Depletion of Ras Suppressor-1 (RSU-1) promotes cell invasion of breast cancer cells through a compensatory upregulation of a truncated isoform

Gkretsi, Vasiliki; Kalli, Maria; Efstathiades, Christodoulos; Papageorgis, Panagiotis; Papanikolaou, Vassilios; Zacharia, Lefteris C.; Tsezou, Aspasia; Athanassiou, Evangelos; Stylianopoulos, Triantafyllos

doi:10.1038/s41598-019-46575-0

Download PDF

Article
Open access
Published: 11 July 2019

Depletion of Ras Suppressor-1 (RSU-1) promotes cell invasion of breast cancer cells through a compensatory upregulation of a truncated isoform

Vasiliki Gkretsi ORCID: orcid.org/0000-0002-3671-4078^1,2,
Maria Kalli¹,
Christodoulos Efstathiades³,
Panagiotis Papageorgis^1,4,
Vassilios Papanikolaou⁵,
Lefteris C. Zacharia⁶,
Aspasia Tsezou^5,7,
Evangelos Athanassiou⁸ &
…
Triantafyllos Stylianopoulos¹

Scientific Reports volume 9, Article number: 10050 (2019) Cite this article

2126 Accesses
11 Citations
2 Altmetric
Metrics details

Subjects

Abstract

Extracellular matrix (ECM)-adhesion proteins and actin cytoskeleton are pivotal in cancer cell invasion. Ras Suppressor-1 (RSU-1), a cell-ECM adhesion protein that interacts with PINCH-1, thus being connected to Integrin Linked Kinase (ILK), alpha-parvin (PARVA), and actin cytoskeleton, is up-regulated in metastatic breast cancer (BC) samples. Apart from the originally-identified gene (RSU-1L), an alternatively-spliced isoform (RSU-1-X1) has been reported. We used non-invasive MCF-7 cells, expressing only RSU-1L, and highly invasive MDA-MB-231-LM2 expressing both isoforms and generated stable shRNA-transduced cells lacking RSU-1L, while the truncated RSU-1-X1 isoform was depleted by siRNA-mediated silencing. RSU-1L depletion in MCF-7 cells resulted in complete abrogation of tumor spheroid invasion in three-dimensional collagen gels, whereas it promoted MDA-MB-231-LM2 invasion, through a compensatory upregulation of RSU-1-X1. When RSU-1-X1 was also eliminated, RSU-1L-depletion-induced migration and invasion were drastically reduced being accompanied by reduced urokinase plasminogen activator expression. Protein expression analysis in 23 human BC samples corroborated our findings showing RSU-1L to be upregulated and RSU-1-X1 downregulated in metastatic samples. We demonstrate for the first time, that both RSU-1 isoforms promote invasion in vitro while RSU-1L elimination induces RSU-1-X1 upregulation to compensate for the loss. Hence, we propose that both isoforms should be blocked to effectively eliminate metastasis.

The extracellular-regulated protein kinase 5 (ERK5) enhances metastatic burden in triple-negative breast cancer through focal adhesion protein kinase (FAK)-mediated regulation of cell adhesion

Article Open access 12 May 2021

Pleiotropic tumor suppressor functions of WWOX antagonize metastasis

Article Open access 17 April 2020

SHP2 is a multifunctional therapeutic target in drug resistant metastatic breast cancer

Article Open access 08 October 2020

Introduction

Breast cancer (BC) is the most frequent type of cancer in women. When BC is characterized as non-invasive or in situ, the prognosis is far better than when it is characterized as metastatic or invasive. In fact, over 90% of cancer mortality is associated with disseminated disease rather than the primary tumor^1,2,3. Thus, gaining more knowledge on the molecular mechanism of metastasis and the key players involved might provide new insights on how to inhibit it. Cancer metastasis is a multi-step process where tumor cells first detach from the primary site, degrade surrounding matrix and intravasate into blood or lymphatic vessels. Cancer cells are then attracted by preferred target tissues where they adhere, migrate, and invade through surrounding matrix to finally establish a colony². Integrins and extracellular matrix (ECM)-related adhesion proteins play an important role in all stages of the metastatic process facilitating the communication between cells and the ECM⁴. They act as adaptor proteins being involved in multiple protein-protein interactions⁵, while being also connected directly or indirectly to the actin cytoskeleton. This connection to actin cytoskeleton allows cells to respond better to mechanical or other stimuli by a number of ways including cell shape modulation or alterations in the migration patterns. Importantly, most of them are involved in cancer progression and metastasis as cell-ECM adhesion disruption is one of the first steps in the process^4,6,7,8.

Ras Suppressor-1 (RSU-1)

gene was originally identified to inhibit Ras-dependent oncogenic transformation⁹, and it was later shown to be localized to cell-ECM adhesions through its physical interaction with Particularly Interesting New Cysteine-Histidine protein (PINCH-1) which was proved both in mammalian cells¹⁰ and in the cells of Drosophila melanogaster¹¹ proving that the interaction is phylogenetically conserved. PINCH-1, in turn, participates in the formation of a stable ternary protein complex at cell-ECM adhesions along with ILK and parvins¹², connecting the ECM with actin cytoskeleton. Interestingly, in Ras-transformed cells the association of RSU-1 protein with the PINCH1-ILK complex is greatly reduced, indicating that RSU-1 may function through an independent pathway in cancer¹³. Although RSU-1 was linked to Ras-dependent oncogenic transformation^9,14 and was shown to have anti-tumorigenic effects suppressing cancer cell growth^9,15,16,17, its expression level and role in cancer has yet to be defined. One study showed that RSU-1 gene is frequently missing in human hepatocellular carcinoma¹⁸, while in another study RSU-1 mRNA expression was found to be significantly up-regulated in metastatic colorectal tumor samples versus healthy controls or primary samples¹⁹. It has also been shown that RSU-1 expression was increased in human BC samples compared to the control which consisted of the patient’s own normal adjacent tissue. In fact, RSU-1 was found to be more dramatically upregulated in metastatic BC samples compared to non-metastatic (in situ)²⁰. Notably, RSU-1 was upregulated in aggressive cell lines of BC²⁰ and hepatocellular carcinoma²¹. Moreover, meta-analysis of Affymetrix microarray gene expression data from 5143 BC patients showed that although elevated RSU-1 mRNA expression was not correlated with overall survival, it was correlated with poor prognosis both in terms of distant metastasis-free survival and remission-free survival²². These data indicate that RSU-1 may be involved in BC metastasis, although the underlying mechanism is still vague.

Interestingly, apart from the originally identified RSU-1 protein of 33KDa (RSU-1L herein, NCBI Reference Sequence: NM_012425.3), there is another alternatively-spliced isoform of 29KDa (RSU-1-X1 herein) reported to be present in more aggressive human gliomas²³. In fact, there is only one study to date on the role of the truncated RSU-1 isoform¹³, demonstrating that RSU-1-X1 (RSU-1J at the time, but RSU-1 variant X1 according to NCBI, Reference Sequence: XM_005252552.4) does not bind to PINCH-1 and promotes cell migration (See Fig. 1a for comparison of the two isoform sequences).

