lived Sod2−/− from all of the backcross generations (P<0.0001). Although the survival curves from the backcross generations closely resembled that of D2 Sod2−/− mice (Fig. 1), N6 and N7 B6cD2 Sod2−/− had significantly longer survival times than did D2 Sod2−/− mice (P=0.0002 and 0.0079, respectively). However, the survival of long-lived Sod2−/− mice in all backcross generations was significantly shorter than that on the B6D2F1 background (P<0.0001).
Genome-wide scan identified linkage disequilibrium in chromosome 13
Genome-wide scans were carried out by genotyping 17 short- (mean lifespan 0.5±0.3 days) and 28 long-lived (11.4±1.0 days) N5 and N6 B6cD2 Sod2−/− mice (Table 1). Consistent with our preliminary study with a smaller set of backcross Sod2−/− mice, the distal region of chromosome 13 (D13Mit288–D13Mit35) showed significant linkage disequilibrium in the long-lived Sod2−/− mice (Table 1). The other chromosome region that was still present as B6/D2 in more than 50% long-lived Sod2−/− mice was chromosome 10 (data not presented). However, there was no significant difference in the allele distribution between long- and short-lived Sod2−/− mice. All other chromosomes had become almost exclusively B6/B6 by this stage. Thirty-nine N6 B6cD2 Sod2−/+ mice were also genotyped to identify potential breeders that were heterozygous only in the distal region (D13Mit288–D13Mit35) of chromosome 13. A total of six were identified and used for the generation of N7 offspring, and the Sod2−/− mice generated from these crosses had a mean lifespan similar to that of N6 B6cD2 Sod2−/− mice (Fig. 1). These data suggest that the genetic modifier(s) in the distal region of chromosome 13 are sufficient to extend the lifespan of B6cD2 Sod2−/− mice to the same level as that on the D2 background. Because all of the N6 B6cD2 Sod2−/+ mice used for the generation of N7 offspring had a B6/B6 genotype at D13Mit287 (Fig. 2), this boundary puts the maximal size of the linkage region at 20 Mb. With an additional backcross to B6, the QTL region was further divided into two sub-regions (Fig. 2). Preliminary results showed that N8 B6cD2 Sod2−/− mice with only the most distal sub-region (A-N, Fig. 2) continued to confer longer survival time (mean lifespan=8.5 days, n=2). The maximum possible size for this sub-region is approximately 10 Mb.
There are approximately 51 known genes in the Sod2−/− QTL region, and four encode mitochondrially targeted proteins. They are (proximal→distal) Nln (neurolysin), Ndufs4 [NADH dehydrogenase (ubiquinone) Fe-S protein 4], Mrps30 (mitochondrial ribosomal protein S30) and nicotinamide nucleotide transhydrogenase (Nnt) (Fig. 2). Ndufs4, Mrps30 and Nnt are located within 5 Mb of each other; Nnt is included in the most distal sub-region (A-N) of the QTL as the single nucleotide polymorphism (SNP) marker used to identify the A-N region is located within Nnt at 84.9 kb position (Fig. 2). Neurolysin is a metallopeptidase and is located in the inter-membrane space of mitochondria (15); NDUFS4 is one of the subunits of Complex I, and mutations in NDUFS4 have been identified in human population with mitochondrial abnormalities (16–18); MRPS30 is located in the matrix of mitochondria and is involved in protein synthesis. Very few SNPs between B6 and D2 have been identified in Nln, Ndufs4 and Mrps30. All the other genes in the QTL region encode proteins that are targeted to the cytosol, nucleus, membranes or extracellular space.
Defective Nnt gene identified in the B6 background
To identify putative modifier genes, we searched available databases to identify sequence polymorphisms in the linkage region in chromosome 13. A discrepancy between the full-length Nnt cDNA sequence derived from B6 and from other strains was identified (Supplementary Material, Table S1). All full-length Nnt cDNAs derived from B6 libraries were shorter than those derived from other genetic backgrounds, and sequence alignment showed that the majority of the truncated region corresponded to exons 7–11. Subsequent RT-PCR analysis with RNA isolated from B6 tissues confirmed the absence of the cDNA sequence corresponding to exons 7–11 (Fig. 3A).
