DNA replication initiation factor RECQ4 possesses a role in antagonizing DNA replication initiation

Xu, Xiaohua; Chang, Chou-Wei; Li, Min; Omabe, Kenneth; Le, Nhung; Chen, Yi-Hsuan; Liang, Feng; Liu, Yilun

doi:10.1038/s41467-023-36968-1

Download PDF

Article
Open access
Published: 04 March 2023

DNA replication initiation factor RECQ4 possesses a role in antagonizing DNA replication initiation

Xiaohua Xu¹,
Chou-Wei Chang²,
Min Li³,
Kenneth Omabe³^na1,
Nhung Le³^na1,
Yi-Hsuan Chen ORCID: orcid.org/0000-0002-6788-4264⁴^na1,
Feng Liang⁵^na1 &
…
Yilun Liu ORCID: orcid.org/0000-0001-6884-8487³

Nature Communications volume 14, Article number: 1233 (2023) Cite this article

3103 Accesses
1 Citations
1 Altmetric
Metrics details

Subjects

Abstract

Deletion of the conserved C-terminus of the Rothmund-Thomson syndrome helicase RECQ4 is highly tumorigenic. However, while the RECQ4 N-terminus is known to facilitate DNA replication initiation, the function of its C-terminus remains unclear. Using an unbiased proteomic approach, we identify an interaction between the RECQ4 N-terminus and the anaphase-promoting complex/cyclosome (APC/C) on human chromatin. We further show that this interaction stabilizes APC/C co-activator CDH1 and enhances APC/C-dependent degradation of the replication inhibitor Geminin, allowing replication factors to accumulate on chromatin. In contrast, the function is blocked by the RECQ4 C-terminus, which binds to protein inhibitors of APC/C. A cancer-prone, C-terminal-deleted RECQ4 mutation increases origin firing frequency, accelerates G₁/S transition, and supports abnormally high DNA content. Our study reveals a role of the human RECQ4 C-terminus in antagonizing its N-terminus, thereby suppressing replication initiation, and this suppression is impaired by oncogenic mutations.

The ORC ubiquitin ligase OBI1 promotes DNA replication origin firing

Article Open access 03 June 2019

Philippe Coulombe, Joelle Nassar, … Marcel Méchali

The human nucleoporin Tpr protects cells from RNA-mediated replication stress

Article Open access 24 June 2021

Martin Kosar, Michele Giannattasio, … Marco Foiani

Trim33 masks a non-transcriptional function of E2f4 in replication fork progression

Article Open access 23 August 2023

Vanessa Rousseau, Elias Einig, … Nikita Popov

Introduction

Rothmund-Thomson syndrome (RTS), Baller-Gerald syndrome, and RAPADILINO are diseases linked to mutations in the human RECQ4 gene, which encodes a member of the RECQ family of DNA helicases^1,2,3,4. A conserved superfamily II (SFII) helicase domain is located at the center of the RECQ4 protein, flanked by amino (N) and carboxyl (C) termini containing unique sequences that are distinct from other members of the RECQ family. The RECQ4 N-terminus is essential for development, because its deletion leads to embryonic lethality in mice^5,6,7. Further, it shares sequence homology with the essential DNA replication initiation factor Sld2 in yeast^8,9. Consistent with a role in replication initiation, RECQ4 binds to replication origins, and the SLD2-like domain of the human RECQ4 N-terminus forms a cell cycle-dependent, chromatin-bound protein complex that contains core replication factors, including MCM10, MCM2-7 helicase, CDC45, and GINS^8,9,10,11,12. The interactions of RECQ4 with these replication components are important for the assembly of active CDC45-MCM2-7-GINS replicative helicase on chromatin to initiate DNA synthesis^10,11. Hence, it has been shown that artificial tethering of RECQ4 to replication origins is sufficient to initiate DNA replication¹³.

Deregulated DNA synthesis has been linked to human diseases including cancer^14,15,16. Indeed, a subset of RECQ4 clinical mutations are tumorigenic³, making RECQ4 an ideal candidate to study the contribution of DNA synthesis dysfunction to tumorigenesis. One of the most commonly found RECQ4 clinical mutations, del(Ala420_Ala463), causes RAPADILINO and is associated with a significantly higher risk of lymphoma³. This mutation leads to an internal deletion (ID) of 44 amino acids within the N-terminus immediately upstream of the SFII helicase domain. These 44 residues within the ID motif are involved in protein–protein interactions; one of these interacting proteins is p32/HABP1, which negatively controls RECQ4 mitochondrial localization¹⁷. In addition to initiating DNA replication in the nucleus, RECQ4 also interacts with the mitochondrial replicative helicase TWINKLE and is targeted to the mitochondria for mitochondrial DNA (mtDNA) synthesis¹⁷. Hence, the ID mutation impairs RECQ4 interaction with p32 and results in accumulation of the mutant protein in the mitochondria, mtDNA overproduction, and mitochondrial dysfunction¹⁷. In addition to the ID mutation, the RECQ4 clinical mutation Q757X is also oncogenic³. Individuals who are homozygous or compound heterozygous for the Q757X mutation carry a 40% risk of developing osteosarcoma³. Q757X is a truncation mutation, in which the conserved C-terminus downstream of the SFII domain is deleted. Interestingly, a RECQ4 splicing mutation (R766X), which leads to a similar C-terminal truncation, has been observed frequently in the tumor registry¹⁸ and is considered oncogenic. Nonetheless, despite an important role in tumor suppression, the molecular function of the RECQ4 C-terminus remains unclear.

In this work, we report an unexpected role of the RECQ4 C-terminus in antagonizing the N-terminus, thereby reducing replication origin firing. Using an unbiased proteomic approach, we identify the anaphase-promoting complex/cyclosome (APC/C), an essential E3 ubiquitin ligase that drives cell cycle progression¹⁹, as a factor that interacts with the RECQ4 N-terminus on human chromatin. This interaction peaks at S phase and enhances APC/C-mediated degradation of the replication inhibitor Geminin, replisome assembly, and origin firing. However, this interaction is restricted by the RECQ4 C-terminus, which binds to the APC/C inhibitor protein EMI1. Consequently, cells carrying cancer-associated RECQ4 C-terminal truncation mutations missing the EMI1-interacting motif show accelerated G₁/S transition and higher-than-normal DNA content, possibly due to DNA re-replication. Our work demonstrates that the RECQ4 C-terminus possesses a self-regulatory mechanism that prevents replication initiation by suppressing RECQ4 N-terminal interaction with APC/C. APC/C is a multi-protein complex, and ANAPC1, which encodes APC1, the largest subunit of APC/C, has been identified as the second RTS genetic risk factor²⁰. Our study provides a functional link between the two RTS genes in DNA replication control.

