Abstract
The E3 ubiquitin-ligases are important for cellular protein homeostasis and their deregulation is implicated in cancer. The E3 ubiquitin-ligase Hakai is involved in tumour progression and metastasis, through the regulation of the tumour suppressor E-cadherin. Hakai is overexpressed in colon cancer, however, the implication in colitis-associated cancer is unknown. Here, we investigated the potential role of Hakai in intestinal inflammation and cancer bowel disease. Several mouse models of colitis and associated cancer were used to analyse Hakai expression by immunohistochemistry. We also analysed Hakai expression in patients with inflamed colon biopsies from ulcerative colitis and Crohn's disease. By Hakai interactome analysis, it was identified Fatty Acid Synthase (FASN) as a novel Hakai-interacting protein. Moreover, we show that Hakai induces FASN ubiquitination and degradation via lysosome, thus regulating FASN-mediated lipid accumulation. An inverse expression of FASN and Hakai was detected in inflammatory AOM/DSS mouse model. In conclusion, Hakai regulates FASN ubiquitination and degradation, resulting in the regulation of FASN-mediated lipid accumulation, which is associated to the development of inflammatory bowel disease. The interaction between Hakai and FASN may be an important mechanism for the homeostasis of intestinal barrier function and in the pathogenesis of this disease.
Similar content being viewed by others
Introduction
Inflammation is an important risk factor for the development of human cancers. Colitis-associated colorectal cancer (CAC) is a specific type of colorectal cancer developed from colitis in inflammatory bowel disease (IBD) patients. IBD, including ulcerative colitis (UC) and Crohn’s disease (CD), is characterized by chronic inflammation in the gastrointestinal tract and can induce pre-neoplastic lesions, being an important risk factor for the onset of colorectal cancer1,2. Ubiquitination is one of the most important translational modifications in eukaryotes that induces substrate degradation, which in consequence controls the “quantity” and “quality” of specific proteins, ensuring cell homeostasis3,4. Ubiquitination process consists in the ubiquitin moiety linkage to a specific substrate that signals for degradation5. Three-enzymes are involved in the ubiquitination cascade: the E1 ubiquitin-activating enzyme that activates the ubiquitin molecule, the E2 ubiquitin-conjugating enzyme that carries the activated ubiquitin molecule as a thioester to the E3 ubiquitin-ligase enzyme that transfers the activated ubiquitin from the E2 to the lysine residue of substrate protein5,6. Among all RING-type E3 ligases, there are a number that require substrate phosphorylation at a tyrosine residue (pTyr) for their recognition, including Cbl family7. Excessive ubiquitin-mediated proteolysis has been observed in different types of cancer as well as in colitis, and its inhibition was shown to improve the colitis in the mouse model8,9,10.
Hakai protein is an E3 ubiquitin-ligase, identified as the first posttranslational regulator of the E-cadherin stability. Hakai induces E-cadherin ubiquitination and degradation in a Src-dependent manner; which in turn causes the alteration of cell–cell adhesions11,12. E-cadherin is the best-characterized member of adherens junctions, a type of cell–cell contacts that participate in embryogenesis and tissue homeostasis13,14. The loss of E-cadherin at cell–cell contacts induces the epithelial-to-mesenchymal transition (EMT), a process by which cells lose cell polarity and acquire a migratory phenotype, a fundamental program during colon tumor progression and metastasis15,16,17. In human biopsies from IBD patients, E-cadherin expression is downregulated. Indeed, E-cadherin is the strongest candidate for UC susceptibility and plays a key role in epithelial restitution and repair following mucosal damage. In fact, expression of E-cadherin is significantly reduced in areas of active UC. Of note, E-cadherin has recently been associated with susceptibility to colorectal cancer, which is an established complication of longstanding UC. The new associations suggest that changes in the integrity of the intestinal epithelial barrier may contribute to the pathogenesis of UC18,19,20,21,22. Moreover, In an in vivo mouse model of experimentally induced colitis, it is shown that E-cadherin deficiency was associated with exacerbated acute and chronic inflammation highlighting its role in the pathogenesis of UC23. We have previously demonstrated that Hakai is an important regulator of cell proliferation, epithelial-to-mesenchymal transition, cell invasion, and that it induces tumour progression and metastasis in vivo24,25,26. We have also shown that Hakai expression is increased in colon and gastric cancer compared to adjacent human colon healthy tissues, with important clinical implications for designing new therapeutic strategies26,27,28.
Several E3 ubiquitin-ligases were reported to be implicated in the pathogenesis and development of human IBD8. However, whether the E3 ubiquitin-ligase Hakai participates in IBD is still unknown. The main purpose is to explore the implication of Hakai in IBD by analyzing Hakai expression in murine models for CAC. In the present study, we have shown that Hakai is downregulated under pro-inflammatory environment in the mice intestinal tissue regardless of origin of that inflammation. Moreover, by an interactome analysis we have identified Fatty Acid Synthase (FASN) as a novel Hakai-interacting protein. Hakai induces FASN ubiquitination and degradation via lysosome, regulating FASN-mediated lipid accumulation, which is associated to the development of IBD. Importantly, an inverse association of FASN expression with Hakai expression was detected in inflammatory AOM/DSS compared to tumour tissue of CAC and healthy tissues.
Results
Hakai expression in different mouse models of colitis and CAC
Hakai overexpression in cytoplasm and nucleus was reported in human colon cancer compared to adjacent normal healthy colon tissues24,26,27. In order to compare Hakai expression in the context of intestinal inflammation, three different mouse models that mimic different origins and stages of the IBD disease were used. Firstly, an AOM-DSS model of CAC was used. This model replicates the tumour development process of the human CAC by using the combination of a pro-inflammatory agent (DSS) and a carcinogenic compound (AOM), as previously described29. As shown in Fig. 1a, the immunohistochemistry analysis of the whole intestine samples using Hakai antibody revealed a significant decreased expression of Hakai in inflammatory conditions (AOM/DSS) of the gut epithelium compared to tumour tissue from the CAC (AOM DSS/Tumour) or healthy tissues. The same pattern of expression was observed when analysing an animal model of acute colitis (acute DSS), which resemble the acute phase of the disease or flare-ups by using higher concentrations of pro-inflammatory agent DSS at short times (Fig. 1b). Finally, a third stablished mouse model was used based in a genetically modified mice deficient for the IL-10 gene (IL-10 KO). These mice spontaneously develop a chronic inflammatory bowel disease (IBD) due to the important control of IL-10 on the gut microbiota30. The absence of IL-10 modulates cellular immune response and reduces mice tolerance towards bacterial antigens of enteric bacteria which causes the inflammatory process. In this model, Hakai expression was also statistically reduced in inflamed conditions compared to gut epithelium of healthy mice (Fig. 1c). All these results point out to a regulation of Hakai in different inflammatory conditions, with a great reduction of Hakai expression in the inflamed epithelium. Remarkably, high expression of Hakai in the epithelium of healthy untreated mouse was detected while this observation was not shown in human tumour-adjacent healthy tissue26.