In the present study, we utilized two BC cell lines of different invasive capacity, namely MCF-7 cells and MDA-MB-231-LM2 cells²⁴ to investigate the role of the two RSU-1 isoforms in BC cell invasion. Our aim was to test if the two isoforms act in concert to exert their action on cell invasion, what is the relationship between them and what happens if one of them is missing. Finally, we validated our findings using human BC samples that expressed differential levels of the two RSU-1 isoforms.

Results

Depletion of RSU-1L from MDA-MB-231-LM2 cells leads to upregulation of the truncated RSU-1-X1 isoform

Intrigued by our previous work showing that siRNA-mediated silencing of RSU-1, using a commercially available pool of siRNAs that targets both isoforms, leads to reduced invasive capacity of BC cells accompanied by inhibition of urokinase Plasminogen Activator (uPA), and metalloproteinase-13 (MMP-13)²², we set out to further investigate the role of RSU-1 isoforms in BC cell metastasis. First, using a bioinformatics approach, we took advantage of Kablammo, a web-based application that produces interactive, vector-based visualizations of sequence alignments generated by NCBI BLAST in order to compare the sequences of the two RSU-1 isoforms. As shown in Fig. 1a, RSU-1-X1 lacks a portion of the RSU-1L sequence and specifically nucleotides 598–731 (133 bp). In this figure, the trapezoid drawn between the bars indicates the portions of the sequences that align to each other, while the white area corresponds to the missing sequence.

To study the role of the two isoforms, we decided to silence their expression. However, as siRNA-mediated gene silencing presented several technical constrictions due to its transient nature, and in order to facilitate our study, stable short hairpin-RNA (shRNA)-infected cell lines were generated to continuously express RSU-1L shRNA, thus inhibiting the expression of the long RSU-1 isoform. A scrambled control shRNA (S shRNA) containing a scrambled sequence that does not target any gene was used as our control sample.

We tested the efficiency of the silencing approach by Real Time PCR and immunoblotting in the low-invasiveness MCF-7 cells and the highly invasive MDA-MB-231-LM2 cells. MDA-MB-231-LM2 cells represent a highly metastatic variant of the parental MDA-MB-231 cells, which express both RSU-1 isoforms²² and have been shown to efficiently colonize the lungs when implanted in the mammary fat pad of mice²⁵. MCF-7 cells express only one RSU-1 isoform (RSU-1L) as RSU-1-X1 is only detected by the very sensitive method of Real Time PCR at low levels while MDA-MB-231-LM2 cells also express the truncated RSU-1-X1 form (Fig. 1b). Using an shRNA-infection approach, RSU-1L was indeed effectively silenced in both cell lines both at the protein (Fig. 1b, compare lane 2 to 1 and 4 to 3) and the mRNA level (Fig. 1c,d). Interestingly however, when RSU-1L was silenced in MDA-MB-231-LM2 cells, RSU-1-X1 was dramatically upregulated as seen by the appearance of a second shorter band in this sample (Fig. 1b). Increased expression of RSU-1-X1 at the mRNA level was also observed (Fig. 1e, presumably due to an attempt of the cell to compensate for RSU-1L loss.

RSU-1L depletion dramatically decreases tumor spheroid invasion in MCF-7 cells but leads to increased invasion of MDA-MB-231-LM2 spheroids

Cells were then subjected to tumor spheroid invasion assay in order to test their ability to invade through three dimensional (3D) collagen gels following depletion of RSU-1L. Results were striking, showing that in tumor spheroids formed from MCF-7 cells lacking RSU-1L, their invasion capacity was completely abolished (Fig. 2, compare a-b to c-d, and Fig. 2i) whereas, invasion of MDA-MB-231-LM2 spheroids lacking RSU-1L was dramatically increased (Fig. 2, compare e-f to g-h, and Fig. 2i). Our findings indicate that the two cell lines have differential response to RSU-1L depletion with regard to tumor spheroid invasion.

Silencing of both RSU-1 isoforms in BC lines

Based on these results, we hypothesized that in highly invasive MDA-MB-231-LM2 cells, depletion of RSU-1L triggers the activation of the truncated RSU-1-X1 isoform to compensate for the loss of RSU-1L function and for this reason its depletion promotes tumor spheroid invasion rather than inhibits it (Fig. 2).

To test our hypothesis, we utilized siRNA-mediated silencing targeting the truncated RSU-1-X1 isoform to transfect the cell lines that stably expressed RSU-1L shRNA thus, achieving double knock-down of both RSU-1 isoforms. As shown in Fig. 3, RSU-1L was stably silenced in these cells (Fig. 3a, compare lanes 3 and 4 to 1 and 2 for MCF-7, and 7 and 8 to 5 and 6 for MDA-MB-231-LM2 and Fig. 3d,e, solid black and striped bars). When RSU-1L was depleted in MDA-MB-231-LM2 cells, RSU-1-X1 was upregulated (Fig. 3a, lanes 7 and 8 and Fig. 3f, solid black bar). However, upon RSU-1-X1 siRNA-mediated silencing, RSU-1-X1 was reduced (Fig. 3a, compare lane 8 to lane 7 and Fig. 3f, solid grey and striped bars compared to the white bar).

Both RSU-1 isoforms regulate the expression of ILK, PINCH-1 and PARVA

RSU-1L protein is known to bind to PINCH-1 at the cell-ECM adhesion sites, being connected to the ILK-PINCH-PARVA tertiary complex at cell-ECM adhesions¹⁰, while RSU-1-X1 isoform is postulated to bind poorly or not at all to PINCH-1¹³, which means that it does not actively compete with RSU-1L for PINCH-1 binding and therefore we wouldn’t expect its silencing to have a dramatic effect on PINCH-1 expression. Thus, we set out to test whether silencing one of the RSU-1 isoforms or both would affect the expression of the proteins comprising the PINCH-ILK-PARVA complex in BC cells. MCF-7 cells that express almost exclusively the long RSU-1L isoform offer a more straightforward explanation for the effect of silencing one of the RSU-1 isoforms on PINCH-ILK-PARVA expression. As shown in Fig. 3, RSU-1X1 silencing in both cells lines resulted in downregulation of all three members of the PINCH-ILK-PARVA complex (Fig. 3b,c, compare lanes 1 to 2 for MCF-7 and 5 to 6 for MDA-MB-231-LM2 noting that in 3b lanes 1 and 5 are underloaded as judged by β-actin expression, along with Fig. 3g–i, compare solid gray to white bars). Furthermore, RSU-1L silencing in both cell lines leads to reduced PINCH-1 expression regardless of the presence or absence of the truncated RSU-1X1 isoform (Fig. 3b, compare lanes 3 and 4 to 1 and 2, and lanes 7 and 8 to 5 and 6 for PINCH-1 protein expression, as well as Fig. 3h, solid black and striped bars compared to white for mRNA expression). With regard to ILK and PARVA, RSU-1L silencing reduces their expression in MCF-7 cells (Fig. 3b, compare lane 3 to 1 for ILK and PARVA, as well as Fig. 3g,i, compare solid black bars to white ones) but increases it in MDA-MB-231-LM2 cells (Fig. 3b, compare lane 7 to 5 for ILK and PARVA, as well as Fig. 3g,i, compare solid black bars to white bars). Interestingly, concurrent silencing of the truncated isoform reverses this effect (Fig. 3b, compare lane 8 to 7 for ILK and PARVA, as well as Fig. 3g,i, striped bars compared to solid black bars) indicating that the increase was likely related to upregulation of RSU-1X1 expression.