Results

The RECQ4 C-terminus antagonizes DNA replication initiation

Consistent with the essential role of RECQ4 in the mammalian system⁵, our previous attempt to isolate viable RECQ4-null HEK293 cells using CRISPR technology was not successful²¹. Instead, because CRISPR-generated frameshift mutations are known to yield low levels of synthesized protein due to ribosomal slippage²², we isolated HEK293 cells that contained RECQ4 frameshift mutations in both alleles²¹. We referred to these RECQ4-CRISPR-edited cells as stable RECQ4 knockdown (KD) cells (Supplementary Fig. 1a), as they survived due to a reduced but detectable amount of RECQ4 on chromatin²¹. In the present study, we found that these RECQ4 KD cells showed an almost 2-fold increase in Geminin (Supplementary Fig. 1a), which blocks DNA replication initiation by inhibiting replication initiation factors²³. Indeed, this increase was accompanied by a decrease in the replication initiation factors CDT1 and MCM7 (Supplementary Fig. 1a). As a result, RECQ4 KD cells proliferated slower (Supplementary Fig. 1b) and accumulated in G₁ phase compared to wild-type (WT) HEK293 cells (Supplementary Fig. 1c). When we stably expressed a FLAG-tagged RECQ4 WT construct in RECQ4 KD cells at a similar level as the endogenous RECQ4 protein in the parental HEK293 cells (Supplementary Fig. 1d), the slow growth rate of the RECQ4 KD cells was restored to a level comparable to that of parental HEK293 cells (Supplementary Fig. 1e).

To determine the function of the RECQ4 C-terminus, we stably expressed a FLAG-tagged RECQ4 construct containing the cancer-associated Q757X mutation in RECQ4 KD cells (Fig. 1a). When FLAG-RECQ4 WT or Q757X mutant proteins were expressed at similar levels (Fig. 1b), RECQ4 Q757X mutant cells exhibited a faster growth rate than RECQ4 WT cells (Fig. 1c, d). Because RECQ4 is involved in initiating DNA replication^8,9,10,11,12, we performed DNA fiber analysis using asynchronized RECQ4 WT and Q757X mutant cells and found that the frequency of origin firing per IdU/CIdU-positive DNA fiber was greater in Q757X mutant cells (26.67%) than in WT cells (15.67%) (Fig. 1e, yellow arrows). This increase in origin firing was not due to a higher percentage of the S-phase population in Q757X mutant cells compared to WT cells (Fig. 1f, right panels), suggesting that there was an increase in origin firing frequency per each Q757X mutant cell undergoing DNA synthesis. Increasing origin firing can shorten S phase²⁴, explaining the faster growth rate in the RECQ4 Q757X mutant cells. Shortening S phase is expected to decrease the S-phase population in asynchronized cells, but the ratio between G₁- and S-phase populations did not change in asynchronized Q757X mutant cells compared to asynchronized WT cells (Fig. 1f, right panels). Therefore, we tested the possibility that DNA replication was initiated earlier to shorten the G₁ phase in Q757X mutant cells. To test this, we used nocodazole to synchronize RECQ4 WT and Q757X mutant cells to the G₂/M phase. At 6 h post-nocodazole release, more than 50% of the RECQ4 WT and Q757X mutant cells had transitioned into G₁ (Fig. 1f). However, by 12 h post-nocodazole release, a higher percentage of Q757X mutant cells (47.3%) were BrdU-positive compared to WT cells (26.9%; Fig. 1f), indicating more Q757X mutant cells had transitioned into S phase, which was maintained at 15 h post-nocodazole release (Fig. 1f), supporting our conclusion that G₁ phase is shortened by the Q757X mutation.

**Fig. 1: RECQ4 C-terminus antagonizes DNA replication initiation.**

Replication stress induced by hydroxyurea (HU) or camptothecin (CPT) activates additional replication origins that are normally dormant to help maintain DNA synthesis rate and increase cell survival^25,26,27. To test if increased origin firing by the RECQ4 Q757X mutation relates to dormant origins, we assessed the sensitivity of RECQ4 WT or Q757X mutant cells to HU and CPT and found that both chemicals inhibited WT and Q757X mutant cell growth (Supplementary Fig. 2a). RECQ4 forms a chromatin-specific replication complex via the N-terminus to initiate DNA replication¹⁰. When we treated RECQ4 WT or Q757X mutant cells with ionizing radiation to induce DNA damage, both WT and Q757X replication complexes were reduced (Supplementary Fig. 2b). These results reveal a role for the RECQ4 C-terminus in suppressing replication origin firing, and suggest this function is not related to cellular response to replication stress.

The RECQ4 C-terminus limits interactions with replication factors and APC/C

We next determined the mechanism by which the RECQ4 C-terminus limits origin firing by analyzing the chromatin-bound (CB) RECQ4 replication complexes formed in RECQ4 KD cells expressing FLAG-RECQ4 WT or Q757X mutant proteins. When we fractionated whole-cell extracts (WCEs) into cytoplasmic (CE), nucleoplasmic, and CB fractions, we observed a modest increase (25-30%) in the amount of Q757X mutant protein in the CB fraction compared to WT protein (Fig. 2a). Replication complex assembly to support DNA synthesis is a multi-step process initiated by the formation of a pre-replication complex (pre-RC) at the replication origin²⁸. We found that components of the pre-RC (e.g., CDC6 and CDT1) and several components of the replication complex (e.g., MCM2-7, GINS, and DNA polymerase δ) were enriched by more than 2-fold in the CB fraction of Q757X mutant cells compared to WT cells (Fig. 2b). We also immunopurified FLAG-RECQ4 WT and Q757X mutant proteins from the CB fractions using M2 agarose beads conjugated with anti-FLAG antibody and identified their associated proteins by mass spectrometry (Supplementary Data 1). After normalizing to the FLAG-tagged bait proteins, we found that replication factors co-purified with FLAG-RECQ4 Q757X increased by as much as 15-fold compared to those co-purified with FLAG-RECQ4 WT protein, as confirmed by both mass spectrometry (Fig. 2c; Supplementary Data 1) and western blot analysis (Fig. 2d). These increases were specific to the CB fraction, as demonstrated by comparison of the replication factors MCM2-7 (e.g., MCM2 and MCM7), CDC45, and GINS (e.g., GINS2 and GINS4) in FLAG-RECQ4 complexes purified from the CE (left) and the CB (right) fractions (Fig. 2d). These results indicate that the RECQ4 C-terminus limits formation of the pre-RC and subsequently the replisome on chromatin.