Then we further analysed the Hakai mRNA expression by using microarray data from similar experiments in NCBI’s Gene Expression Omnibus (GEO). Three different mouse models were analysed: the colitis-associated colorectal cancer (AOM/DSS), the acute colitis (acute-DSS), and the IL-10 KO mouse models. As shown, the levels of Hakai mRNA were reduced in the inflamed tissue in AOM/DSS model (Fig. 2a), the DSS mouse model (Fig. 2b) and the IL-10 KO mouse model (Fig. 2c). Moreover, Hakai mRNA expression was recovered during tumour progression (low grade dysplasia, high grade dysplasia and colorectal adenocarcinoma) in the AOM/DSS model (Fig. 2a). Taking together these results suggest that, mRNA and protein expression of Hakai are clearly regulated under a pro-inflammatory environment in the intestinal tissue regardless of origin of that inflammation.
FASN as a novel Hakai-regulated protein identified by interactome analysis
In order to understand the potential molecular mechanism by which Hakai could be involved in inflammation, HCT116 colon cell line was used to perform a large-scale immunoprecipitation of Hakai followed by a mass spectrometric analysis in order to determine novel Hakai-interacting proteins that could be related to inflammatory process. For Hakai interactome, immunoprecipitation of endogenous Hakai protein levels was firstly confirmed (Fig. 3a). A total of 26 proteins with a peptide match ≥ 2 were identified by proteomic analysis in Hakai immunoprecipitated samples compared to non-specific immunoprecipitation using IgG control (Table 1). It should be noted that, Hakai is among the identified proteins and also HSP90 protein, another previously Hakai-interacting protein reported31, ensuring the specificity of the developed technique. A map of Hakai molecular interactions was performed by using the biological database STRING that provide information about both physical and functional properties of proteins (Fig. 3b)32. Interestingly, the Fatty Acid Synthase (FASN) protein was found as a novel Hakai-interacting protein. FASN is a multifunctional enzyme that catalyses the novo synthesis of long chain saturated fatty acids, from acetyl-CoA and malonyl-CoA, in the presence of NADPH33. Long-chain fatty acids considerably contribute to the pathology of intestinal epithelial cells, however, under normal conditions, the synthesis of fatty acids takes place in order to store energy. Abnormalities of lipid metabolism through overexpression of FASN, are associated with the development of inflammatory bowel disease (IBD)34,35. On the other hand, FASN expression has been detected in some benign and preneoplastic lesions of several organs such as colon, prostate, breast, lung, stomach, and skin nevi36,37.
In order to determine the possible link between Hakai and FASN, HCT116 cells were transfected with Hakai, in presence of Src, and the effect on FASN expression levels was assessed. Hakai overexpression strongly reduced FASN protein expression in HCT-116 cells, while no effect was detected at mRNA levels (Fig. 3c,d), further suggesting that Hakai may regulate FASN at a post-transcriptional level. Then, we tested the effect of Hakai-silencing on FASN expression. Transient transfections of two different oligos of siRNA Hakai in HCT116 cells and viral transduction of shRNA-Hakai silencing in an inducible system in HT29 were performed. Hakai silencing strongly increased FASN protein expression in both cell lines (Fig. 3e,f), while mRNA expression of FASN was not affected by Hakai silencing (Fig. 3g), further supporting the effect of Hakai on FASN at post-transcriptional level. Then it was analysed the effect of Hakai-silencing in the localization of FASN by immunofluorescence. The strong reduction of Hakai in the cells after inducing the knockdown with doxycycline confirmed the increased of FASN, without affecting FASN cellular localization (Fig. 3h). At the phenotypic level, silencing of Hakai induced a more epithelial phenotype, with cells closer attached between each other accompanied to a more three-dimensional cell sheet, compared to control conditions (Fig. 3i).
Hakai is a post-translational regulator of FASN via ubiquitin-lysosome pathway
Given that our results suggested that Hakai may control FASN at post-transcriptional level, inhibition of protein synthesis with cycloheximide (CHX) was performed in order to determine the half-life of FASN protein in presence or absence of Hakai (Fig. 4a, left and middle panel). FASN is a rather stable protein in HT29 cell, with an approximate half-life of 9.5 h (Fig. 4a, right panel). FASN half-life was increased to 11.5 h in Hakai-silencing conditions, suggesting Hakai effect on FASN protein stability. We then analysed whether Hakai may act as an E3 ubiquitin-ligase for FASN inducing its ubiquitination and degradation. After Hakai overexpression, an interaction between Hakai and FASN was detected (Fig. 4b), further confirming the results obtained by the interactome analysis (Fig. 3b). Moreover, Hakai induced FASN ubiquitination when transfecting cells in presence of pcDNA-Flag-Hakai, pBSSR-HA-ubiquitin and pSG-v-Src (Fig. 4c). This effect was also detected when Src was not overexpressed (Fig. S1). Taken together these results indicate that Hakai binds to FASN and induces its ubiquitination and degradation in vitro. There are three described pathways by which ubiquitinated substrates can be degraded: proteasome degradation, lysosome degradation and autophagy system. Treatment with the lysosome inhibitor chloroquine did increase FASN protein levels in HCT116 cells, while the autophagy inhibitor 3-methyladenine (3-MA) did not (Fig. 4d). Given that both inhibitors exert their inhibitory function in the autophagy pathway, 3-MA at early stages of autophagosome formation and chloroquine at late-autophagy stage targeting the lysosome38, their eeffectiveness were confirmed by using LC3 I/II levels as positive control. Furthermore, the 26S proteasome inhibitor MG132 did not increase FASN protein (Fig. 4d), suggesting that FASN degradation does occur via lysosome degradation. Besides, FASN levels were recovered after Hakai overexpression when lysosome inhibitor chloroquine was present (Fig. 4e), indicating that Hakai induced FASN degradation is, at least in part, via lysosome. Finally, we used a specific reported Hakai inhibitor, Hakin-1, to inhibit Hakai-mediated ubiquitination without affecting Hakai protein levels28. As shown, Hakin-1 was able to increase FASN protein levels without affecting Hakai protein levels, further supporting Hakai-mediated action on FASN (Fig. 4f). We also observed a reduction of Hakai-dependent ubiquitination of FASN when cells were treated with Hakin-1 (Fig. 4g). Collectively, our data support that Hakai control FASN ubiquitination and degradation via lysosome.