To determine if the truncation of the Nnt message observed in B6 affects protein stability, western blot analysis was carried out with antibodies raised against either the N- or the C-terminal peptide (19). No mature NNT protein was detected in B6 tissues, whereas abundant NNT protein was detected in tissues from D2, FVB/NJ and C3H/HeJ (Fig. 4). Consistent with the western blot results, enzyme assays failed to detect any transhydrogenase activity in mitochondrial fractions isolated from B6 hearts and brains (n=3 each), whereas mitochondrial fractions isolated from FVB hearts showed strong transhydrogenase activity (11±2 mmol/min/mg protein, n=3).
The B6 Nnt gene has a 17.8 kb deletion
To determine whether the truncated Nnt message observed in B6 was the result of alternative splicing or chromosomal deletion, exon-specific PCR (Supplementary Material, Table S2) was carried out to amplify regions corresponding to exons 1, 6–12 and 21. Negative PCR results were obtained with B6 genomic DNA for exons 7–11 (Fig. 3B), suggesting a deletion at the genomic DNA level between exons 6 and 12. Additional PCR analyses (Supplementary Material, Table S3) in introns 6-7 and 11-12 identified the proximal location of the breakpoint. The PCR product bridging the breakpoint was sequenced, and the sequence alignment identified a stretch of 17 814 bp between exons 6 and 12 to be missing in Nnt from B6 mice (Supplementary Material, Fig. S1). The sequence was later confirmed by comparing it with the Nnt genomic DNA sequence from the Ensembl database (NCBI m33 mouse assembly, Ensembl gene ID ENSMUSG00000025453), which assembles only the C57BL/6J sequence.
Only B6 mice from The Jackson Laboratory (C57BL/6J) harbor the deletion in Nnt
To determine whether the deletion we observed is common among different strains of mice, we genotyped three B6 sub strains (C57BL/6NCrl, C57BL/6JEi, C57BL/6ByJ), one B6-derived cell line (B16-F1), three closely related inbred strains (C57BL/10J, C57L/J, C58/J) and seven other inbred strains (AKR/J, BALB/cJ, CAST/EiJ, SJL/J, SPRET/EiJ, MOLF/EiJ) using exon-specific PCR analyses. The deletion was detected only in B6 mice (C57BL/6J) from The Jackson Laboratory (Bar Harbor, Maine, USA) (data not shown) and not in any of the other strains examined.
DISCUSSION
We have described the generation of congenic recombinant mice (B6cD2) that carry a QTL from D2 that confers longer survival time in MnSOD null (Sod2−/−) mice. The QTL was located in the most distal 20 Mb region of chromosome 13, and N7 B6cD2 Sod2−/− mice with a B6/D2 genotype only in the QTL region had an average lifespan of 9.7±1.0 days. In addition, N8 B6cD2 Sod2−/− mice with only the most distal sub-region of the QTL continued to have a lifespan comparable with that of D2 Sod2−/− mice. The gene Nnt, which encodes nicotinamide nucleotide transhydrogenase, is located in the most distal sub-region of Sod2−/− QTL and is defective in C57BL/6J mice. The subcellular location and the biological function of NNT make it a likely genetic modifier for MnSOD deficiency.
NNT is a transmembrane protein and functions as a proton pumping transhydrogenase (20). The protein is present in both prokaryotes and eukaryotes and is located in the inner membrane of mitochondria. In prokaryotic cells, the enzyme is composed of α and β subunits of 54 and 48 kDa, respectively (20,21). In eukaryotic cells, the enzyme is usually composed of a single peptide of 110 kDa (22). Although NNT catalyzes the inter-conversion of NADH and NADPH, the forward reaction using the reducing power of NADH to regenerate NADPH would be favored under conditions of oxidative stress (23). This has an important implication in redox detoxification in the mitochondria, as NADPH is used for the regeneration of reduced glutathione (GSH) and thioredoxin (TrxS2) (Fig. 5). The net effect is to support the antioxidant capacity in the mitochondria with an ample supply of GSH and TrxS2. Our results indicate that C57BL/6J mice do not have any active NNT protein and that B6 Sod2−/− mice are essentially double knockouts of MnSOD and NNT. Although the data suggest that NNT deficiency alone probably does not lead to any overt abnormality under normal laboratory conditions, the defect leads to enhanced tissue damage in the absence of MnSOD.