**Fig. 2: The RECQ4 C-terminus regulates protein–protein interactions.**

In addition to DNA replication factors¹⁰, we previously detected components of the APC/C E3 ubiquitin ligase in mass spectrometry analyses of FLAG-RECQ4 complexes purified from human cell extracts (Supplementary Data 2)^10,17, but the physiological significance of this association was not immediately clear. In the current study, we compared FLAG-RECQ4 WT and Q757X mutant complexes on chromatin using mass spectrometry (Fig. 2c; Supplementary Data 1) and western blot analysis (Fig. 2d) and observed that interactions with APC/C subunits were enhanced by as much as 35-fold in the Q757X mutant complex. In contrast, interactions with ATP citrate lyase (ACLY), ubiquitin-activating enzyme E1 homolog A (UBA1), and mitotic checkpoint protein BUB3, all of which also co-purified with RECQ4, were significantly weakened by the Q757X mutation (Fig. 2c, d). Furthermore, increased binding of APC/C to the RECQ4 Q757X mutant was specific to the CB fraction and was not present in the CE fraction, as validated by western blot analysis using antibodies specific to the APC1 and APC5 subunits (Fig. 2d). On the other hand, only the RECQ4 WT interaction with BUB3, which has a role in regulating APC/C^29,30, took place in the CB fraction; RECQ4 WT interactions with UBA1 and ACLY were detected in the CE fraction (Fig. 2c, d).

Because APC/C is an important E3 ubiquitin ligase that controls both G₁/S transition and mitosis³¹, we next wished to confirm that endogenous RECQ4 interacts with APC/C and determine whether this interaction is cell-cycle regulated. To test this, we synchronized parental HEK293 cells with nocodazole; after release from nocodazole block, we purified endogenous RECQ4 complexes from WCE using an antibody specific to RECQ4 (Fig. 3a). We found that APC/C co-immunoprecipitated with endogenous RECQ4, and that similar to its interaction with replication factors (e.g., MCM5 and GINS2)¹⁰, the interaction of RECQ4 with APC/C (e.g., APC1 and APC11) peaked at 12 h post-nocodazole release when cells were transitioning from G₁ to S phase (Fig. 3b, right panels, 3c). Although BUB3 functions as an APC/C inhibitor during M phase^30,32, our cell cycle analysis showed that the interaction with BUB3 also increased as more cells entered S phase (Fig. 3b, c). When we repeated the experiment in RECQ4 KD HEK293 cells stably expressing FLAG-RECQ4 WT, we observed similar kinetics of APC/C and BUB3 interactions during the cell cycle (Fig. 3d, e), despite exogenous RECQ4 being constitutively expressed throughout the cell cycle (Fig. 3d, e, left panel), unlike endogenous RECQ4 (Fig. 3b, input). Importantly, we observed a maximum increase in the binding of RECQ4 Q757X mutant vs. WT protein to replication factors and APC/C during S phase (i.e., 13 h; Fig. 3e). When we assessed EMI1, an APC/C inhibitor that acts during S phase to prevent re-replication^33,34,35, we found that EMI1 also co-purified with RECQ4 WT mainly during S-phase (Fig. 3e). For both BUB3 and EMI1, the interaction was impaired by the Q757X mutation (Fig. 3e).

**Fig. 3: APC/C facilitates RECQ4 Q757X replication complex formation.**

Because APC/C and various replication factors shared similar kinetics in their interactions with RECQ4, we next asked if APC/C is responsible for enhanced interaction of the Q757X mutant with replication factors. For this, we depleted the APC5 subunit of the APC/C complex by expressing an shRNA specific to APC5 in both the RECQ4 WT and Q757X mutant cells (Fig. 3f). We found that depleting APC5 indeed reversed the enhanced interaction of RECQ4 Q757X mutant with replication factors (MCM2, MCM7, GINS, CDC45) to a level comparable to that of the WT protein (Fig. 3g). These results together indicate that APC/C interacts with RECQ4 during S phase to enhance replisome assembly, and this function is self-limited by the RECQ4 C-terminus.

Multiple domains within the RECQ4 N-terminus interact with APC/C

We next mapped the residues present in the first 757 amino acids of RECQ4 that contribute to its association with APC/C. To do this, we transiently overexpressed various FLAG-tagged RECQ4 deletion mutants to achieve similar expression levels in RECQ4 KD HEK293 cells (Fig. 4a) and confirmed that all RECQ4 fragments were detected in the CB fraction (Fig. 4b). When normalized to FLAG-RECQ4 proteins immunopurified on M2 agarose beads, we found that an N-terminal RECQ4_1-480 fragment without the conserved SFII domain showed a similar increase (4.1-fold for APC1 and 2.4-fold for APC5) as the Q757X mutant (4.1-fold for APC1 and 2.6-fold for APC5) in binding to components of APC/C compared to the WT RECQ4 (Fig. 4a, c). However, removing the residues between 340 and 480 (i.e., FLAG-RECQ4_1-340) reduced the interaction of RECQ4 with APC/C by approximately 3-fold compared to FLAG-RECQ4_1-480 (Fig. 4c), even though these two fragments were present at similar levels in the CB fractions (Fig. 4b). A RECQ4_1-240 fragment that contains only the SLD2 domain showed similar APC/C binding efficiency as the RECQ4_1-340 fragment. This result suggests that the RECQ4 N-terminus contains two APC/C-binding domains (ABD), with ABD1 located within SLD2, and ABD2 overlapping with residues 340–480 (Fig. 4d). Interestingly, ABD2 contains the 44 residues missing in the cancer-prone ID mutation (Fig. 4d). Previously, we showed that the ID motif is required for RECQ4 interaction with p32¹⁷, which suggests that the p32 interacting site may overlap with that of APC/C. Indeed, we found that depleting APC/C in RECQ4 KD HEK293 cells expressing FLAG-RECQ4 WT or Q757X mutant increased the amount of p32 co-purified with both WT and Q757X mutant proteins (Fig. 3g, bottom panel).

We next wished to confirm that ABD1 and ABD2 are both involved in APC/C binding and to exclude the possibility that differential binding to APC/C by distinct FLAG-RECQ4 fragments transiently overexpressed in RECQ4 KD HEK293 cells was due to changes in cell cycle or protein localization. For this, we performed in vitro pull-down experiments using recombinant His-tagged, FLAG-tagged RECQ4 N-terminal fragments (Fig. 4d) purified from E. coli and conjugated to M2 agarose beads to pull down APC/C from the CB fraction prepared from parental HEK293 cells. After normalizing to the His-RECQ4-FLAG bait protein on the beads, we confirmed that both RECQ4_1-240, which contains ABD1, and RECQ4_220-480, which contains ABD2, pulled down components of APC/C, but with different binding preferences. Specifically, the fragment containing ABD1 preferentially pulled down APC1, whereas that containing ABD2 preferentially pulled down APC5 (Fig. 4e). Interestingly, recombinant RECQ4_220-480 pulled down 3-fold more APC5 than RECQ4_1-492 (Fig. 4e). It is possible that the presence of ABD1 affects ABD2 access to APC5 but may be altered by additional regulations, such as post-translational modifications that are not present in the recombinant proteins generated in E. coli. In summary, these results indicate that the RECQ4 N-terminus contains two ABDs that bind to different APC/C subunits.