Hakai controls lipid accumulation via FASN
Given the demonstrated role of Hakai controlling FASN protein at posttranslational level, we assessed whether Hakai may have an impact in lipid accumulation. For this purpose, HCT116 cells were first transfected with Flag-Hakai to analyze the effect of its overexpression in lipid accumulation. When Hakai is overexpressed (Fig. 5a), a decrease in lipid accumulation was confirmed by oil red staining (Fig. 5b). Moreover, lower FASN levels decreased lipid accumulation, while the dual knockdown of siRNA-FASN and siRNA-Hakai, did not allow to recover lipid accumulation supporting that Hakai may control lipid accumulation, at least in part, through FASN (Fig. 5c,d). Given the previous results showing that Hakai expression in AOM-DSS model of CAC was decreased in inflammatory conditions compared to tumour tissue of colitis-associated colorectal cancer (AOM DSS/Tumour) and healthy tissues, we extended our results to analyse FASN expression in this mouse model (Fig. 5e). An inverse expression of FASN expression with Hakai expression was detected in inflammatory AOM/DSS compared to tumour tissue of colitis-associated colorectal cancer and healthy tissues (Fig. 5e) further suggesting that Hakai may regulate FASN expression in mouse model of inflammatory bowel disease.
FASN and Hakai expression in human IBD
Given that in the mouse model of inflammation-driven colorectal cancer, an inverse expression of Hakai and FASN expression was detected, we decided to analyse the expression of Hakai and FASN in human inflammatory colon disorders, including UC and CD. These two processes are chronic inflammatory conditions of the gastrointestinal tract that increase the risk of developing pre-neoplastic and neoplastic lesions. To compare the expression pattern of Hakai and FASN in the context of intestinal inflammation, human tissue samples from CAC, including UC and CD were analysed by immunohistochemistry. As shown in Fig. 6a, Hakai expression was significantly upregulated in UC and CD compared to normal tissues, and higher expression was detected compared to colorectal adenocarcinoma TNM-stage IV tissues. On the other hand, FASN expression was increased in CD samples compared to healthy tissues, but no significant differences were detected while comparing UC and healthy samples (Fig. 6b). Collectively, these results indicate that Hakai and FASN expression in the IBD mouse models do not mimic in the human IBD.
Discussion
IBD is a chronic inflammatory disorder in gastrointestinal tract that increases the risk of developing colon cancer39. In the last years, important number of publications highlight the importance of protein ubiquitination in IBD40,41. The E3 ubiquitin-ligase Hakai, highly expressed in colon cancer tissues compared to adjacent normal tissues, plays a critical role during tumor progression42, however, the potential implication in IBD is still unknown. In the current study, we have shown that Hakai expression is downregulated in inflamed intestinal epithelium in different mouse models for IBD (Fig. 1), while higher expression was detected in tumor tissues from AOM-DSS CAC model (Fig. 1a). Furthermore, the Fatty Acid Synthase (FASN) is a novel Hakai-interacting protein identified in the present study. We show that Hakai induces FASN ubiquitination and degradation, thereby resulting in the downregulation of FASN-mediated fatty acid accumulation (Figs. 4, 5). The abnormalities in fatty acid metabolism have been reported in IBD, and are considered as one of the etiologies for the development of this disease43. By immunohistochemistry, we have shown that FASN expression increases in the mucosa in the mice with colitis. This observation agrees with our results and previous reported studies showing high FASN expression in patients with IBD and colorectal neoplasia35,37.
In our in vitro model system, we have demonstrated that Hakai overexpression induces FASN degradation, while Hakai-silencing increases FASN expression and, in consequence, fatty-acid accumulation, which is associated to the development of IBD. In the mouse model, Hakai expression is downregulated in inflamed intestinal epithelium accompanied to an increase expression of FASN. Although, several studies have reported the role of Hakai in different cancers11,44,45, to our knowledge, this is the first study that links Hakai with IBD. Other E3 ubiquitin-ligases were reported to be involved in IBD. For instance, RNF186 controls protein homeostasis in colonic epithelial and regulates intestinal inflammation. Indeed, RNF186 is expressed in colonic epithelial of the mice, and Rnf186−/− mice are reported to lead to an increased risk of intestinal inflammation46. Accordingly, our results open the possibility to elucidate whether, in a similar manner, a decreased expression of Hakai in inflamed intestinal epithelia in mice may increase the risk of IBD. Importantly, in the tumors of the CAC mouse model, a higher expression of FASN and Hakai was detected, further supporting the implication of both proteins in colon cancer. However, in other studies, by gene expression prolife analysis, a decrease of FASN expression was described in patients with UC47. FASN was also described to play a crucial role in maintaining the homeostasis of intestinal barrier function, showing that loss of FASN in mouse intestine can initiate intestinal inflammation48. Intestinal homeostasis depends on multiple factor including the interaction between intestinal epithelium and the host immune system and the microbiota. Several regulatory mechanisms are reported to maintain intestinal homeostasis, and how the alteration of these pathways may precipitate the IBD49. Therefore, further studies are required in order to elucidate in which specific situation Hakai/FASN axis may contribute to intestinal homeostasis or IBD, as well as to reveal additional molecules that may help to orchestrate this regulatory process.
Previous studies have shown an increased ubiquitination mediated proteolysis in colonic biopsy samples from patients with IBD8,9,50. Indeed, other E3 ubiquitin ligases, such as RNF183, are reported to be up-regulated in the inflamed IBD mucosa, including UC and CD. RNF183 induces ubiquitination-mediated degradation of IκBα leading to the activation of NFκB-p65 in intestinal epithelial cells, further suggesting RNF183 role in NF-κB pathway in intestinal inflammation51. Hakai was recently reported to be associated to immune microenvironment regulation of periodontitis, a chronic inflammatory disease occurring in periodontal that involves complex interactions between pathogens and immune reactions52,53. This work demonstrates that Hakai is an important regulator of TNF and cytokine in immune reaction in periodontitis53. Given that TNF-α is a well-known inflammatory mediator that is highly expressed in the inflamed intestines of CD and UC patients54, it opens the possibility to explore whether Hakai may be linked to TNF-α signaling pathway in IBD.