Consistent with our results in mice, a Caenorhabditis elegans mutant with deletion of nnt1 grows normally under standard laboratory conditions but has a marked reduction in GSH/GSSG ratio and an increased sensitivity to oxidative stress (24). A recent linkage analysis further highlighted the important role of NNT in cellular function (25). C57BL/6J mice are known to exhibit impaired glucose tolerance (26), and functional analysis suggested that the defect was in beta cell metabolism related to insulin secretion. Linkage analysis with B6C3 F2 mice identified the chromosome region containing Nnt as one of the candidate QTLs (25). The study showed a marked reduction in Nnt message level in the liver and islets of C57BL/6J mice (25). Additional studies using β-cells isolated from NNT-deficient mice showed a marked increase in ROS production under high glucose condition (27). Taken together, these data suggest that the presence of NNT is essential for mitochondrial defense against oxidative stress and for normal cellular metabolism.
Cardiac tissue may be the tissue most vulnerable to oxidative stress during embryonic and fetal development and could suffer a great deal of damage without proper antioxidant capacity in the mitochondria. MnSOD deficiency, therefore, can be detrimental to the developing heart. However, the highest level of NNT expression is in the heart (28), and the presence of NNT most likely provides sufficient antioxidant capacity through the regeneration of GSH and TrxS2. As a consequence, Sod2−/− mice with a functional copy of Nnt are able to develop normally through gestation without overt abnormality in the heart. On the other hand, other tissues such as liver and brain have relatively low levels of NNT (28), which may not be sufficient to compensate for MnSOD deficiency when metabolic demands in these tissues increase. Consequently, D2 and B6D2F1 Sod2−/− mice develop metabolic acidosis and neurological defects during the postnatal stage (12,13). The longer survival time of Sod2−/− mice on B6C3 F2 (B6C3F1 Sod2−/+ × B6C3F1 Sod2−/+, average lifespan 9.3±0.3 days, n=163, TT Huang, unpublished result) and B6/129 background (14) also lends support to the role of NNT as a genetic modifier for Sod2−/− as both C3H/HeJ and 129 carry the normal Nnt gene (Fig. 4 and Supplementary Material, Table S1).
As B6D2F1 Sod2−/− mice have the longest survival time, it is reasonable to speculate that heterozygosity at one or more loci may be beneficial to the survival of Sod2−/− mice. Outbred vigor may be one explanation for the observation. Alternatively, there may be recessive suppressor alleles that are neutralized on the B6D2F1 background and allow Sod2−/− mice to survive longer.
Identification of modifier genes provide insights into the molecular and cellular networks controlling specific aspects of biological functions. In Sod2−/− mice, the modifier gene(s) provide protection to the mitochondria in the absence of MnSOD and allow the developing heart to escape the damaging effects. The identification of Nnt as a putative genetic modifier underscores the importance of NADPH in the maintenance of redox potential in the mitochondria. By inference, defects in Nnt gene could also be a potential risk factor for increased mitochondrial vulnerability under various pathological conditions.