RECQ4 ABD2-APC/C interaction promotes replication complex assembly

Our domain analysis showed that the RECQ4 C-terminus negatively regulates ABD2 interaction with APC/C. Therefore, we next tested if disrupting the interaction of RECQ4 ABD2 with APC/C is sufficient to reverse the deregulation of replication complex formation by the Q757X mutation. ABD2 contains a zinc knuckle (ZnK; Fig. 5a) that is involved in nucleic acid binding³⁶. To avoid disrupting ZnK, we generated a RECQ4 Q757X-ID double mutant, in which only the residues corresponding to the ID motif and downstream of the ZnK were removed from the Q757X fragment (Fig. 5a). Using purified recombinant His-RECQ4 WT, Q757X, ID, and Q757X-ID mutant proteins from E. coli (Supplementary Figs. 3a, 3b), we confirmed that deleting ID in either the WT or Q757X mutant construct did not interfere with DNA binding (Fig. 5b–d; Supplementary Fig. 3c–e). We next stably expressed the Q757X-ID construct in RECQ4 KD HEK293 cells and compared it to those stably expressing the RECQ4 WT and Q757X proteins (Fig. 5e, top panel). We found that introducing the additional ID mutation reduced the ability of the Q757X mutant protein to interact with APC/C (e.g., APC1 and APC5) by as much as 16.5-fold (Fig. 5f), even though there was only a 30% decrease in the amount of Q757X-ID mutant binding to chromatin (Fig. 5g, top panel). In addition, the levels of pre-RC factors (e.g., CDC6 and CDT1) and components of the replication complex (e.g., MCM2, MCM7, CDC45, GINS2, and GINS4) on chromatin were reduced in Q757X-ID double mutant cells by more than 2-fold compared to those expressing the Q757X single mutant (Fig. 5g). Consistent with this, we also observed that Geminin was reduced in Q757X mutant cells, but the reduction was reversed by the Q757X-ID double mutation (Fig. 5e). Hence, Q757X-ID double mutant cells lost the growth advantage found in Q757X mutant cells over WT cells (Fig. 5h).

**Fig. 5: RECQ4 N-terminal interaction with APC/C promotes replisome assembly.**

RECQ4-APC/C interaction facilitates the degradation of Geminin

During G₁ phase and G₁/S transition, APC/C is activated by the adaptor protein CDH1 to promote pre-RC assembly and origin firing by degrading the replication inhibitor Geminin^34,37. Because we found that the amount of Geminin (Fig. 5e) was inversely proportional to the interaction of APC/C with RECQ4 (Fig. 5f), we asked if RECQ4-APC/C interaction facilitates Geminin degradation. We first fractionated RECQ4 KD HEK293 cells stably expressing FLAG-RECQ4 WT or Q757X mutant and confirmed that Geminin was proportionally reduced in the CB fraction prepared from Q757X mutant cells compared to WT cells (Fig. 6a). The reduction was most noticeable at 6 h (2-fold) and 13 h (3-fold) post-nocodazole release, when the cells were in G₁ and S phase, respectively (Fig. 6b). We further determined that Geminin was stabilized in Q757X mutant cells by treating the cells with the proteasome inhibitor MG132; the amount of Geminin was restored to a similar level as that in WT cells (Fig. 6c), confirming that expression of reduced Geminin in the Q757X mutant cells was due to proteasome-mediated protein degradation.

**Fig. 6: RECQ4 enhances APC/C E3 ubiquitin ligase activity.**

The increased degradation of Geminin in Q757X mutant cells led us to test whether APC/C co-activator expression (e.g., CDH1 and CDC20) is increased in Q757X mutant cells. We detected increased CDH1 by 3.5-fold in the CB fraction of Q757X mutant cells compared to WT cells (Fig. 6d). When we used an antibody specific to the HA-tag to immunopurify the APC/C complex from RECQ4 WT and Q757X mutant cells expressing an HA-tagged APC5 subunit, we found that CDH1 association with APC/C was enhanced (2-fold) by the RECQ4 Q757X mutation (Fig. 6d). On the other hand, Q757X mutation had little effect on the level of CDC20 (Fig. 6d), which primarily functions to activate APC/C during mitosis³⁸. RECQ4 C-terminal deletion also did not enhance CDC20 association with APC/C in the CB fraction (Fig. 6d). An increase in APC/C-CDH1, but not APC/C-CDC20, complexes is consistent with the fact that expression of S-phase kinase-associated protein 2 (SKP2), which is an APC/C-CDH1 substrate³⁹, was also lower in the Q757X mutant cells compared to WT cells (Fig. 6a). In contrast, cyclin A degradation, which is mediated primarily by APC/C-CDC20³², was not affected by the RECQ4 Q757X mutation (Fig. 6a). Although CDC6 is also a known APC/C substrate, its stability was not reduced by the Q757X mutation (Fig. 2b). This may be because CDC6 is protected from APC/C-CDH1-mediated degradation by CDK-dependent phosphorylation in cycling cells⁴⁰.

To determine if APC/C E3 ubiquitin ligase activity is affected in Q757X mutant cells, we performed in vitro ubiquitination assays using purified recombinant Geminin to measure APC/C activity in WCEs prepared from RECQ4 WT and Q757X mutant cells. When we incubated purified recombinant Geminin proteins with equal amounts of RECQ4 WT or Q757X mutant WCE, we observed more ubiquitinated Geminin proteins in the reactions containing Q757X mutant WCE than those with WT WCE (Fig. 6e). We further depleted APC/C from both WCEs using an anti-APC5 antibody (Fig. 6f) and confirmed that APC/C-depleted WCEs from both RECQ4 WT and Q757X mutant cells exhibited reduced ubiquitination activity on the recombinant Geminin substrate (Fig. 6g).

During S phase, Geminin expression is restored by inactivation of APC/C to prevent re-replication during the mitotic cycle³³. In addition, CDT1 is targeted for degradation by SKP2 to prevent re-replication^41,42,43. Geminin expression in Q757X mutant cells continued to remain lower than that in WT cells during S phase (Fig. 6b), raising the possibility that Q757X mutation increases the risk of re-replication. Developmental signaling or external stress, such as G₂ arrest by nocodazole, is known to induce re-replication by activating APC/C^44,45. Consistent with this, by 15 h post-nocodazole release, we observed that not only were more Q757X mutant cells replicating DNA (i.e., greater % in S phase) than were WT cells, but that the BrdU-positive cell population containing more than 4N DNA was increased in Q757X vs. WT cells, likely due to additional rounds of DNA synthesis without cell division (Supplementary Fig. 4). In summary, these results demonstrate that the RECQ4 C-terminus restricts the RECQ4 N-terminus from binding to APC/C, thereby limiting APC/C-mediated degradation of Geminin and pre-RC chromatin association to prevent DNA replication initiation and re-replication.