Increased migration of highly invasive MDA-MB-231-LM2 cells lacking RSU-1L is significantly reduced upon silencing of the second RSU-1 isoform, RSU-1-X1

Using the experimental set-up described above, MCF-7 and MDA-MB-231-LM2 cells expressing both isoforms (transfected with the Scrambled SshRNA + Non Specific Control-NSC for the siRNA approach), only one (RSU-1L shRNA + NSC or SshRNA + RSU-1-X1siRNA) or none (RSU-1L shRNA + RSU-1-X1 siRNA) of the RSU-1 isoforms were subjected to transwell migration assay. As shown in Fig. 4, migration of MCF-7 cells was significantly reduced when one of the RSU-1 isoforms was missing (Fig. 4b,c, compared to 4a) but was dramatically abolished when both isoforms were silenced (Fig. 4d,i). In MDA-MB-231-LM2 cells, depletion of RSU-1-X1 lead to reduced cell migration (Fig. 4f, compared to 4e), depletion of RSU-1L lead to increased cell migration (Fig. 4g compared to 4e,i), while depletion of both was able to partially reverse the increased cell migration observed due to RSU-1L silencing (Fig. 4h compared to 4g,i).

Increased invasion of RSU-1L-depleted MDA-MB-231-LM2 cells is significantly reduced upon silencing of the second RSU-1 isoform, RSU-1-X1

Similar results were obtained when the traditional transwell invasion assay was performed. MCF-7 cells, which are considered to be low-invasive, showed an effect only when both isoforms were missing. More specifically, as demonstrated in Fig. 5, cell invasion was not dramatically affected in MCF-7 cells lacking RSU-1X1 (Fig. 5b compared to 5a and 5i, solid gray bar) or RSU-1L (Fig. 5c compared to 5a and 5i, solid black bar), perhaps due to the fact that the invasive capacity of these cells is already too low, while depletion of both isoforms completely abolished cell invasion (Fig. 5d compared to 5a–c and 5i, striped bar). In the highly invasive MDA-MB-231-LM2 cells, cell invasion was reduced upon RSU-1X1 silencing (Fig. 5f compared to 5e and 5i, gray bar) and enhanced when only RSU-1L was missing (Fig. 5g compared to 5e, and 5i, solid black bar), but was dramatically impaired when both isoforms were silenced (Fig. 5h,i, striped bar), indicating that RSU-1-X1 inhibition has the potential to reverse the effect of RSU-1L silencing on cell invasion.

To verify these results in 3D, we performed a tumor spheroid invasion assay for the same experimental groups in the highly invasive MDA-MB-231-LM2 cell. To do that, stable cell lines lacking RSU-1L were transiently transfected with NSC siRNA or RSU-1-X1 siRNA, tumor spheroids were formed and the next day they were embedded in collagen I gels where they were left to invade in 3D. As the transfection period limit for optimal siRNA efficiency is 72 h, spheroids were left to grow for only 24 h, limiting their size (compared to the better formed spheroids in Fig. 2 and affecting their morphology). Nevertheless, the results of the tumor spheroid invasion assay in MDA-MB-231-LM2 cells confirmed the transwell invasion results, demonstrating that depletion of RSU-1-X1 inhibited spheroid invasion (Fig. 6, compare e and f to a and b, and i, gray bar), and depletion of RSU-1L enhanced spheroid invasion (Fig. 6, compare c and d to a and b, and i, solid black bar). Notably, depletion of both isoforms reduced invasion compared to the RSU-1L-depleted spheroids but did not abolish it (Fig. 6, compare g and h to a and b, and i, striped bar). Furthermore, expression of uPA, a protease that has been fundamentally implicated in matrix degradation and cancer cell invasion and metastasis²⁶ and it was previously shown to be affected by RSU-1 silencing²², follows the same pattern as spheroid invasion (Fig. 6j).

RSU-1L and RSU-1-X1 are differentially expressed in metastatic and in situ human BC samples with RSU-1L being upregulated in metastatic and RSU-1-X1 being downregulated in the same samples

To better comprehend the role of each one of the RSU-1 isoforms in BC metastasis, we proceeded to test their expression in total cell lysates isolated from BC patients with in situ or metastatic tumors, forming metastasis to at least one lymph node, compared to respective normal adjacent tissue for each tumor. It has been shown that RSU-1L is upregulated in metastatic BC samples compared to in situ²⁰ but no information was obtained regarding the expression of the RSU-1-X1 isoform. In the present study, we evaluated the expression of both RSU-1 isoforms at the protein level and, as shown in Fig. 7, RSU-1L was dramatically upregulated in metastatic samples (Fig. 7a, compare lanes 4, 6 and 8 to 3, 5 and 7, as well as Fig. 7b), while RSU-1-X1 had the exact opposite expression pattern, being upregulated in in situ (Fig. 7a, compare lane 2 to 1, as well as Fig. 7c) and downregulated in metastatic BC samples (Fig. 7a, compare lanes 4, 6 and 8 to 3, 5 and 7 for RSU-1-X1, as well as Fig. 7c).

Information on the patients’ age, family history of BC, height, weight, body-mass-index (BMI), age of menarche and menopause, number of pregnancies, smoking habits, grade, infiltration of the blood vessels, nerves, skin or nipple, pathology evaluation, tumor diameter, status of estrogen receptors (ER), progesterone receptors (PR), HER2/neu, and lymph node metastasis (Supplementary Table 3) was also available. Interestingly, all samples with elevated RSU-1L and reduced RSU-1-X1 were from women with no family history of BC who had had more than one pregnancies and exhibited lymph node metastasis. These findings in human BC samples provide a clinical insight and corroborate our results in the two BC cell lines highlighting the importance of RSU-1 in BC cell metastatic behavior.