MATERIALS AND METHODS
Serial backcross and lifespan analysis
All Sod2−/− mice were generated from inter-crosses between −/+ mice. Designations of all strains and crosses described in this study give the strain of female parent first, followed by that of the male parent. Nn denotes the number of backcross to B6; B6cD2 denotes the recombinant congenic mice derived in this study with B6 as the recipient and D2 as the donor strain. At each generation of backcross to B6, Sod2−/− mice were generated and the life spans determined. As the average lifespan of live-born Sod2−/− mice on B6 background was 0.9±0.3 days (12) and the minimum survival in the B6D2F1 Sod2−/− population was 6 days, we used 6 days as the cut-off. Thus, only Sod2−/− mice that survived for ≥6 days were included in the long-lived population, and those that survived for <6 days were included in the short-lived population. Sod2−/+ mice generated from the breeding colonies that sired long-lived −/− mice were used for the serial backcross. The process was repeated until the N6 generation. Thus, the selection of breeders was based on the phenotype of their Sod2−/− littermates. Starting from the N7 generation, all Sod2−/+ breeders were genotyped for the presence of the whole or partial putative QTL region before they were used for the backcross. The chromosome 13 QTL region was subsequently separated into two sub-regions (Fig. 2), and breeding was carried out independently for the A-N sub-region to determine the life spans of Sod2−/− mice. Only male breeders were used for all the subsequent breeding. Lifespan analysis of Sod2−/− mice was carried out as described previously (12). Wild-type B6 (stock no. 000664) and D2 (stock no. 000671) mice were purchased from The Jackson Laboratory. All animal handling procedures were carried out according to the protocols approved by the Animal Care Committee (CAR) at UCSF and the Subcommittee on Animal Studies at the Palo Alto VA Health Care System.
Genotyping by microsatellite markers and SNPs
Genomic DNA was isolated from N5 and N6 B6cD2 Sod2−/− mice collected from the serial backcross. A total of 217 informative microsatellite markers (MIT markers) were used with an average distance of 6.8 cM. DNA isolated from B6, D2 and B6D2F1 were used as controls. DNA isolated from Sod2−/+ breeders that sired long-lived −/− offspring were also included. Genotyping was carried out at the UCSF Genomics Core Facility using the ABI PRISM Genetic Analyzer (Foster City, CA, USA) and the data were analyzed using the ABI PRISM Genotyper software. Subsequent genotyping with a small set of MIT markers from chromosomes 10 and 13 was carried out using the Spreadex gels system (Elchrom Scientific, Switzerland), and the genotypes were determined manually. Fisher's exact test was carried out for each of the MIT markers comparing the segregation of the B6/B6 versus B6/D2 genotype between the short- and the long-lived populations. Several SNP markers (Supplementary Material, Table S4) were also used to confirm the microsatellite results and for the screening of QTLs in Sod2 mice starting from the N7 generation (Fig. 2). The SNP markers were selected from the Celera database and utilized the presence of a restriction enzyme recognition site for the diagnosis. All Sod2 mice (−/+ and −/−) with a B6/D2 genotype in mCV22635497 were screened for the presence of wild-type Nnt by exon-specific PCR (see below).
RT–PCR and PCR analyses of regions corresponding to exons 7–11 of Nnt
To confirm the presence of a shortened Nnt message in B6 tissues, RT–PCR analysis was carried out using primers that were either outside (F1, position 1041, AACAGTGCAAGGAGGTGGAC; R1, position 2361, GTGCCAAGGTAAGCCACAAT) or inside (F2, position 1565, GCAGGTCTCACTGGGA; R2, position 1733, AACCAGAGATGGCATTGGTC) of the region corresponding to exons 7–11 (Fig. 3A). Primers were designed based on the full-length cDNA sequence derived from FVB (accession no. BC008518). To determine if exons 7–11 exist in the genomic DNA from B6 and other strains of mice, exon-specific primers were used for PCR amplification (Supplementary Material, Table S2). Exons 1, 6, 12 and 21 were used as positive controls. All PCR reactions were carried out with a hot start and 30 cycles of amplification (94°C, 62°C and 72°C of 30 s each). Reverse transcription of total RNA was carried out with Superscript II (Invitrogen, Carlsbad, CA, USA) according to manufacturers' instruction. DNA from The Jackson Laboratory mice (with the letter J at the end of the strain designation) were all purchased from the Mouse DNA Resource (The Jackson Laboratory). DNA from C57BL/6NCrl and B16-F1 were extracted from a B6 mouse from Charles River Laboratory (Wilmington, MA, USA) and from the cell line purchased from ATCC (American Type Culture Collection, Manassas, VA, USA), respectively. Exon-specific PCR analyses on C57BL/6J were carried out with multiple DNA sources from direct isolation from C57BL/6J mice as well as from the DNA stock available from the Mouse DNA Resource at the Jackson Laboratory.