In IBD human biopsies, Hakai expression was significantly upregulated in UC and CD compared to normal tissues, and higher expression was even detected in TNM-stage IV colorectal adenocarcinoma tissues. On the other hand, FASN expression was only increased in CD samples compared to healthy tissues, but no significant differences were detected between IBD and TNM-stage IV colorectal cancer. These results are not according to the ones observed in IBD mice, suggesting that Hakai regulation in mouse models does not accurately mimic human IBD, as observed in UC and CD. Although mouse models have been extensively used to study basic pathophysiological mechanisms, important controversies are reported regarding to how well murine models reflect human inflammatory diseases55,56. Indeed, Seok et at show that the genomic responses to different acute inflammatory stresses are highly similar in humans, but are not reproduced in the mouse models. Several factors can contribute to the differences seen in the molecular response of inflammatory mice and human disease including the evolutional and distance differences in cellular composition between mice and humans, as well as the complexity of the human disease57,58,59,60.
Taken together, we found that the E3 ubiquitin-ligase Hakai increases ubiquitination and degradation of FASN, thereby resulting in the regulation of FASN-mediated lipid accumulation, which is associated to the development of IBD. Further studies are needed to deepen into the role of Hakai in IBD in mouse models in order to better understand the regulatory mechanism and pathways that may influence intestinal homeostasis and its breakdown in IBD. Moreover, the role of Hakai/FASN axis in other diseases such as fatty liver disease awaits to be elucidated.
Materials and methods
Human intestinal tissues samples
Human biopsies from patients with UC and CD and colorectal cancer were obtained from the Pathological Anatomy Department from the “Complejo Hospitalario Universitario A Coruña” (CHUAC), under informed consent signed from all patients. Research investigation was approved by the Research Ethics Committee from A Coruña-Ferrol (Ethical Protocol Codes: 2018/257 and 2017/570) following standard ethical procedures of the Spanish regulation (Ley Orgánica de Investigación Biomédica, 14 July 2007) and according to the ethical standards in the 1964 Declaration of Helsinki. Paraffin samples were obtained from CHUAC Biobank integrated in the Spanish Hospital Platform Biobanks Network. Serial 4 µm sections from archived, formalin-fixed and paraffin-embedded intestinal tissue samples from patients (CD, n = 10; UC, n = 8 and colorectal cancer, n = 6) were analysed for Hakai protein expression.
Mice intestinal tissues samples
Three different mouse models of CAC were used to analyze Hakai protein expression. First, a chronic inflammation-associated carcinogenesis mouse model from which biopsies were taken from C57BL/6J mice, in which the development of colorectal cancer associated with inflammation, was promoted through intraperitoneal administration a chemical carcinogen Azoxymethane (AOM) and the inflammatory agent, dextran sodium sulfate (DSS), was given with the drinking water as reported29. Second, a DSS model that mimics the acute colitis, on which only DSS is used in a single cycle of 8 days and concentration (3%). Animals were sacrificed 4 days after the end of the DSS cycle. Finally, an IL10−/− model61, a genetically modified mice resulting in the enterocolitis appearance in presence of intestinal bacteria and imbalance in the function of the intestinal mucosa. All mouse intestinal tissue samples from C57BL/6J and C57BL/6 IL10 KO mice were kindly provided by Prof. Dr. Christoph Gasche (Medical University of Vienna, Austria).
Microarray data mining in NCBI’s gene expression omnibus (GEO)
Data from Hakai expression obtained from a gene-centric and an experiment-centric perspective was obtained from the GEO Database (https://www.ncbi.nlm.nih.gov/sites/GDSbrowser/). All the data sets available were filtered looking for microarrays of models of colitis associated cancer. Exclusion criteria was common for the 3 searches and included mice models that could interfere in the evaluation of the physiological process, principally studies that evaluated the effect of any drug to prevent the development of the inflammatory process. For the AOM/DSS model subgroups were formed according to the exposure time to the AOM/DSS, which was 2 weeks for the inflamed tissue, 4 weeks for those with low dysplasia, between 6 and 8 weeks for high dysplasia and 20 weeks for CRC with the control group only treated with saline. For the other two models, acute colitis and IL-10 KO, criteria for subgroup formation were only case/control. The final studies selected (GDS4367, GSE31106 and GSE107810) were analysed using GEO2R (https://www.ncbi.nlm.nih.gov/geo/geo2r/), in order to identify genes differentially expressed across the experimental conditions. The results of the search for Hakai expression in the created subgroups are presented. Parameters for the GEO2R tool were not customized and were used as default.
Antibodies and inhibitors
Hakai antibody (Invitrogen, Carlsbad, CA, USA) was used for western-blotting, and Hakai-2498 antibody used for immunohistochemistry was kindly provided by Dr. Fujita and Hakai antibody (Bethyl, Montgomery, TX, USA) was used for immunoprecipitation12. The rest of antibodies used for western-blotting are FASN antibody (Santa Cruz, Dallas, TX, USA), LC3 A/B antibody (Cell Signaling, Leiden, The Netherlands), E-cadherin antibody (BD Trans Lab, Franklin Lakes, NJ, USA), β-catenin antibody (Cell Signaling, Leiden, The Netherlands), GAPDH antibody (Invitrogene) and mouse and rabbit secondary antibodies (GE Healthcare, Chicago, IL, USA). Proteasome inhibitor MG132 (Sigma-Aldrich, St. Louis, MO, USA) was added for 6 h using 10 µM and 30 µM. Lysosome degradation inhibitor Chloroquine (Sigma-Aldrich, St. Louis, MO, USA), was added for 24 h at 50 µM and for 6 h at 100 µM. Autophagy inhibitor 3-Methyladenine (Sigma-Aldrich, St. Louis, MO, USA) was added for 24 h at 5 mM and 10 mM. Protein synthesis inhibitor cycloheximide (Sigma-Aldrich) was used at 10 μg/mL for the indicated times.