Discussion

Although RSU-1 was connected to Ras-mediated oncogenic transformation^9,14, its expression in cancer tissues, and its association to metastasis are still vague. Several reports have demonstrated upregulation of RSU-1 in some cancer types, such as metastatic colon cancer¹⁹, metastatic breast cancer²⁰, and hepatocellular carcinoma cells²¹. All the above reports, however, refer to the long RSU-1L isoform. Regarding the truncated RSU-1-X1 form, there are only two reports so far; one that comments on its expression in high grade gliomas²³, and another one reporting its detection in tumor cell lines with high levels of activated Ras¹³. Regarding the effect of the RSU-1 isoforms in cancer cell migration, the study by Dougherty et al.¹³, showed that RSU-1L inhibits it, perhaps through binding to the PINCH-ILK-PARVA complex, whereas RSU-1-X1 promotes it. In the present study, we defined, for the first time, the connection between the two RSU-1 isoforms. We demonstrated that depletion of RSU-1L using an shRNA-mediated approach completely abolishes spheroid invasion in MCF-7 cells (Fig. 2a–d,i) that express almost exclusively this isoform (Fig. 1b) indicating that RSU-1L by itself promotes cell invasion. Similarly, silencing of RSU-1-X1 in MCF-7 cells by an siRNA-mediated approach led to inhibition of cell migration (Fig. 4) also pointing to the direction that RSU-1-X1 by itself promotes metastatic properties. However, it had no significant effect on MCF-7 cell invasion, perhaps due to the fact that MCF-7 are cells of low-invasiveness which means that the detected invading cells were too few to reach statistical significance. It should be noted though that despite the fact that MCF-7 cells do not seem to express RSU-1X1 isoform at the protein level (as evident by immunoblotting analysis, e.g. Figs 1b, 3a), they do have detectable levels of RSU-1X1 mRNA expression as seen by the more sensitive and quantitative method of real time PCR analysis (Figs 1f, 3d), and that is why RSU-1X1 silencing has an effect on cell migration (Fig. 4) and invasion when RSU-1L is also depleted (Fig. 5, striped bar).

In accordance with findings in MCF-7 cells, RSU-1X1 silencing in highly invasive MDA-MB-231-LM2 cells severely impaired cell migration (Fig. 4), and cell invasion (Figs 5, 6). However, depletion of RSU-1L from MDA-MB-231-LM2 cells had opposite effects inducing a dramatic increase in tumor spheroid invasion (Fig. 2e–h,i). Notably, we also noticed a concurrent upregulation of RSU-1-X1 isoform upon RSU-1L depletion (Fig. 1b, lane 4 compared to lane 3, and 1e). Thus, we hypothesized that the cell upregulates RSU-1-X1 in an attempt to compensate for RSU-1L loss and that explains the observed increase in spheroid invasion (Fig. 2).

Hence, siRNA-mediated silencing of RSU-1-X1 in cells that already lack RSU-1L showed diminished cell migration (Fig. 4), and cell invasion (Figs 5, 6), which was also correlated with reduced uPA expression (Fig. 6j). It should be noted, however, that although the effect of double silencing on transwell cell invasion was dramatic showing significantly reduced invasion (Fig. 5), the effect on cell migration (Fig. 4) and tumor spheroid invasion (Fig. 6) was significantly reduced compared to RSU-1L depletion alone, but was not statistically significant compared to that of the control cells. This can be easily explained by the efficiency of silencing in each case. As expected depletion of RSU-1L was more efficient (Figs 1, 3) as it was shRNA-based stable infection whereas depletion of RSU-1-X1 was less efficient as it was mediated by transient siRNA transfection. Therefore, rendering the effect of RSU-1-X1 depletion less strong.

Moreover, results from the protein expression analysis in human BC samples verified our hypothesis that RSU-1L by itself is metastasis-promoting. That is why RSU-1L increases in metastatic human BC samples (Fig. 7a, compare lanes 4, 6 and 8 to 3, 5 and 7, as well as Fig. 7c). RSU-1-X1, in turn, is increased when RSU-1L is reduced and its increase likely leads to increased cell invasion, which also indicates that it is metastasis-promoting. However, RSU-1-X1 decreases in human metastatic samples (Fig. 7a, compare lanes 4, 6 and 8 to 3, 5 and 7 for RSU-1-X1, as well as Fig. 7c). Although there was some variation in expression among the 23 human BC samples tested by immunoblotting, as it is anticipated when dealing with patient samples, the results were overall consistent, as shown in the quantification analysis of the immunoblots (Fig. 7b,c). In general, high levels of RSU-1L are associated with low levels of RSU-1X1 and vice versa, which indicates a negative regulation between the two isoforms and it could suggest that the cell always needs the expression of one RSU-1 isoform, that is why it increases the expression of one when the other is lost as a compensation mechanism.

Moreover, even though it cannot be confirmed that cancer cells are not the only cell type that contributes to the expression of RSU-1 isoforms in the human samples, as other cells such as stromal cells, may also contribute at a smaller degree, these findings in human BC samples provide a clinical insight and corroborate our in vitro findings emphasizing the significance of RSU-1 in BC cell metastasis.

Regarding the interplay between RSU-1 and the PINCH-ILK-PARVA complex, we show that RSU-1X1 silencing in both cells lines results in downregulation of all three members of the PINCH-ILK-PARVA complex (Fig. 3b,c,g–i), suggesting a positive regulation of the complex by this isoform. As for the effect of RSU-1L silencing on PINCH-1 expression, it seems that stable depletion of RSU-1L in both cell lines reduces PINCH-1 expression regardless of the presence or absence of RSU-1X1 isoform (Fig. 3b,h). This appears to be opposite from the finding of our previous work in which RSU-1 silencing promoted PINCH-1 expression²⁰. A possible explanation could be related to the RSU-1 expression levels. In the previous study²⁰ both RSU-1 isoforms where transiently silenced while in the present work we stably and efficiently eliminated only RSU-1L. Nevertheless, this is something that definitely needs to be investigated and clarified in more detail in the future.

With regard to ILK and PARVA, RSU-1L silencing reduces their expression in MCF-7 cells (Fig. 3b,g,i) but increases it in MDA-MB-231-LM2 cells (Fig. 3b,g,i). Although, this may initially sound contradictory, it, in fact, validates our hypothesis, since depletion of RSU-1L leads to upregulation of RSU-1X1 which in turn positively regulates ILK and PARVA thus promoting their expression. That is why double knock-down of both isoforms reverses this effect (Fig. 3b,g,i).

Based on our results, we propose a model, a summary of which is diagrammatically depicted in Fig. 7d. RSU-1 isoforms are tightly regulated in cancer, both having metastasis-promoting properties through activation of uPA and by inducing the expression of PINCH-ILK-PARVA complex. Furthermore, RSU-1L exhibits a suppressive effect on RSU-1-X1, which means that when RSU-1L is lost, RSU-1-X1 is upregulated to compensate for this loss, activating uPA and the PINCH-ILK-PARVA complex (Fig. 7d). Hence, in order for metastasis to be eliminated both isoforms need to be blocked.

The present work highlights the importance of RSU-1 isoforms in BC cell metastasis paving the way for the use of RSU-1 protein as a metastasis biomarker and/or potent therapeutic target to treat metastasis. Evidently, several questions need to be answered; for instance, it needs to be clarified whether the expression of the two isoforms correlates with tumor grade, which could render RSU-1 a BC biomarker or whether RSU-1 expression has similar significance in other types of cancer. Moreover, the molecular mechanism of RSU-1 action as well as its interactors needs to be investigated further. Finally, the effect of blocking the two isoforms in preclinical models of cancer would potentially offer insights into its use as a therapeutic target against BC metastasis. In fact, identification of blocking peptides or inhibitors of RSU-1 has the potential to lead to novel therapeutic approaches that will ultimately improve overall survival of cancer patients dealing directly with metastasis.