Identification of chromosome breakpoint
To identify the chromosome breakpoint leading to the deletion of Nnt exons 7–11, we used SNP markers in introns 6-7 and 11-12 as the starting points and sequentially walked toward exons 7 and 11. A positive PCR result suggests the presence of the target DNA sequence in B6, whereas a negative PCR result suggests the absence of the target sequence. D2 and B6D2F1 DNA were used as positive controls for all PCR analyses (see primers and PCR results in Supplementary Material, Table S3). After identifying sequences at the vicinity of the breakpoint, a set of primers (Exon12_L1 and Exon6_L4) were used to PCR across the breakpoint. Under the PCR condition used, a 547 bp PCR product was observed from B6 and B6D2F1 genomic DNA preparations, whereas no PCR product was observed from that of D2. The PCR product was gel-purified and sequenced using the forward and reverse PCR primers to identify the exact breakpoint. All primers were designed using Primer3 software [Whitehead Institute for Biomedical Research, (29)] based on the genomic DNA sequence obtained from Celera Discovery System. The PCR reaction was carried out with a hot start and 35 cycles of amplification (94°C, 60°C and 72°C of 30 s each).
Western blot analysis
Western blot analysis was carried out to determine the size and the tissue level of NNT protein in B6 (C57BL/6J), D2 (DBA/2J), FVB (FVB/NJ) and C3H (C3H/HeJ) mice. The affinity-purified rabbit polyclonal antibodies were raised against either the 43 kDa N-terminal (N43K) or the 20 kDa C-terminal (C20K) domain of bovine NNT protein (19). Tissue lysates were prepared in a solution containing PBS, 1% Triton-X 100, and 1:100 dilution of a protease inhibitor cocktail (Calbiochem, San Diego, CA, USA). Aliquots of 30 µg tissue lysates in 15 µl loading buffer (Pierce) containing 0.1 M DTT were boiled for 5 min and separated in 4–12% Bis–Tris Gel (NuPage gel, Invitrogen). After transferring to nitrocellulose membrane, the protein loading was checked by Ponceau S stain and the membrane incubated sequentially with blocking reagent (TBST with 1% milk, 60 min), primary antibody (1:50 in TBST with 1% milk, 60 min), wash (3×, TBST with 0.5% Tween 20) and secondary antibody (HRP-conjugated anti-rabbit IgG, 1:5000 in TBST with 1% milk, 60 min). Chemiluminescent reagents were used for signal detection on X-ray films (Lumi-Film, Roche, IN, USA). Filters were stripped and probed with actin antibody as an internal control.
Enzyme assay
Mitochondrial fractions were isolated from fresh tissues using a mitochondrial isolation kit (Pierce, Rockford, IL, USA). To break open the mitochondrial membranes, isolated mitochondria were freeze-thawed three times between liquid nitrogen and room temperature water, followed by a 5″ sonication. The transhydrogenase activity was measured spectrophotometrically at 375 nm at 37°C as described (19). The reaction mixture contains 100 mm Na-phosphate (pH 6.5), 0.3 mm NADPH, 0.3 mm 3-acetylpyridine adenine dinucleotide (AcPyAD), 10 µm rotenone and various amounts of mitochondrial preparation. All chemicals were obtained from Sigma–Aldrich (St Louis, MO, USA).
Statistical analysis
Lifespan analyses were carried out with log-rank test using GraphPad Prism 4 for Windows (GraphPad Software, San Diego, CA, USA). Comparison of genetic segregation between long- and short-lived Sod2−/− mice was carried out with a 2×2 contingency table and Fisher's exact test using the Online Calculators for Scientist from GraphPad Software.
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG Online.
ACKNOWLEDGEMENTS
We thank Dr Joseph Nadeau for helpful discussion on statistical analysis, Anne Marie Gillespie for technical assistance and Anna Bogdanova, Rhodora Gacayan, Marguerite Doan and Xinli Wong for excellent animal care. This work was supported by funding from the National Institutes of Health AG24400 (TTH) and AG16998 (CJE).
Conflict of Interest statement: None.