Immunohistochemistry
For immunohistochemistry, slides containing sections of mice and human intestinal tissues (4 µm) were deparaffinised, rehydrated and processed as previously described31. Incubation with primary antibody was carried out in a wet chamber overnight at 4 °C. Hakai dilution was 1:700 and FASN dilution was 1:500. Commercial kit for immunohistochemistry was Dako EnVision + System, Peroxidase (EnVision + System, HRP) purchased to Agilent Technologies, Inc. Nuclei were counterstained with Gill´s haematoxylin and mounted with DePeX. Pictures were taken with an Olympus BX50 microscope. Quantification of HRP signals was performed with ImageJ software by analysing 5 photographs of each sample, and the represented results are shown as mean ± SEM.
Cell culture, transfection and construction of lentivirus and inducible cell lines
HCT 116 cell line was cultured in Dulbecco’s Modified Eagle Medium (DMEM) and HT29 cell line was cultured in McCoy's 5A medium. All media were supplemented with 1% penicillin/streptomycin and 10% of heat-inactivated fetal bovine serum (FBS). All cell lines were grown at 37 °C in a humidified incubator with 5% of CO2. Cells were regularly tested for mycoplasma. Plasmids used for transfection were pcDNA-Flag-Hakai, pBSSR-HA-Ubiquitin and pSG-v-Src which were kindly provided by Dr. Fujita (University College London, UK). Transient transfection for Hakai silencing was performed by employing two different siRNA oligonucleotides for Hakai: Hakai-1 (5′-CTCGATCGGTCAGTCAGGAAA-3′) and Hakai-2 (5′-CACCGCGAACTCAAAGAACTA-3′) or siRNA FASN oligonucleotide (5′-GCUACAUGGCCCAAGGGAA-3′). Transfection experiments were performed by using Lipofectamine 2000 Transfection Reagent and Opti-MEM (Thermo Fisher Scientific) media following manufacturer’s protocol. Universal Non-coding siRNA (Sigma-Aldrich, St. Louis, MO, USA) was used as a negative control of transfection. Lentiviral vector system for Hakai expression (SMARTvector Inducible Lentiviral shCBLL1) by doxycycline inducible sh-RNAs particles were acquired in Dharmacon (Horizon Perkin Elmer Group). Lentiviruses were propagated using previously described methods62. Doxycycline (Sigma) was added to the medium at final concentration of 1 µg/ml, and cells were incubated for 72 h. Two different clones of HT29 colon cancer cells transduced with viral supernatant, containing sh-Hakai (sh-Hak1 and sh-Hak2) or sh-control (sh-), were selected and Hakai knockdown efficiency was monitored by western blot.
Interactome analyses
HCT116 cells were used for interactome analysis. Cell pellets were incubated with lysis buffer (20 mM Tris–HCl pH 7,5, 150 mM NaCl and 1% Triton X-100, 125 mg/mL N-ethylmaleimide) in rotation at 4 °C for 30 min. Pre-clearing was performed to eliminate unspecific interactions. For large scale immunoprecipitation, cells were used per point of the experiment (IgG and IP). 40 μL of Dynabeads protein A (Thermo Fisher Scientific) were resuspended in filtered PBS-T 0,1% and incubated with 5 μg of Hakai Bethyl antibody or control IgG 2 h at 4 °C on rotation for beads-antibody coupling. Then, beads and protein sample were incubated overnight at 4 °C on rotation. Samples were loaded into SDS-PAGE gel and band was stained with Sypro-Ruby (Lonza) fluorescent and processed to in gel digestion as previously described63. Samples were reduced in 10 mM dithiothreitol and dissolved in 50 mM ammonium bicarbonate (AMBIC) (Sigma-Aldrich). Then samples were alkylated with iodoacetamide 55 mM dissolved in AMBIC 50 mM (Sigma-Aldrich). The gel pieces were rinsed with AMBIC 50 mM in 50% methanol (HPLC grade, Scharlau) and acetonitrile (HPLC grade, Scharlau) was added for dehydration. Finally, they were dried in a SpeedVac (Thermo Fisher Scientific) and digested with porcine trypsin (Promega) to a final concentration of 20 ng/µL in AMBIC 20 mM for a final overnight incubation at 37 °C. For mass spectrometric analysis, samples were processed by the Proteomics Platform of Biomedical Research Institute of Santiago de Compostela (IDIS). The separation of peptides was done by Reverse phase chromatography. The 400 micro nanoLC liquid chromatography system (Eksigent Technologies, ABSciex) combined with a Triple Time-of-flight (TOF) 6600 high speed mass spectrometer (ABSciex) were used for creating a gradient. Analysis of peptides was performed on the C18CL reverse phase column (150 × 0.30 mm, 3 µm, 120 Å) (Eksigent, ABSciex). The peptides were separated using a 90-min gradient ranging from 2 to 90% of mobile phase B (mobile phase A: 0.1% formic acid, 2% acetonitrile; mobile phase B: 0.1% formic acid, 100% acetonitrile). Acquisition of data was performed on a Triple TOF 6600 system (ABSciex). The TF 1.7.1 analyst software was used for instrument operation (ABSciex). A switching criterion was used for ions greater than the mass/charge ratio (m/z) 350 and less than m/z 1400, with a mass tolerance of 250 ppm, a charge state of 2–5 and a threshold of abundance of more than 200 accounts (cps). The computer analysis of the raw data obtained was carried out using ProteinPilotTM 5.0.1 software (ABSciex). Analysis was performed with the Significance Analysis of INTeractome (SAINT) score SAINTexpress64. Preys with SAINT probability score cut-off of 1 detected by at least two exclusive spectral counts were deemed high confidence Hakai-interacting proteins.
Western blot analysis, real-time quantitative PCR (RT-qPCR) and immunofluorescence staining
For western blot analysis, whole cell extracts were obtained as described previously31. For RT-qPCR, total RNA was extracted using TriPure isolation reagent (Roche,Basel, Switzerland). mRNA levels were analysed in technical triplicates by quantitative RT-PCR, following specifications of reverse retrotranscriptase kit (NZYTech, Lisbon, Portugal). Amplification was performed in a Light Cycler 480 (Roche, Basel, Switzerland) and data was analysed by qBase + analysis software (Biogazelle, Zwijnaarde, Belgium). Primers used for FASN were F′ TTCTACGGCTCCACGCTCTTCC and R′ GAAGAGTCTTCGTCAGCCAGGA. As housekeeping control HPRT primers F′-TGACCTTGATTTATTTTGCATACC and R′-CGAGCAAGACGTTCAGTCCT or RPL13A F′-CTCAAGGTGTTTGACGGCATCC and R′-TACTTCCAGCCAACCTCGTGAG were used. Immunofluorescence was performed as described31. Briefly, cells were fixed with PFA 4% for 15 min and permeabilized with 0.5% Triton X-100/PBS for 15 min. Primary antibodies were incubated for 2 h, at RT and secondary antibody was incubated at RT for 1 h. Nuclear staining was performed using 1:10,000 Hoechst dilution (Life Technologies, Carlsbad, CA, USA). ProLong Gold Antifade Mountant (Life Technologies, Carlsbad, CA, USA) was employed for coverslips mounting. Images were obtained by using fluorescence microscope “Monitorized reflected Fluorescence System” (Olympus).