Methods

BC cell lines

BC cell line MCF-7 was purchased from ATCC, while MDA-MB-231-LM2 cells were kindly provided by Dr. Joan Massague, Memorial Sloan Kettering Cancer Center²⁴. All cells were grown in Dulbecco’s Modified Eagle Medium supplemented with 10% Fetal Bovine Serum, 1% Glutamine and 1% Penicillin/Streptomycin, and incubated in a CO₂-incubator at 37 °C²². All cell culture reagents were purchased from Invitrogen Life Technologies²².

Plasmid construction and lentiviral-mediated shRNA transduction

To construct a lentiviral vector expressing small hairpin RNA (shRNAs) against RSU-1L, we used the AgeI/EcoRI-digested pLKO.1-puro vector ligated with 58 base pair-oligos²⁷. The forward oligo sequence for RSU-1L shRNA construct is 5′CCGGGCCAGAAGCAGGTATTCAAAGCTCGAGCTTTGAATACCTGCTTCTGGCTTTTTG-3′ while the reverse oligo sequence is 5′AATTCAAAAAGCCAGAAGCAGGTATTCAAAGCTCGAGCTTTGAATACCTGCTTCTGGC -3′. Ligated plasmids were transformed into XL10 gold competent bacteria and selected on ampicillin-containing LB agar plates (100 μg/mL). Single colonies were grown overnight in LB broth and plasmids were isolated using a NucleoSpin_PlasmidQuickPure kit (Macherey–Nagel)²⁸. The presence of each insert was tested by PCR (KAPA Biosystems) using pLKO.1 Forward primer: GGAATAGAAGAAGAAGGTGGA and RSU-1L Reverse primer: GCCAGAAGCAGGTATTCAAAG. The sequence of the construct was verified by DNA sequencing (Macrogen, Netherlands). Establishment of cells stably expressing RSU-1L shRNA or a vector containing scrambled shRNA (Scrambled shRNA-SshRNA control from Addgene) was performed by lentiviral-mediated transduction. Briefly, 293 T cells were co-transfected with 5 μg pLKO-SshRNA or pLKO-shRSU-1L plasmids, and specifically 1 μg pMD2.G (envelope plasmid) and 3 μg psPAX2 (packaging plasmid). After 48 h, cells were transduced with virus-containing medium in the presence of 10 μg/ml polybrene (Millipore), selected with 2 μg/ml puromycin (Acros organics), and pooled for further assays²⁷.

siRNA Transfection

BC cells (MCF-7 and MDA-MB-231-LM2) stably expressing either the scrambled SshRNA control or the RSU-1L-shRNA were transfected with 100 nM non-specific control (NSC) siRNA or siRNA against RSU-1X1 using the Lipofectamine 2000 reagent (Invitrogen Life Technologies). The siRNAs were obtained from Eurofins Genomics/VBC. As NSC, a sequence of 47% GC NSC was used while the sequence targeting RSU-1-X1 was 5′AGAACUAGCCUCUACGGCAUU 3′. Cells were harvested 48 h post-transfection and silencing efficiency was verified by western blot and real time PCR as specified in each experiment²².

RNA isolation and Real Time PCR

Total RNA was extracted from BC cells using Trizol (Invitrogen) and purified using RNeasy mini kit (Qiagen)²². RNA concentration and purity was assessed using the IMPLEN nanophotometer. Pure RNA samples (with a A260/A280 ratio close to 2.00 but not lower than 1.80) were transcribed to cDNA using Superscript III Reverse Transcriptase (Invitrogen) following the company’s instructions²² and using 1 μg of RNA as starting material. The resulting cDNA was diluted 1:10 before being used for quantification of gene expression by real-time PCR using β-actin as reference gene. At least six replicates were run for each sample (three with the test primer and three with the β-actin primer) and each reaction had a total volume of 10 μl which included 1 μl of cDNA, 1 μl of the respective primer mixture (forward and reverse primer, 10 μM each), 3 μl of dH₂O and 5 μl SYBR green reagent (Kapa SYBR Fast qPCR Master Mix-2x, Kapa Biosystems, Cat.#KR0389). Replicates were placed in a 96-well PCR plate (4titude) and the real time PCR reaction was performed in a CFX96 thermal cycler (BioRad). The real time PCR conditions were the same for all genes tested and included an initial step of 2 min incubation at 95 °C. This was followed by incubation at 95 °C for 2 sec, 60 °C for 20 sec and 72 °C for 30 sec, with 2–3 steps being repeated for 39 cycles. After the completion of the PCR, melting curves were monitored to ensure that one peak is detected and amplified. At least 3 independent experiments were performed. All primers used are shown in Supplementary Table 1. Quantification of relative gene expression was performed using the ΔΔCt method, where data were log transformed and analyzed using standard methodology²⁹. Cells infected with S-shRNA SshRNA + Non Specific control (NSC) were used as calibrators, as specified in each experiment.

Protein isolation and Western blot analysis

For protein expression analysis, standard immunoblotting protocol was followed, as described previously²². Total cell lysates were obtained from cell pellets using 1% sodium dodecyl sulfate (SDS) in RIPA buffer (20 mMTris/Cl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1% TX-100, 0.25% sodium deoxycholated, 0.6–2 μg/ml aprotinin, 10 μM leupeptin, 1 μM pepstatin)²². Protein concentration was determined using the Bicinchoninic Acid (BCA) protein assay kit from Pierce (Cat.#23225) and absorbance was measured using an RT-2100C Rayto microplate reader at 562 nm. An amount of 20 μg of protein (that did not exceed 35 μl in volume) from each cell lysate was run on a 10–12% polyacrylamide gel (or 15% gel for human samples presented in Fig. 7) at 200 Volts for 40–60 min. Transfer to a PVDF membrane (Millipore) was achieved at 15Volts for 20 min using the BioRad Semi-dry transfer system (BioRad). Membrane was blocked in 5% non-fat milk in Tris-buffered saline-tween (TBST) buffer for 1 h and was then incubated with appropriate antibodies³⁰. The exact antibodies used, as well as their working dilutions and incubations times are provided in Supplementary Table 2. Signal was visualized using chemiluminescent substrate from Pierce (SuperSignal West Femto Maximum Sensitivity Substrate, Cat.#34095) and Fuji Biomax light films (Cat.# RX1318) were developed manually using Carestream Kodak autoradiography GBX developer/replenisher (Cat.#P7042) and fixer/replenisher (Cat.#P7167) according to the company’s instructions. Films were then scanned using an HP Scanjet G4010 scanner and images were analyzed in Adobe Photoshop. Color was discarded and images were converted to grayscale. When needed, contrast was used on the entire image to enhance image clarity. No other image manipulation was performed²². Most blots were sequentially reprobed with suitable antibodies as indicated in each figure legend, without stripping. Each blot was reprobed with an antibody for loading (β-actin, GAPDH, or β-tubulin) and up to four (4) other relevant antibodies without stripping, as indicated. The full length blots are provided in the supplementary file of the manuscript (Supplementary Figs 1–5).