Markers . | Position (Mb) . | Short-lived Sod2−/− mice . | Long-lived Sod2−/− mice . | P-value . | ||
---|---|---|---|---|---|---|
. | . | Genotype . | Genotype . | . | ||
. | . | B6/B6 . | B6/D2 . | B6/B6 . | B6/D2 . | . |
Sample size | N=17 | N=28 | ||||
Mean lifespan | 0.5±0.3 days | 11.4±1.0 days | ||||
D13Mit288 | 103.7 | 11 | 6 | 8 | 20 | 0.029 |
D13Mit148 | 105.1 | 12 | 5 | 7 | 21 | 0.0047 |
D13Mit230 | 107.8 | 13 | 4 | 4 | 24 | <0.0001 |
D13Mit262 | 109.2 | 13 | 4 | 1 | 27 | <0.0001 |
mCV22635497 | 13 | 4 | 2 | 26 | <0.0001 | |
D13Mit35 | 116.1 | 13 | 4 | 3 | 25 | <0.0001 |
Markers . | Position (Mb) . | Short-lived Sod2−/− mice . | Long-lived Sod2−/− mice . | P-value . | ||
---|---|---|---|---|---|---|
. | . | Genotype . | Genotype . | . | ||
. | . | B6/B6 . | B6/D2 . | B6/B6 . | B6/D2 . | . |
Sample size | N=17 | N=28 | ||||
Mean lifespan | 0.5±0.3 days | 11.4±1.0 days | ||||
D13Mit288 | 103.7 | 11 | 6 | 8 | 20 | 0.029 |
D13Mit148 | 105.1 | 12 | 5 | 7 | 21 | 0.0047 |
D13Mit230 | 107.8 | 13 | 4 | 4 | 24 | <0.0001 |
D13Mit262 | 109.2 | 13 | 4 | 1 | 27 | <0.0001 |
mCV22635497 | 13 | 4 | 2 | 26 | <0.0001 | |
D13Mit35 | 116.1 | 13 | 4 | 3 | 25 | <0.0001 |
N5 and N6 B6cD2 Sod2−/− mice were used for genome-wide linkage analysis. Positions of the markers are based on the Ensembl mouse genome database. mCV22635497 is a SNP marker identified in Celera database and is located in the proximal region of Nnt. mCV22635497 is located at 116 316 734 bp position in the Celera database. Two-tailed Fisher's exact test (df=1) was carried out for each marker.
Markers . | Position (Mb) . | Short-lived Sod2−/− mice . | Long-lived Sod2−/− mice . | P-value . | ||
---|---|---|---|---|---|---|
. | . | Genotype . | Genotype . | . | ||
. | . | B6/B6 . | B6/D2 . | B6/B6 . | B6/D2 . | . |
Sample size | N=17 | N=28 | ||||
Mean lifespan | 0.5±0.3 days | 11.4±1.0 days | ||||
D13Mit288 | 103.7 | 11 | 6 | 8 | 20 | 0.029 |
D13Mit148 | 105.1 | 12 | 5 | 7 | 21 | 0.0047 |
D13Mit230 | 107.8 | 13 | 4 | 4 | 24 | <0.0001 |
D13Mit262 | 109.2 | 13 | 4 | 1 | 27 | <0.0001 |
mCV22635497 | 13 | 4 | 2 | 26 | <0.0001 | |
D13Mit35 | 116.1 | 13 | 4 | 3 | 25 | <0.0001 |
Markers . | Position (Mb) . | Short-lived Sod2−/− mice . | Long-lived Sod2−/− mice . | P-value . | ||
---|---|---|---|---|---|---|
. | . | Genotype . | Genotype . | . | ||
. | . | B6/B6 . | B6/D2 . | B6/B6 . | B6/D2 . | . |
Sample size | N=17 | N=28 | ||||
Mean lifespan | 0.5±0.3 days | 11.4±1.0 days | ||||
D13Mit288 | 103.7 | 11 | 6 | 8 | 20 | 0.029 |
D13Mit148 | 105.1 | 12 | 5 | 7 | 21 | 0.0047 |
D13Mit230 | 107.8 | 13 | 4 | 4 | 24 | <0.0001 |
D13Mit262 | 109.2 | 13 | 4 | 1 | 27 | <0.0001 |
mCV22635497 | 13 | 4 | 2 | 26 | <0.0001 | |
D13Mit35 | 116.1 | 13 | 4 | 3 | 25 | <0.0001 |
N5 and N6 B6cD2 Sod2−/− mice were used for genome-wide linkage analysis. Positions of the markers are based on the Ensembl mouse genome database. mCV22635497 is a SNP marker identified in Celera database and is located in the proximal region of Nnt. mCV22635497 is located at 116 316 734 bp position in the Celera database. Two-tailed Fisher's exact test (df=1) was carried out for each marker.