Immunoprecipitation and ubiquitination assays
For immunoprecipitation experiments, cells were lysed for 20 min in 1 ml of 1% Triton X-100 lysis buffer (20 mM Tris–HCl pH 7.5, 150 mM NaCl and 1% Triton X-100) containing 10 μg/ml leupeptin, 10 μg/ml aprotinin and 1 mM phenylmethanesulphonyl fluoride (PMSF). Supernatants were immunoprecipitated for 2 h with 2 μg of anti-Hakai antibody or anti-HA bound to protein G PLUS-Agarose beads (Santa Cruz Biotechnology, USA), followed by SDS–polyacrylamide gel electrophoresis (PAGE) and western blotting with the indicated antibodies as previously reported. For ubiquitination assays, HCT116 cells were transfected with 0.25 µg Src, 0.75 µg Flag-Hakai, and 0.5 µg HA-ubiquitin using Lipofectamin 2000 (Invitrogen, UK). Cell extracts were obtained in the above lysis buffer used for immunoprecipitation, supplemented with 10 mM N-ethylmaleimide.
Oil-red staining assay
HCT116 and HT29 cells (105) were seeded in 8-well chambers (Millicell EZ SLIDE 8-well glass, Millipore) were washed with 1 × PBS and stained with a freshly prepared Oil Red O (ORO) working solution as described previously33. Staining was observed using light microscope (Olympus BX61). Positively-stained areas were used to quantify lipid accumulation using ImageJ software by analysing 5 photographs. The represented results are shown as mean ± SEM.
Statistical analysis
Shapiro–Wilk test was used to check a normal distribution and Levene test to assess the equality of variances. Statistical significance of data was determined by applying a two-tailed Student t-test or ANOVA depending on the data. Results obtained are expressed as mean ± SD or mean ± SEM. Quantification of human IHQ did not follow a normal distribution therefore we used Kruskal–Wallis with Tukey correction test. Significant differences among the experimental groups indicated in the figures is shown as *P < 0.05, **P < 0.01 ***P < 0.001 and ****P < 0.0001.
Data availability
The datasets generated and/or analysed during the current study are available in the ProteomeXchange repository, accession number PXD029136. Full blots are included in Supplemental Figure file.
Abbreviations
- CAC:
-
Colitis-associated cancer
- CD:
-
Crohn’s disease
- IBD:
-
Inflammatory bowel diseases
- UC:
-
Ulcerative colitis
References
Lasry, A., Zinger, A. & Ben-Neriah, Y. Inflammatory networks underlying colorectal cancer. Nat. Immunol. 17, 230–240. https://doi.org/10.1038/ni.3384 (2016).
Mantovani, A., Allavena, P., Sica, A. & Balkwill, F. Cancer-related inflammation. Nature 454, 436–444. https://doi.org/10.1038/nature07205 (2008).
Rape, M. Ubiquitylation at the crossroads of development and disease. Nat. Rev. Mol. Cell Biol. 19, 59–70. https://doi.org/10.1038/nrm.2017.83 (2018).
Weissman, A. M., Shabek, N. & Ciechanover, A. The predator becomes the prey: Regulating the ubiquitin system by ubiquitylation and degradation. Nat. Rev. Mol. Cell Biol. 12, 605–620. https://doi.org/10.1038/nrm3173 (2011).
Hershko, A., Ciechanover, A. & Varshavsky, A. Basic medical research award. The ubiquitin system. Nat. Med. 6, 1073–1081. https://doi.org/10.1038/80384 (2000).
Livneh, I., Cohen-Kaplan, V., Cohen-Rosenzweig, C., Avni, N. & Ciechanover, A. The life cycle of the 26S proteasome: From birth, through regulation and function, and onto its death. Cell Res. 26, 869–885. https://doi.org/10.1038/cr.2016.86 (2016).
Metzger, M. B., Hristova, V. A. & Weissman, A. M. HECT and RING finger families of E3 ubiquitin ligases at a glance. J. Cell Sci. 125, 531–537. https://doi.org/10.1242/jcs.091777 (2012).
Xiao, Y., Huang, Q., Wu, Z. & Chen, W. Roles of protein ubiquitination in inflammatory bowel disease. Immunobiology 225, 152026. https://doi.org/10.1016/j.imbio.2020.152026 (2020).
Inoue, S. et al. The effect of proteasome inhibitor MG132 on experimental inflammatory bowel disease. Clin. Exp. Immunol 156, 172–182. https://doi.org/10.1111/j.1365-2249.2008.03872.x (2009).
Deng, L., Meng, T., Chen, L., Wei, W. & Wang, P. The role of ubiquitination in tumorigenesis and targeted drug discovery. Signal Transduct Target Ther. 5, 11. https://doi.org/10.1038/s41392-020-0107-0 (2020).
Aparicio, L. A., Valladares, M., Blanco, M., Alonso, G. & Figueroa, A. Biological influence of Hakai in cancer: A 10-year review. Cancer Metastasis Rev. 31, 375–386. https://doi.org/10.1007/s10555-012-9348-x (2012).
Fujita, Y. et al. Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat. Cell Biol. 4, 222–231. https://doi.org/10.1038/ncb758 (2002).
Schneider, M. R. & Kolligs, F. T. E-cadherin’s role in development, tissue homeostasis and disease: Insights from mouse models: Tissue-specific inactivation of the adhesion protein E-cadherin in mice reveals its functions in health and disease. BioEssays 37, 294–304. https://doi.org/10.1002/bies.201400141 (2015).
Bondow, B. J., Faber, M. L., Wojta, K. J., Walker, E. M. & Battle, M. A. E-cadherin is required for intestinal morphogenesis in the mouse. Dev. Biol. 371, 1–12. https://doi.org/10.1016/j.ydbio.2012.06.005 (2012).