Cell migration assay

Cell migration was assessed using the standard transwell migration assay. Equal number of cells per condition were suspended in 0.5 ml of plain DMEM and added to the upper chamber of the 8-μm pore diameter transwell motility chamber (2 × 10⁴ cells/chamber) while complete serum-containing medium (10% Fetal Bovine Serum) was added to the bottom of the transwell serving as chemoattractant. After incubation at 37 °C for 18 h, cells on the upper surface of the membrane were removed. The membranes were fixed with 4% paraformaldehyde (PFA) and the cells on the undersurface were stained with 0.1% Crystal Violet for 30 min. Finally, transwells were washed with distilled water and pictures were taken from five randomly selected microscopic fields using a Nikon Eclipse optical microscope equipped with a digital camera³¹. Cells in all 5 fields were counted. Experiments were run in duplicates and at least two independent experiments were performed.

Cell invasion assay

Transwell invasion assay³² was analyzed using the BD biosciences tumor invasion system (with matrigel coated inserts). Briefly, cells were trypsinized and suspended in DMEM containing 1 mg/mL BSA at a concentration of 5 × 10⁵ cells/ml while complete serum-containing medium was placed at the bottom chamber. Cells were incubated at 37 °C for 18 h and non-invading cells that remained on the upside of the filter were removed. The invading cells were fixed with PFA, stained with crystal violet and photographed under a Nikon Eclipse optical microscope equipped with digital camera. The number of invading cells was quantified by counting cells from five randomly selected microscopic fields under the 10x objective³³.

Tumor spheroid invasion assay

Tumor spheroids were formed using the hanging drop technique^34,35,36. A cell suspension of 2.5 × 10⁴ cells/ml was prepared and hanging drops were made using 20 μl from this suspension. Thus, hanging drops containing 500 cells each were placed on the inside of the cover of a culture dish and incubated at 37 ^oC²². Formed spheroids were transferred into wells containing 1 mg/ml 3D collagen I gel (Collagen I high concentration solution, Corning Cat.# 354249) using sterile glass Pasteur pipettes and left to grow for the designated time (5 h for MDA-MB-231-LM2 cells and 18 h for MCF-7 cells). The transfer was performed three days later (for SshRNA or RSU-1L shRNA stable cells) (Fig. 2) or the next day (for cells transiently expressing NSC, or RSU-1-X1 siRNA) (Fig. 5). The diameter of the spheroids was monitored by a Nikon Eclipse optical microscope equipped with a digital camera. Pictures were taken immediately (time zero) and at the end of the designated time period. Cell invasion through the surrounding collagen was measured using the ImageJ software and the final spheroid size (average of the major and minor axis length) was compared to the initial size at time zero^22,37. In experiments where cells were subjected to RSU-1-X1 siRNA-mediated silencing, siRNA transfection was performed 24 h prior to formation of hanging drops and invasion was monitored up until 72 h post-transfection. At least 8 spheroids were analyzed per condition and at least two independent experiments were performed²².

BC tissue samples

BC tissue samples as well as normal adjacent tissue from the same patient were obtained from patients undergoing tumor excision surgery at the University Hospital of Larissa (UHL), Greece during the period of 2005 to 2007²⁰. Normal adjacent tissue was verified to be normal by UHL pathologists. A total of 32 invasive BC samples and their normal counterparts were analyzed for RSU-1 expression by Real Time PCR and western blotting and the data were published in a previous work²⁰. Seventeen (17) samples were metastasis-free (in situ) and 15 were considered to be metastatic exhibiting metastasis to at least one lymph node (metastatic). In the present study, protein lysates kept from these samples were re-run on a 15% polyacrylamide gel, so that the smaller truncated isoform of RSU-1 (RSU-1X1) (~29KDa) is also distinguished on the gel, and analyzed by western blotting using anti-RSU-1 antibody. For the samples presented in this work, information on the patients’ age, family history of BC, height, weight, BMI, age of menarche and menopause, number of pregnancies, smoking habits, grade, infiltration of the blood vessels, nerves, skin or nipple, pathology evaluation, tumor diameter, ER, PR and Her2/neu status, and lymph node metastasis is summarized in Supplementary Table 3. All samples were obtained following verbal informed consent according to a protocol approved by the Institutional Review Board of the UHL (#12549) and in accordance with ethical guidelines of the 1975 Declaration of Helsinki²⁰.

Quantification of protein expression from western blots

The two isoforms of RSU-1 (Fig. 7) were quantified compared to the GAPDH loading control using the National Institute of Health Image J software²². The mean intensity of protein bands from five (5) different immunoblots including 23 human BC samples was used for the quantification. A p value of 0.05 was considered as statistically significant.

Bioinformatics analysis

RSU-1L (NM_012425.3) and RSU-1-X1 (XM_005252552.4) gene sequences were initially run in NCBI Blast Nucleotide (Blastn). To create a visualization of BLAST results we used the Kablammo open source BLAST visualization tool³⁸.

Statistical analysis

Normality was tested using Statgraphics Plus ‘Test for normality’. All the data presented in this work (apart from the analysis of protein expression presented in Fig. 7) followed normal distribution and therefore t-test was used for comparison of means between two groups (e.g. SshRNA versus RSU-1L shRNA-treated cells). For the data that did not follow normal distribution (western blot data presented in Fig. 7b,c), the non-parametric Mann Whitney test was used. In all cases a p-value < 0.05 was considered statistically significant. We also followed a graded approach in data presentation where a difference < 0.05 was denoted by one asterisk (*), a difference < 0.01 was denoted by two asterisks (**) and a difference < 0.001 was denoted by three asterisks (***).

Ethics approval and consent to participate

All human BC samples were obtained following verbal informed consent according to a protocol approved by the Institutional Review Board of the UHL (#12549) and in accordance with the ethical guidelines of the 1975 Declaration of Helsinki²⁰.

Data Availability

All data generated and analyzed during this study are included in this published article (and its Supplementary Information Files). All data and protocols are readily available to the readers.