EMI1 interaction with RECQ4 C-terminus is inversely correlated with RECQ4-APC/C interaction

We next explored the mechanism by which the RECQ4 C-terminus negatively regulates the interaction between the RECQ4 N-terminus and APC/C. Similar to the Q757X mutation, the D1093X clinical mutation, which deletes the terminal 115 amino acids of RECQ4 (Fig. 7a), has been linked to RTS and osteosarcoma⁴⁶. When we stably expressed a FLAG-tagged RECQ4 D1093X mutant protein at a similar level as WT RECQ4 in RECQ4 KD HEK293 cells (Fig. 7b), we found that D1093X mutant cells also exhibited a faster cell growth rate than WT cells (Fig. 7c). Importantly, D1093X mutant expression led to reduced expression of Geminin, accompanied by increased expression of CDH1, relative to that in WT cells (Fig. 7b). Interestingly, the crystal structure of human RECQ4_427-1116 fragment⁴⁷ indicates that residues containing the ID motif that are involved in APC/C binding and visible in the structure (Fig. 7d, T449-A480 shown in green) are in close proximity and facing the same surface as the C-terminal residues between D1093 and E1111 (Fig. 7d, α-helix shown in pink) that are missing in the D1093X mutation. Therefore, we tested whether a protein–protein interaction with the terminal 115 residues of RECQ4 blocks the nearby ID motif and limits its accessibility to APC/C, thereby weakening RECQ4-APC/C interaction. Because Q757X mutation impaired RECQ4 binding to both APC/C inhibitors EMI1 and BUB3 (Fig. 3e), we next determined if EMI1 or BUB3 interacts with the terminal 115 residues of RECQ4 to block the ID interaction with APC/C and replication complex assembly. We first expressed a RECQ4 C-terminal fragment containing residues 751 to 1208 (Fig. 7a) and confirmed that both EMI1 and BUB3, but not replication factors (e.g., MCM2, MCM7, GINS4), interacted primarily with the C-terminus of RECQ4 (Fig. 7e). Although the level of D1093X mutant on chromatin did not increase compared to WT (Fig. 7f), components of APC/C (e.g., APC1 and APC5) and replication factors (e.g., MCM2, MCM7, GINS2, GINS4, and CDC45) were enriched in FLAG-RECQ4 D1093X complexes immunopurified from the CB fraction (Fig. 7g), indicating that the last 115 residues of RECQ4 are involved in suppressing APC/C interaction with the ID motif in the N-terminus. Importantly, only the EMI1 interaction, and not the BUB3 interaction, was weakened by the D1093X mutation and inversely correlated with the RECQ4-APC/C interaction (Fig. 7g). These results support a model in which the EMI1-interacting residues on RECQ4 are spatially in proximity to those important for APC/C interaction, and RECQ4-EMI1 interaction may impose a steric hindrance to prevent RECQ4 interaction with the APC/C complex (Fig. 7d). Our analysis of the D1093X mutant also suggests that while there is an increase in Q757X mutant proteins on chromatin compared to WT RECQ4 proteins, this increase is not required for enhancing RECQ4-APC/C interaction.

**Fig. 7: RECQ4 C-terminal interaction with EMI1 is inversely correlated with RECQ4 N-terminal interaction with APC/C.**

Discussion

We identified a chromatin-specific interaction that occurs between RECQ4 and APC/C through the N-terminus of RECQ4 and showed that this interaction promotes replication complex assembly and replication initiation. We showed that maximum binding of RECQ4 to APC/C on chromatin requires both ABD1 overlapping with the SLD2 and ABD2 containing the ID motif within the RECQ4 N-terminus. Because APC/C is a megadalton, multi-protein complex, it is unlikely that ABD1 and ABD2 independently bind to two separate APC/C complexes. As these two domains showed binding preferences for distinct APC/C subunits in vitro, we propose that maximum binding is achieved by the interaction of ABD1 and ABD2 with different components of the same APC/C complex to stabilize the interaction. Given that ABD1 contains SLD2 that interacts with replication factors¹⁰, it is also possible that the ABD1-APC/C association is indirect via their mutual interactions with replication factors. We previously showed that RECQ4 ID mutant proteins not only accumulate in the mitochondria due to impaired interaction with p32 but also exhibit reduced nuclear localization¹⁷. Given that proteins can shuttle between the nucleus and mitochondria⁴⁸, our previous study suggested that the reduction in nuclear RECQ4 ID mutant proteins is a consequence of imbalanced shuttling. Our current study provides an alternative but not mutually exclusive possibility that the reduction in nuclear RECQ4 ID mutant proteins may also be due to a reduced affinity for APC/C.

Our study further identified an inhibitory activity within the RECQ4 C-terminal 115 residues (1093–1208) that blocks the APC/C interaction with RECQ4 ABD2. Because these C-terminal residues are spatially located in proximity to ABD2, we suggest that a protein–protein interaction with these C-terminal residues blocks the nearby RECQ4 ABD2. Both BUB3 and EMI1 function as APC/C inhibitors^49,50. However, only interaction with EMI1 was mapped to the terminal 115 residues of RECQ4 and inversely correlated with the interaction of RECQ4 with APC/C. EMI1 may interact with the RECQ4 C-terminus to block APC/C from accessing ABD2; these mutually exclusive interactions suggest a possible new mechanism by which EMI1 inhibits APC/C activity during S phase. In cells expressing a RECQ4 C-terminal truncation mutant, such as Q757X or D1093X, RECQ4-EMI1 interaction was weakened, allowing the RECQ4 N-terminus to increase interaction with and activate APC/C, thereby enhancing Geminin degradation and DNA replication initiation during S phase.