Yang, J. et al. Guidelines and definitions for research on epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. https://doi.org/10.1038/s41580-020-0237-9 (2020).
Brabletz, T., Kalluri, R., Nieto, M. A. & Weinberg, R. A. EMT in cancer. Nat. Rev. Cancer 18, 128–134. https://doi.org/10.1038/nrc.2017.118 (2018).
Aparicio, L. A. et al. Clinical implications of epithelial cell plasticity in cancer progression. Cancer Lett. 366, 1–10. https://doi.org/10.1016/j.canlet.2015.06.007 (2015).
Jankowski, J. A. et al. Alterations in classical cadherins associated with progression in ulcerative and Crohn’s colitis. Lab Investig. 78, 1155–1167 (1998).
Gassler, N. et al. Inflammatory bowel disease is associated with changes of enterocytic junctions. Am. J. Physiol. Gastrointest. Liver Physiol. 281, G216-228. https://doi.org/10.1152/ajpgi.2001.281.1.G216 (2001).
Brighenti, E. et al. Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: A new pathway connecting inflammation to cancer. Oncogene 33, 4396–4406. https://doi.org/10.1038/onc.2014.1 (2014).
Barrett, J. C. et al. Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. Nat. Genet. 41, 1330–1334. https://doi.org/10.1038/ng.483 (2009).
Houlston, R. S. et al. Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. Nat. Genet. 40, 1426–1435. https://doi.org/10.1038/ng.262 (2008).
Grill, J. I., Neumann, J., Hiltwein, F., Kolligs, F. T. & Schneider, M. R. Intestinal E-cadherin deficiency aggravates dextran sodium sulfate-induced colitis. Dig. Dis. Sci. 60, 895–902. https://doi.org/10.1007/s10620-015-3551-x (2015).
Figueroa, A. et al. Novel roles of Hakai in cell proliferation and oncogenesis. Mol. Biol. Cell 20, 3533–3542. https://doi.org/10.1091/mbc.E08-08-0845 (2009).
Rodriguez-Rigueiro, T., Valladares-Ayerbes, M., Haz-Conde, M., Aparicio, L. A. & Figueroa, A. Hakai reduces cell-substratum adhesion and increases epithelial cell invasion. BMC Cancer https://doi.org/10.1186/1471-2407-11-474 (2011).
Castosa, R. et al. Hakai overexpression effectively induces tumour progression and metastasis in vivo. Sci. Rep. 8, 3466. https://doi.org/10.1038/s41598-018-21808-w (2018).
Abella, V. et al. miR-203 regulates cell proliferation through its influence on Hakai expression. PLoS ONE 7, e52568. https://doi.org/10.1371/journal.pone.0052568 (2012).
Martinez-Iglesias, O. et al. Hakin-1, a new specific small-molecule inhibitor for the E3 ubiquitin-ligase Hakai, inhibits carcinoma growth and progression. Cancers https://doi.org/10.3390/cancers12051340 (2020).
Dammann, K. et al. PAK1 promotes intestinal tumor initiation. Cancer Prev. Res. 8, 1093–1101. https://doi.org/10.1158/1940-6207.CAPR-15-0205-T (2015).
Sellon, R. K. et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect. Immun. 66, 5224–5231. https://doi.org/10.1128/IAI.66.11.5224-5231.1998 (1998).
Díaz-Díaz, A. et al. Heat shock protein 90 chaperone regulates the E3 ubiquitin-ligase Hakai protein stability. Cancers https://doi.org/10.3390/cancers12010215 (2020).
Franceschini, A. et al. STRING v9.1: Protein-protein interaction networks, with increased coverage and integration. Nucleic Acids Res. 41, D808–D815. https://doi.org/10.1093/nar/gks1094 (2013).
Gang, X. et al. Speckle-type POZ protein suppresses lipid accumulation and prostate cancer growth by stabilizing fatty acid synthase. Prostate 79, 864–871. https://doi.org/10.1002/pros.23793 (2019).
Matsuo, S., Yang, W. L., Aziz, M., Kameoka, S. & Wang, P. Fatty acid synthase inhibitor C75 ameliorates experimental colitis. Mol. Med. 20, 1–9. https://doi.org/10.2119/molmed.2013.00113 (2014).
Consolazio, A. et al. Overexpression of fatty acid synthase in ulcerative colitis. Am. J. Clin. Pathol. 126, 113–118. https://doi.org/10.1309/pubvqndnvqkjvc8m (2006).
Röhrig, F. & Schulze, A. The multifaceted roles of fatty acid synthesis in cancer. Nat. Rev. Cancer 16, 732–749. https://doi.org/10.1038/nrc.2016.89 (2016).
Rashid, A. et al. Elevated expression of fatty acid synthase and fatty acid synthetic activity in colorectal neoplasia. Am. J. Pathol. 150, 201–208 (1997).
Onorati, A. V., Dyczynski, M., Ojha, R. & Amaravadi, R. K. Targeting autophagy in cancer. Cancer 124, 3307–3318. https://doi.org/10.1002/cncr.31335 (2018).
Yalchin, M., Baker, A. M., Graham, T. A. & Hart, A. Predicting colorectal cancer occurrence in IBD. Cancers https://doi.org/10.3390/cancers13122908 (2021).
Cleynen, I. et al. Genetic and microbial factors modulating the ubiquitin proteasome system in inflammatory bowel disease. Gut 63, 1265–1274. https://doi.org/10.1136/gutjnl-2012-303205 (2014).
Ardley, H. C. Ring finger ubiquitin protein ligases and their implication to the pathogenesis of human diseases. Curr. Pharm. Des. 15, 3697–3715. https://doi.org/10.2174/138161209789271807 (2009).
Rodríguez-Alonso, A. et al. Regulation of epithelial-mesenchymal plasticity by the E3 ubiquitin-ligases in cancer. Cancers https://doi.org/10.3390/cancers12113093 (2020).
Shores, D. R., Binion, D. G., Freeman, B. A. & Baker, P. R. New insights into the role of fatty acids in the pathogenesis and resolution of inflammatory bowel disease. Inflamm. Bowel Dis. 17, 2192–2204. https://doi.org/10.1002/ibd.21560 (2011).
Weng, C. H. et al. Epithelial-mesenchymal transition (EMT) beyond EGFR mutations per se is a common mechanism for acquired resistance to EGFR TKI. Oncogene 38, 455–468. https://doi.org/10.1038/s41388-018-0454-2 (2019).