References

Budczies, J. et al. The landscape of metastatic progression patterns across major human cancers. Oncotarget 6, 570–583, https://doi.org/10.18632/oncotarget.2677 (2015).
Article PubMed Google Scholar
Hunter, K. W., Crawford, N. P. & Alsarraj, J. Mechanisms of metastasis. Breast Cancer Res 10(Suppl 1), S2 (2008).
Article Google Scholar
Weigelt, B., Peterse, J. L. & van ‘t Veer, L. J. Breast cancer metastasis: markers and models. Nat Rev Cancer 5, 591–602, https://doi.org/10.1038/nrc1670 (2005).
Article CAS PubMed Google Scholar
Hynes, R. O. Integrins: bidirectional, allosteric signaling machines. Cell 110, 673–687 (2002).
Article CAS Google Scholar
Wu, C. ILK interactions. J Cell Sci 114, 2549–2550 (2001).
CAS PubMed Google Scholar
Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell 144, 646–674, https://doi.org/10.1016/j.cell.2011.02.013S0092-8674(11)00127-9 (2011).
Article CAS Google Scholar
Beavon, I. R. The E-cadherin-catenin complex in tumour metastasis: structure, function and regulation. Eur J Cancer 36, 1607–1620 (2000).
Article CAS Google Scholar
Canel, M., Serrels, A., Frame, M. C. & Brunton, V. G. E-cadherin-integrin crosstalk in cancer invasion and metastasis. J Cell Sci 126, 393–401 (2013).
Article CAS Google Scholar
Cutler, M. L., Bassin, R. H., Zanoni, L. & Talbot, N. Isolation of rsp-1, a novel cDNA capable of suppressing v-Ras transformation. Mol Cell Biol 12, 3750–3756 (1992).
Article CAS Google Scholar
Dougherty, G. W., Chopp, T., Qi, S. M. & Cutler, M. L. The Ras suppressor Rsu-1 binds to the LIM 5 domain of the adaptor protein PINCH1 and participates in adhesion-related functions. Exp Cell Res 306, 168–179 (2005).
Article CAS Google Scholar
Kadrmas, J. L. et al. The integrin effector PINCH regulates JNK activity and epithelial migration in concert with Ras suppressor 1. J Cell Biol 167, 1019–1024 (2004).
Article CAS Google Scholar
Wu, C. The PINCH-ILK-parvin complexes: assembly, functions and regulation. Biochim Biophys Acta 1692, 55–62, https://doi.org/10.1016/j.bbamcr.2004.01.006S0167488904000965 (2004).
Article CAS PubMed Google Scholar
Dougherty, G. W., Jose, C., Gimona, M. & Cutler, M. L. The Rsu-1-PINCH1-ILK complex is regulated by Ras activation in tumor cells. Eur J Cell Biol 87, 721–734 (2008).
Article CAS Google Scholar
Tsuda, T. & Cutler, M. L. Human RSU1 is highly homologous to mouse Rsu-1 and localizes to human chromosome 10. Genomics 18, 461–462, https://doi.org/10.1006/geno.1993.1503.
Article CAS Google Scholar
Tsuda, T., Marinetti, M. R., Masuelli, L. & Cutler, M. L. The Ras suppressor RSU-1 localizes to 10p13 and its expression in the U251 glioblastoma cell line correlates with a decrease in growth rate and tumorigenic potential. Oncogene 11, 397–403 (1995).
CAS PubMed Google Scholar
Vasaturo, F., Dougherty, G. W. & Cutler, M. L. Ectopic expression of Rsu-1 results in elevation of p21CIP and inhibits anchorage-independent growth of MCF7 breast cancer cells. Breast Cancer Res Treat 61, 69–78 (2000).
Article CAS Google Scholar
Donthamsetty, S. et al. Role of PINCH and its partner tumor suppressor Rsu-1 in regulating liver size and tumorigenesis. PLoS One 8, e74625, https://doi.org/10.1371/journal.pone.0074625 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Nalesnik, M. A. et al. Gene deletions and amplifications in human hepatocellular carcinomas: correlation with hepatocyte growth regulation. Am J Pathol 180, 1495–1508, https://doi.org/10.1016/j.ajpath.2011.12.021 (2012).
Article CAS PubMed PubMed Central Google Scholar
Barbazan, J. et al. Molecular characterization of circulating tumor cells in human metastatic colorectal cancer. PLoS One 7, e40476, https://doi.org/10.1371/journal.pone.0040476 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Giotopoulou, N. et al. Ras suppressor-1 promotes apoptosis in breast cancer cells by inhibiting PINCH-1 and activating p53-upregulated-modulator of apoptosis (PUMA); verification from metastatic breast cancer human samples. Clin Exp Metastasis 32, 255–265, https://doi.org/10.1007/s10585-015-9701-x (2015).
Article CAS PubMed Google Scholar
Gkretsi, V. & Bogdanos, D. P. Elimination of Ras Suppressor-1 from hepatocellular carcinoma cells hinders their in vitro metastatic properties. Anticancer Res 35, 1509–1512, 35/3/1509 (2015).
Gkretsi, V., Stylianou, A., Louca, M. & Stylianopoulos, T. Identification of Ras suppressor-1 (RSU-1) as a potential breast cancer metastasis biomarker using a three-dimensional in vitro approach. Oncotarget 8, 27364–27379, https://doi.org/10.18632/oncotarget.16062 (2017).
Article PubMed PubMed Central Google Scholar
Chunduru, S. et al. Identification of an alternatively spliced RNA for the Ras suppressor RSU-1 in human gliomas. J Neurooncol 60, 201–211 (2002).
Article Google Scholar
Minn, A. J. et al. Genes that mediate breast cancer metastasis to lung. Nature 436, 518–524, https://doi.org/10.1038/nature03799 (2005).
Article ADS CAS PubMed PubMed Central Google Scholar
Morales, M. et al. RARRES3 suppresses breast cancer lung metastasis by regulating adhesion and differentiation. EMBO Mol Med 6, 865–881, https://doi.org/10.15252/emmm.201303675 (2014).
Article CAS PubMed PubMed Central Google Scholar
Su, S. C., Lin, C. W., Yang, W. E., Fan, W. L. & Yang, S. F. The urokinase-type plasminogen activator (uPA) system as a biomarker and therapeutic target in human malignancies. Expert Opin Ther Targets 20, 551–566, https://doi.org/10.1517/14728222.2016.1113260 (2016).
Article CAS PubMed Google Scholar
Papageorgis, P. et al. Targeting IL13Ralpha2 activates STAT6-TP63 pathway to suppress breast cancer lung metastasis. Breast Cancer Res 17, 98, https://doi.org/10.1186/s13058-015-0607-y (2015).
Article CAS PubMed PubMed Central Google Scholar
Kalli, M., Papageorgis, P., Gkretsi, V. & Stylianopoulos, T. Solid Stress Facilitates Fibroblasts Activation to Promote Pancreatic Cancer Cell Migration. Annals of Biomedical Engineering 46, 657–669, https://doi.org/10.1007/s10439-018-1997-7 (2018).
Article PubMed PubMed Central Google Scholar
Yuan, J. S., Reed, A., Chen, F. & Stewart, C. N. Jr. Statistical analysis of real-time PCR data. BMC Bioinformatics 7, 85, https://doi.org/10.1186/1471-2105-7-85 (2006).
Article CAS PubMed PubMed Central Google Scholar
Gkretsi, V., Stylianou, A. & Stylianopoulos, T. Vasodilator-Stimulated Phosphoprotein (VASP) depletion from breast cancer MDA-MB-231 cells inhibits tumor spheroid invasion through downregulation of Migfilin, beta-catenin and urokinase-plasminogen activator (uPA). Exp Cell Res, https://doi.org/10.1016/j.yexcr.2017.02.019 (2017).
Article CAS Google Scholar
Zhang, Y., Tu, Y., Gkretsi, V. & Wu, C. Migfilin Interacts with Vasodilator-stimulated Phosphoprotein (VASP) and Regulates VASP Localization to Cell-Matrix Adhesions and migraion. J Biol Chem 281, 12397–12407 (2006).
Article CAS Google Scholar
Gkretsi, V. & Bogdanos, D. P. Experimental evidence of Migfilin as a new therapeutic target of hepatocellular carcinoma metastasis. Exp Cell Res 334, 219–227, https://doi.org/10.1016/j.yexcr.2015.03.002 (2015).
Article CAS PubMed Google Scholar
Gkretsi, V. et al. Inhibition of Breast Cancer Cell Invasion by Ras Suppressor-1 (RSU-1) Silencing Is Reversed by Growth Differentiation Factor-15 (GDF-15). Int J Mol Sci 20, https://doi.org/10.3390/ijms20010163 (2019).
Article Google Scholar
Del Duca, D., Werbowetski, T. & Del Maestro, R. F. Spheroid preparation from hanging drops: characterization of a model of brain tumor invasion. J Neurooncol 67, 295–303 (2004).
Article Google Scholar
Kelm, J. M., Timmins, N. E., Brown, C. J., Fussenegger, M. & Nielsen, L. K. Method for generation of homogeneous multicellular tumor spheroids applicable to a wide variety of cell types. Biotechnol Bioeng 83, 173–180, https://doi.org/10.1002/bit.10655 (2003).
Article CAS PubMed Google Scholar
Foty, R. A simple hanging drop cell culture protocol for generation of 3D spheroids. Journal of visualized experiments: JoVE, https://doi.org/10.3791/2720 (2011).
Kaufman, L. J. et al. Glioma expansion in collagen I matrices: analyzing collagen concentration-dependent growth and motility patterns. Biophys J 89, 635–650, https://doi.org/10.1529/biophysj.105.061994 (2005).
Article CAS PubMed PubMed Central Google Scholar
Wintersinger, J. & Wasmuth, J. D. Kablammo: an interactive, web-based BLAST results visualizer. Bioinformatics 31, 1305–1306, https://doi.org/10.1093/bioinformatics/btu808 (2015).
Article PubMed Google Scholar