Negative regulation of DNA replication initiation by the RECQ4 C-terminus may act to prevent unscheduled origin firing during G₁/S transition (Fig. 7h). The increased origin firing frequency we observed in Q757X mutant cells is consistent with the accelerated cell cycle progression of both G₁ and S phases, resulting in the faster growth rate observed in RECQ4 Q757X mutant vs. WT cells. In addition, APC/C-mediated re-replication can be induced during development and tissue regeneration in response to developmental signaling or external stress^44,45. Re-replication has emerged as a key step during differentiation of multiple tissues⁵¹, and Drosophila RECQ4 has been shown to promote re-replication during development⁵². Because we observed an increased number of RECQ4 Q757X mutant vs. WT cells with DNA index >4N, likely due to additional rounds of DNA replication without cell division, this suggests that negative regulation of replication initiation by the RECQ4 C-terminus is related to suppressing re-replication (Fig. 7h). Our study also provides an explanation of why mouse embryonic fibroblasts isolated from mice expressing only the N-terminal RECQ4 domain were hyperploid⁶. Geminin and SKP2 prevent re-replication by limiting replication to one round of origin firing per cell cycle^41,42,43,53. It would be of great interest for future studies to determine if RECQ4 facilitates re-replication via the activation of APC/C to degrade Geminin and SKP2 during tissue differentiation and promote tissue development. If so, it would be important to determine how cells switch between RECQ4-APC/C and RECQ4-EMI1 complexes during these processes, and if this regulation involves post-translational modifications. It is worth noting that APC2, a component of the APC/C complex, has been detected in a synthetic genetic array analysis of the yeast Hrq1 (RECQ4 homolog) protein complex⁵⁴. It remains to be determined if the role of RECQ4-APC/C interaction in replication initiation is conserved in yeast.

Clinical analyses indicate that more than 50% of RTS cases are consequences of mutations in the RECQ4 gene^55,56. Recently, ANAPC1, which encodes APC1, the largest subunit of APC/C, was also identified as a genetic risk factor that when mutated, contributes to RTS pathogenesis in the remaining RTS patient population with intact RECQ4 gene copies²⁰. Our study used an unbiased proteomic approach to uncover mechanistic insights into the functional link between these two RTS factors in regulating DNA replication initiation. The significance of this link is underscored by the fact that RECQ4 clinical mutations alter RECQ4 interaction with APC/C. It would be of great interest to determine if RECQ4 clinical mutations induce deregulation of the RECQ4-APC/C interaction, leading to abnormal replication origin firing and high DNA content, which contributes to developmental abnormalities associated with RTS and cancer pathogenesis.

Our mass spectrometry analysis also identified changes in RECQ4 cytoplasmic interactions by the Q757X mutation. While beyond the scope of the current study, it would be of great interest to explore the functional significance of these interactions. For example, UBA1 is a ubiquitin E1 ligase, and its interaction with RECQ4 may regulate ubiquitination and protein degradation in other cellular processes. In addition, RECQ4 interacts with ACLY, a key enzyme to support Warburg effect⁵⁷. We previously showed that RECQ4 ID mutant proteins accelerated cell growth by inducing Warburg effect through mitochondrial dysfunction¹⁷. Further work is needed to determine the contribution of RECQ4-ACLY interaction to Warburg effect. Because this interaction is impaired by the Q757X mutation in cytoplasm, it is possible that Q757X-ID double mutant does not share the same growth advantage as either Q757X or ID mutant over WT RECQ4, because it fails to enhance origin firing as well as Warburg effect.

Methods

Plasmids

A pCMV-FLAG-RECQ4 plasmid was previously constructed¹⁰. pMCV-FLAG-RECQ4-Q757X and pCMV-FLAG-RECQ4-D1093X plasmids were generated by site-directed mutagenesis of the pCMV-FLAG-RECQ4 plasmid. A pCMV-RECQ4-Q757X-ID plasmid was generated by the combination of pCMV-FLAG-RECQ4-ID¹⁷ and pCMV-FLAG-RECQ4-Q757X at the BamHI site. pCMV-FLAG-RECQ4(1–480), pCMV-FLAG-RECQ4(1–340), pCMV-FLAG-RECQ4(1–240), and FLAG-RECQ4(751–1208) plasmids were prepared by PCR amplification of cDNAs and cloning into the NdeI and XhoI sites of a pCMV-FLAG vector. To generate pCMV-HA-APC5 plasmid, APC5 cDNA was PCR-amplified from a Hela cDNA library and cloned into the XhoI and EcoRI sites of a pCMV-HA vector, which was modified from the pCMV-FLAG vector. A Tet-pLKO-shAPC5 plasmid was constructed by cloning annealed shRNA sequences into a Tet-pLKO-Puro vector (Addgene, #21915). Ubiquitin (Ubi) and Geminin (GMNN) cDNA were PCR-amplified from a Hela cDNA library. A pET-16b-Ubi plasmid was constructed by inserting ubiquitin cDNA into a pET-16b vector (Novagen) with NdeI and XhoI sites. A pTXB1-GMNN plasmid was constructed by inserting Geminin cDNA into a pTXB1 vector (NEB) with NdeI and XhoI sites. Primer sequences were as follows: RECQ4_fwd 5’-GGTCGTCATATGGAGCGGCTGCGGGACGTGCGGGAG-3′; RECQ4_rv 5′-CCG CTCGAGAGCGGGCCACCTGCAGGAG-3′; R751_fwd 5′-GGATCATATGCGGG AACGGCGGGTACAGC-3′; 1-340_rv 5′-CC GCTCGAGGTGCAGGGGGGCTGTG CCT-3′; 1-480_rv 5′-CCGCTCGAGGGCTTG GTGCCCCAGCTGCTC-3′; Q757X 5′-GGGAACGGCGGCGGGTATAGCGAGCCTTCATGCAG-3′; D1093M 5′-CCC TGCCTGGAGCAGCAGATGAGGAGCGCAGCAC-3′; APC5_fwd 5′-CCGCTCGA GATGGCCAGCGTCCACGAGAGCCT-3′; APC5_rv 5′-CGGAATTCCTAGAGAT GGTTTATCAAGGGTACC-3′; shAPC5_fwd 5′-CCGGTCTCTCCCTATAAATGAT GTACTCGAGTACATCATTTATAGGGAGA GATTTTTG-3′; shAP5_rv 5′-AATTC AAAAATCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGA-3′; Ubi_fwd 5′-GGAATTCCATATGCAGA TCTTCGTGAAAACC-3′; Ubi_rv 5′-CCGCTCGAGCTAACCACCTCTCAGACGCAG-3′; GMNN_fwd 5′-GGAATTCC ATATGAATCCCAGTATGAAGCAGAAAC-3′; GMNN_rv 5′-CCGCTCGAGAGC TATACATGGCTTTGCATCCG-3′.