Liu, M. et al. Ajuba inhibits hepatocellular carcinoma cell growth via targeting of β-catenin and YAP signaling and is regulated by E3 ligase Hakai through neddylation. J. Exp. Clin. Cancer Res. 37, 165. https://doi.org/10.1186/s13046-018-0806-3 (2018).
Fujimoto, K. et al. Regulation of intestinal homeostasis by the ulcerative colitis-associated gene RNF186. Mucosal Immunol. 10, 446–459. https://doi.org/10.1038/mi.2016.58 (2017).
Heimerl, S. et al. Alterations in intestinal fatty acid metabolism in inflammatory bowel disease. Biochim. Biophys. Acta 1762, 341–350. https://doi.org/10.1016/j.bbadis.2005.12.006 (2006).
Wei, X. et al. Fatty acid synthase modulates intestinal barrier function through palmitoylation of mucin 2. Cell Host Microbe 11, 140–152. https://doi.org/10.1016/j.chom.2011.12.006 (2012).
Maloy, K. J. & Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature 474, 298–306. https://doi.org/10.1038/nature10208 (2011).
Cenac, N. et al. Role for protease activity in visceral pain in irritable bowel syndrome. J. Clin. Investig. 117, 636–647. https://doi.org/10.1172/JCI29255 (2007).
Yu, Q. et al. E3 ubiquitin ligase RNF183 is a novel regulator in inflammatory bowel disease. J. Crohns Colitis 10, 713–725. https://doi.org/10.1093/ecco-jcc/jjw023 (2016).
Slots, J. Periodontitis: Facts, fallacies and the future. Periodontol. 2000(75), 7–23. https://doi.org/10.1111/prd.12221 (2017).
Zhang, X. et al. m6A regulator-mediated RNA methylation modification patterns are involved in immune microenvironment regulation of periodontitis. J. Cell Mol. Med. 25, 3634–3645. https://doi.org/10.1111/jcmm.16469 (2021).
Breese, E. J. et al. Tumor necrosis factor alpha-producing cells in the intestinal mucosa of children with inflammatory bowel disease. Gastroenterology 106, 1455–1466. https://doi.org/10.1016/0016-5085(94)90398-0 (1994).
Seok, J. et al. Genomic responses in mouse models poorly mimic human inflammatory diseases. Proc. Natl. Acad. Sci. USA 110, 3507–3512. https://doi.org/10.1073/pnas.1222878110 (2013).
Takao, K. & Miyakawa, T. Genomic responses in mouse models greatly mimic human inflammatory diseases. Proc. Natl. Acad. Sci. USA 112, 1167–1172. https://doi.org/10.1073/pnas.1401965111 (2015).
Davis, M. M. A prescription for human immunology. Immunity 29, 835–838. https://doi.org/10.1016/j.immuni.2008.12.003 (2008).
Hayday, A. C. & Peakman, M. The habitual, diverse and surmountable obstacles to human immunology research. Nat. Immunol. 9, 575–580. https://doi.org/10.1038/ni0608-575 (2008).
Mestas, J. & Hughes, C. C. Of mice and not men: Differences between mouse and human immunology. J. Immunol. 172, 2731–2738. https://doi.org/10.4049/jimmunol.172.5.2731 (2004).
Cabrera, O. et al. The unique cytoarchitecture of human pancreatic islets has implications for islet cell function. Proc. Natl. Acad. Sci. USA 103, 2334–2339. https://doi.org/10.1073/pnas.0510790103 (2006).
Frick, A. et al. Overt increase of oxidative stress and DNA damage in murine and human colitis and colitis-associated neoplasia. Mol. Cancer Res. 16, 634–642. https://doi.org/10.1158/1541-7786.MCR-17-0451 (2018).
Naldini, L. et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, 263–267. https://doi.org/10.1126/science.272.5259.263 (1996).
Shevchenko, A. et al. Linking genome and proteome by mass spectrometry: Large-scale identification of yeast proteins from two dimensional gels. Proc. Natl. Acad. Sci. USA 93, 14440–14445. https://doi.org/10.1073/pnas.93.25.14440 (1996).
Teo, G. et al. SAINTexpress: Improvements and additional features in Significance Analysis of INTeractome software. J. Proteomics 100, 37–43. https://doi.org/10.1016/j.jprot.2013.10.023 (2014).
Acknowledgements
This work was supported by Plan Estatal I + D + I 2013−2016, co-funded by the Instituto de Salud Carlos III (ISCIII, Spain) under grant agreements PI18/00121 and PI21/00238 and by Fondo Europeo de Desarrollo Regional (FEDER) “A way of Making Europe”. The project that gave rise to these results has received funding from ”la Caixa” Foundation and the European Institute of Innovation and Technology, EIT (body of the European Union that receives support from the European Union’s Horizon 2020 research and innovation program), un-der the grant agreements LCF/TR/CI19/52460016 and LCF/TR/CC21/52490003. Also supported by Consolidation of Competitive Research (IN607B2020/14) from GAIN from Xunta de Galicia. DRL was supported by a post-specialization fellowship from Fundación Profesor Novoa Santos and a public grant from Deputación de A Coruña (Spain), ADD by FPU contract (FPU014/02837) from Ministerio de Educación Cultura y Deporte (Spain), MQ was supported by supported by Consolidation of Competitive Research (IN607B2020/14) from GAIN from Xunta de Galicia and AR was supported by a predoctoral contract (PRDLC21591RODR) from Fundación Científica AECC/AECC.
Author information
Authors and Affiliations
Contributions
Designed the study D.R.L. and A.F., performed the experiments: D.R.L., M.Q., A.D.D., A.R.A. A.B.A. and M.-E.C. contributed to the interactome analysis. A.C. and G.R. contributed to the human I.H.Q. analysis. C.G. and V.K. hosted and supervised D.R.L. at Medical University of Vienna, and reviewed manuscript. Drafted the article: D.R.L. and A.F. All authors read and approved the final version of the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Roca-Lema, D., Quiroga, M., Khare, V. et al. Role of the E3 ubiquitin-ligase Hakai in intestinal inflammation and cancer bowel disease. Sci Rep 12, 17571 (2022). https://doi.org/10.1038/s41598-022-22295-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-022-22295-w
This article is cited by
-
The implications of FASN in immune cell biology and related diseases
Cell Death & Disease (2024)
-
Interaction between N6-methyladenosine modification and the tumor microenvironment in colorectal cancer
Molecular Medicine (2023)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.