References
Wallace, D.C. (
Cohen, G., Farooqui, R. and Kesler, N. (
Orth, M. and Schapira, A.H. (
Ko, L.W., Sheu, K.F., Thaler, H.T., Markesbery, W.R. and Blass, J.P. (
Cottrell, D.A., Blakely, E.L., Johnson, M.A., Ince, P.G. and Turnbull, D.M. (
Davis, R.E., Miller, S., Herrnstadt, C., Ghosh, S.S., Fahy, E., Shinobu, L.A., Galasko, D., Thal, L.J., Beal, M.F., Howell, N. et al. (
Galas, M.C., Bizat, N., Cuvelier, L., Bantubungi, K., Brouillet, E., Schiffmann, S.N. and Blum, D. (
Panov, A.V., Gutekunst, C.A., Leavitt, B.R., Hayden, M.R., Burke, J.R., Strittmatter, W.J. and Greenamyre, J.T. (
Parish, R. and Petersen, K.F. (
Marin-Garcia, J. and Goldenthal, M.J. (
Li, Y., Huang, T.T., Carlson, E.J., Melov, S., Ursell, P.C., Olson, J.L., Noble, L.J., Yoshimura, M.P., Berger, C., Chan, P.H. et al. (
Huang, T.T., Carlson, E.J., Kozy, H.M., Mantha, S., Goodman, S.I., Ursell, P.C. and Epstein, C.J. (
Lynn, S., Huang, E.J., Elchuri, S., Naeemuddin, M., Nishinaka, Y., Yodoi, J., Ferriero, D.M., Epstein, C.J. and Huang, T.T. (
Lebovitz, R.M., Zhang, H., Vogel, H., Cartwright, J., Jr. Dionne, L., Lu, N., Huang, S. and Matzuk, M.M. (
Serizawa, A., Dando, P.M. and Barrett, A.J. (
Papa, S., Scacco, S., Sardanelli, A.M., Vergari, R., Papa, F., Budde, S., van den Heuvel, L. and Smeitink, J. (
Petruzzella, V., Vergari, R., Puzziferri, I., Boffoli, D., Lamantea, E., Zeviani, M. and Papa, S. (
Scacco, S., Petruzzella, V., Budde, S., Vergari, R., Tamborra, R., Panelli, D., van den Heuvel, L.P., Smeitink, J.A. and Papa, S. (
Yamaguchi, M. and Hatefi, Y. (
Hatefi, Y. and Yamaguchi, M. (
Arkblad, E.L., Betsholtz, C. and Rydstrom, J. (
Fjellstrom, O., Bizouarn, T., Zhang, J.W., Rydstrom, J., Venning, J.D. and Jackson, J.B. (
Arkblad, E.L., Tuck, S., Pestov, N.B., Dmitriev, R.I., Kostina, M.B., Stenvall, J., Tranberg, M. and Rydstrom, J. (
Toye, A.A., Lippiat, J.D., Proks, P., Shimomura, K., Bentley, L., Hugill, A., Mijat, V., Goldsworthy, M., Moir, L., Haynes, A. et al. (
Surwit, R.S., Kuhn, C.M., Cochrane, C., McCubbin, J.A. and Feinglos, M.N. (
Freeman, H., Shimomura, K., Horner, E., Cox, R.D. and Ashcroft, F.M. (
Arkblad, E.L., Egorov, M., Shakhparonov, M., Romanova, L., Polzikov, M. and Rydstrom, J. (
Rozen, S. and Skaletsky, H.J. (