Cell culture, colony formation, and cell proliferation assay

RECQ4 KD HEK293 cells generated previously²¹ and parental HEK293 cells (ATCC CRL-1573) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) with streptomycin and penicillin. To generate HEK293 cells stably expressing FLAG-RECQ4 WT or mutant proteins, RECQ4 KD HEK293 cells were transfected with the corresponding pCMV-FLAG-RECQ4 plasmids using lipofectamine 2000 (Invitrogen). Single clones were selected with G418 and analyzed for expression of the FLAG-tagged proteins, with the exception of the RECQ4 fragment analysis shown in Fig. 4d using cells 48 h after transient transfection. For proteasome inhibition, cells were treated with 10 μM MG132 (A2585, APExBIO) for 4 h before harvest. Colony formation assay was carried out by seeding 500 cells per 10 cm dish for a minimum of 14 days. Plates from each experiment were incubated for the same amount of time, stained with 0.5% crystal violet, and dried overnight. For cell irradiation, cells were treated with 6 Gy of IR (Gammacell 3000) and harvested 2 h after IR treatment. The real-time cell growth assay was performed using xCELLigence Real-Time Cell Analysis (RTCA) DP (Agilent). Cell cycle analysis was carried out as previously described⁵⁸. Cells were synchronized at G₂/M phase using 50 ng/ml nocodazole in complete medium for 20 h. Cells were then released by washing 2x with warm complete DMEM medium. To incorporate BrdU, cells were pulse-labeled with 20 μM BrdU for 30 min before harvest at indicated time points. Cells were then stained with Rat anti-BrdU antibody followed by anti-Rat DyLight 488-conjugated secondary antibody and propidium iodide. Flow cytometry analysis was performed using a CyAn ADP analyser (Beckman Coulter). Cell cycle profile distributions were determined using FlowJo software (Tree Star Inc., OR). An example of ungated vs gated cell profile distribution was included (Supplementary Fig. 5).

Antibodies

Primary antibodies used were rabbit anti-RECQ4 (4-11) generated against residues 71–80 of human RECQ4 (WB 1:1000)¹⁰, rabbit anti-RECQ4 (17008-1-AP, Proteintech, IP 1:200), mouse anti-RECQ4 (sc-518189, Santa Cruz, WB 1:1000), mouse anti-alpha tubulin (sc-5286, Santa Cruz, WB 1:1000), rabbit anti-APC1 (21748-1-AP, Proteintech, WB 1:1000), rabbit anti-APC5 (AP7109, Abclonal, WB 1:1000), mouse anti-APC11 (sc-517142, Santa Cruz, WB 1:1000), rabbit anti-beta actin (20536-1-AP, Proteintech, WB 1:1000), rabbit anti-BUB3 (27073-1-AP, Proteintech, WB 1:1000), mouse anti-BUB3 (sc-376506, Santa Cruz, WB 1:1000), rabbit anti-C1QBP (P32) (5734S, Cell Signaling, WB 1:1000), rabbit anti-CDC20 (10252-1-AP, Proteintech, WB 1:1000), rabbit anti-CDC45 (A2047, Abclonal, WB 1:1000), mouse anti-CDC6 (sc-9964, Santa Cruz, WB 1:1000), rabbit anti-CDT1 (A16576, Abclonal, WB 1:1000), rabbit anti-Cyclin A (PA5-16519, Thermo Fisher Scientific, WB 1:1000), mouse anti-Cyclin E (ab3927, Abcam, WB 1:1000), rabbit anti-DNA pol δ (sc-10784, Santa Cruz, WB 1:1000), rabbit anti-FBXO5 (EMI1) (10872-1-AP, Proteintech, WB 1:1000), mouse anti-FLAG (66008-3-Ig, Proteintech, WB 1:1000), rabbit anti-FLAG (20543-1-AP, Proteintech, WB 1:3000), rabbit anti-FZR1 (CDH1) (16368-1-AP, Proteintech, WB 1:1000), rabbit anti-Geminin (10802-1-AP, Proteintech, WB 1:1000), rabbit anti-GINS4 (A8592, Abclonal, WB 1:1000), rabbit anti-Histone H3 (sc-10809, Santa Cruz, WB 1:1000), rabbit anti-Lamin A/C (sc-20681, Santa Cruz, WB 1:1000), rabbit anti-MCM7 (ab52489, Abcam, WB 1:1000), rabbit anti-MCM2 (10513-1-AP, Proteintech, WB 1:1000), mouse anti-MCM5 (sc-165994, Santa Cruz, WB 1:1000), rabbit anti-ORC2 (A302-734A, Bethyl, WB 1:1000), rabbit anti-PSF2 (GINS2) (16247-1-AP, Proteintech, WB 1:1000), mouse anti-GINS2 (sc-376595, Santa Cruz, WB 1:1000), rabbit anti-PP2A (2039S, Cell Signaling, WB 1:1000), rabbit anti-SKP2 (A302-436A, Bethyl, WB 1:1000), rabbit anti-UBE1 (UBA1) (671981-1-Ig, Proteintech, WB 1:1000), rat anti-BrdU/CldU (MCA2060T, Bio-Rad, IF 1:200), mouse anti-BrdU/IdU (347580, BD Biosciences, IF 1:200), goat anti-rat IgG (H + L) Alexa Fluor Plus 488 conjugated (A48262, Invitrogen, IF 1:200), goat anti-mouse IgG (H + L) Alexa Fluor 568 conjugated (A-11004, Invitrogen, IF 1:200), goat anti-rat IgG (H + L) DyLight 488 (SA5-10018, Invitrogen, Flow Cytometry 1:100).

Lentivirus production and transduction

Lentivirus production was carried out according to the protocol described previously⁵⁹. Briefly, lentiviral particles were produced by co-transfection of HEK293FT cells with 8 μg Tet-pLKO/shAPC5 or Tet-pLKO/Scrambled (Addgene, #47541), 6 μg packaging plasmid psPAX2, and 2 μg envelope plasmid pMD2G by using lipofectamine 2000. The transfection medium was changed after 8 h, and recombinant lentiviruses were harvested 48 h and 72 h later. The virus particles-containing supernatant were centrifuged at 100 × g for 5 minutes, filtered through 0.45 μM PES membrane filters, and concentrated using PEG-8000, and aliquoted and stored at −80 °C until needed. For lentivirus transduction, cells were seeded in 10 cm dishes in Tet-free complete DMEM medium. Concentrated virus was directly overlaid on cells and polybrene was added at a final concentration of 10 μg/ml. Medium was changed at 12 h and cells were split at 48 h, then selection was started by adding 2 μg/ml of puromycin for 72 h. shRNA expression was induced by adding doxycycline (20 ng/ml) for 48–72 h.