Download references

Acknowledgements

We thank Ms. Maria Louca for useful comments on the manuscript. Research leading to the findings of the present work has received funding from the European Research Council (ERC) under the European Union’s Seventh Framework Programme (FP7/2007–2013)/ERC grant agreement no 336839-ReEngineeringCancer. ERC had no part in the design of the study, the collection, analysis and interpretation of the data or the writing of the article.

Author information

Authors and Affiliations

Cancer Biophysics Laboratory, Department of Mechanical and Manufacturing Engineering, University of Cyprus, Nicosia, Cyprus
Vasiliki Gkretsi, Maria Kalli, Panagiotis Papageorgis & Triantafyllos Stylianopoulos
Biomedical Sciences Program, Department of Life Sciences, School of Sciences, European University Cyprus, Nicosia, Cyprus
Vasiliki Gkretsi
The Center for Risk and Decision Sciences (CERIDES), Department of Computer Sciences, School of Sciences, European University Cyprus, Nicosia, Cyprus
Christodoulos Efstathiades
Biological Sciences Program, Department of Life Sciences, School of Sciences, European University Cyprus, Nicosia, Cyprus
Panagiotis Papageorgis
Laboratory of Cytogenetics and Molecular Genetics, Faculty of Medicine, University of Thessaly, Larissa, Greece
Vassilios Papanikolaou & Aspasia Tsezou
Department of Life and Health Sciences, University of Nicosia, Nicosia, Cyprus
Lefteris C. Zacharia
Department of Biology, Faculty of Medicine, University of Thessaly, Larissa, Greece
Aspasia Tsezou
Departments of Surgery, University of Thessaly Medical School, Larissa, Greece
Evangelos Athanassiou

Authors

Vasiliki Gkretsi
View author publications
You can also search for this author in PubMed Google Scholar
Maria Kalli
View author publications
You can also search for this author in PubMed Google Scholar
Christodoulos Efstathiades
View author publications
You can also search for this author in PubMed Google Scholar
Panagiotis Papageorgis
View author publications
You can also search for this author in PubMed Google Scholar
Vassilios Papanikolaou
View author publications
You can also search for this author in PubMed Google Scholar
Lefteris C. Zacharia
View author publications
You can also search for this author in PubMed Google Scholar
Aspasia Tsezou
View author publications
You can also search for this author in PubMed Google Scholar
Evangelos Athanassiou
View author publications
You can also search for this author in PubMed Google Scholar
Triantafyllos Stylianopoulos
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

V.G.: conceived and designed the study, performed the experiments, analysed data and interpreted results, and wrote the paper. M.K.: was responsible for the generation of the shRNA constructs, the design of Figure 10 as well as editing the manuscript. C.E.: was responsible for the bioinformatics analysis performed to compare the two RSU-1 isoforms. PP: assisted in the design of the shRNA constructs. V.P.: was responsible for the acquisition of the human samples, and editing the manuscript. L.C.Z.: was responsible for statistical analysis, running the normality tests and selecting the human samples to be used in immunoblotting experiments based on previously published real time PCR data, data interpretation, and editing of the final version of the manuscript. AT: was involved in the acquisition of the human samples, and editing the manuscript. E.A.: was the surgeon responsible for the acquisition of the human samples, and editing the manuscript. T.S.: oversaw the project, participated in the design of the study, data analysis and interpretation and final editing of the manuscript while he was also responsible for the acquisition of funding. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Vasiliki Gkretsi or Triantafyllos Stylianopoulos.

Ethics declarations

Competing Interests

The authors declare no competing interests.

Additional information

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Gkretsi, V., Kalli, M., Efstathiades, C. et al. Depletion of Ras Suppressor-1 (RSU-1) promotes cell invasion of breast cancer cells through a compensatory upregulation of a truncated isoform. Sci Rep 9, 10050 (2019). https://doi.org/10.1038/s41598-019-46575-0

Download citation

Received: 25 July 2018
Accepted: 21 June 2019
Published: 11 July 2019
DOI: https://doi.org/10.1038/s41598-019-46575-0

This article is cited by

Ras suppressor-1 (RSU1) exerts a tumor suppressive role with prognostic significance in lung adenocarcinoma
- Sofia Nikou
- Marina Arbi
- Vasiliki Bravou
Clinical and Experimental Medicine (2022)
ILK silencing inhibits migration and invasion of more invasive glioblastoma cells by downregulating ROCK1 and Fascin-1
- Maria Louca
- Apostolos Zaravinos
- Vasiliki Gkretsi
Molecular and Cellular Biochemistry (2020)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.