Cell fractionation, co-immunoprecipitation, and mass spectrometry

Cell fractionation procedure was adapted from the previously published protocol¹⁰. Briefly, asynchronized cells in log phase (less than 70% confluency) were harvested and lysed with 3x volume of cytoplasmic lysis buffer (10 mM Tris·HCl pH 7.9, 0.34 M sucrose, 3 mM CaCl₂, 2 mM magnesium acetate, 0.1 mM EDTA, 1 mM DTT, 0.5% Nonidet P-40, 1x protease inhibitors, and 1x phosphatase inhibitor), and intact nuclei were pelleted by centrifugation at 3500 × g for 5 min. Nuclei were washed with cytoplasmic lysis buffer without inhibitors and then lysed with 2x volume of nuclear lysis buffer (20 mM HEPES pH 7.9, 3 mM EDTA, 10% glycerol, 150 mM KCl, 1.5 mM MgCl₂, 1 mM DTT, 0.1% Nonidet P-40, 1x protease inhibitors, and 1x phosphatase inhibitor) and homogenized using a 21G1/2 needle. The nucleoplasmic fraction was cleared by centrifugation at 15,000 × g for 30 min. The chromatin-enriched pellet was then resuspended in 2x volume of nuclease incubation buffer (20 mM Hepes pH 7.9, 1.5 mM MgCl₂, 150 mM KCl, 10% glycerol, protease inhibitors, and 1x phosphatase inhibitor) and 0.15 unit/μl benzonase (MilliporeSigma). The sample was cleared by centrifugation at 20,000 × g for 30 min, and supernatant containing the solubilized native chromatin proteins was collected. Co-immunoprecipitation of FLAG-RECQ4 was conducted using ANTI-FLAG M2 affinity gel (MilliporeSigma). Cell fractions were incubated overnight with ANTI-FLAG M2 affinity gel at 4 °C. Beads were pelleted by centrifugation and washed extensively with FLAG-A-binding buffer (10 mM HEPES pH 7.9, 1.5 mM MgCl₂, 0.3 M NaCl, 10 mM KCl, 0.2% Triton X-100, and 10% glycerol). The FLAG-tagged protein complexes were eluted by using either SDS loading buffer or FLAG elution A buffer (20 mM HEPES 7.9, 0.2 M NaCl, 0.2 mM EDTA, 0.05% Triton-X, 0.3 mg/ml 3xFLAG peptide, and 10% glycerol). For mass spectrometry analysis, purified FLAG-RECQ4 protein complexes were loaded onto a Mini-PROTEAN precast polyacrylamide gel (BioRad). After the eluent migrated 1 cm from the well into the gel, the gel was fixed with collodial coomassie stain (Invitrogen), and the 1 cm gel slice was excised and stored in ddH2O prior to mass spectrometry analysis. Mass spectrometry analysis was performed by the Taplin Biological Mass Spectrometry Core Facility at Harvard University^60,61,62. Briefly, gel slices were resuspended in reducing buffer (50 mM NH₄HCO₃, 1 mM DTT) for 30 min at 60 °C, followed by the addition of 5 mM iodoacetamide for 15 min at room temperature and quenching with 5 mM DTT. Gel slices were washed, dehydrated with acetonitrile, and dried. For trypsin digestion, gel slices were rehydrated in 50 mM NH₄HCO₃ containing 12.5 ng/μl modified sequencing-grade trypsin (Promega, V5111) and then incubated at 37 °C overnight. Peptides were extracted and reconstituted in 10 µl of solvent A (2.5% acetonitrile, 0.1% formic acid). Each digested sample was loaded via a Famos autosampler (LC Packings) onto a nano-scale reverse-phase HPLC capillary column, which was prepared by packing 2.6 µm C18 spherical silica beads into a fused silica capillary (100 µm inner diameter; 30 cm length). Peptides were eluted with increasing concentrations of solvent B (97.5% acetonitrile, 0.1% formic acid). Peptides, as they were eluted from the column, were subjected to electrospray ionization before entering an LTQ Orbitrap Velos Pro ion-trap mass spectrometer (Thermo Fisher Scientific) to produce a tandem mass spectrum of specific fragment ions for each peptide. Software program Sequest (Thermo Fisher Scientific) was used to determine peptide sequences and protein identity by matching the acquired fragmentation pattern with the human proteome database. All databases include a reversed version of all the sequences and the data was filtered with a cutoff at 1% peptide false discovery rate. Endogenous RECQ4 and associated proteins were immunopurified from parental HEK293 WCE prepared from the indicated time points post nocodazole release using a rabbit anti-RECQ4 antibody (Proteintech) conjugated to protein A agarose beads (Pierce).

DNA fiber analysis

Cells were labeled with 50 μM IdU for 30 min and then 50 μM CldU for 30 min. Cells were then trypsinized and resuspended in ice-cold PBS at 2.5 × 10⁵ cell/ml. DNA spreads were made as previously described⁶³ with modifications. Briefly, 2 μl cell suspensions were mixed with 8 μl spreading buffer (200 mM Tris-HCl pH 7.4, 50 mM EDTA, 0.5% SDS) on a silane-coated slide. After 5 min, the slides were tilted at 15° to allow DNA to run down the slide, air dried, and then fixed in methanol/acetic acid (3:1). The slides were treated with 2.5 N HCl at 37 °C for 1 h, washed 3 times in PBS, and blocked with 2% bovine serum albumin in PBS. The slides were then incubated with mouse anti-BrdU/IdU and rat anti-BrdU/CldU in blocking buffer at 4 °C overnight. After washing, the slides were incubated in secondary antibody mixture of Alexa Fluor 488-conjugated goat anti-rat and Alexa Fluor 568-conjugated goat anti-mouse (Invitrogen) at room temperature for 1 h. The slides were then washed and mounted in Prolong gold antifade (Invitrogen). Microscopy was carried out using a Zeiss Axio Observer with oil immersion lens. Fiber length was measured based on a conversion factor of 1 µm to 2.59 kb.

Protein expression and purification

Recombinant His-tagged, FLAG-tagged RECQ4 WT, and mutant fragments were prepared as previously described⁶⁴. Ubiquitin was overexpressed in E. coli BL21(DE3) (Novagen) and induced by 0.8 mM IPTG for 4 h at 30 °C in LB medium. After cell lysis and centrifugation, Ubiquitin was affinity purified from supernatant using HisPur Cobalt resin (Thermo Fisher Scientific). Geminin was overexpressed in E. coli BL21(DE3) and induced by 0.1 mM IPTG overnight at 16 °C in LB medium. After cell lysis and centrifugation, supernatant was loaded onto chitin resin (NEB). Geminin was cleaved and eluted from chitin resin with 50 mM DTT. All proteins were dialysis against 20 mM Tris pH 7.5, 150 mM NaCl, 0.1 mM EDTA.

In vitro DNA binding, protein pull-down, and ubiquitination assays

DNA binding reactions, which were based on the previously published protocol⁶⁴, were initiated by incubating WT or mutant RECQ4 proteins with 4 pg of ³²P-labeled single-stranded DNA oligo in DNA binding buffer (30 mM HEPES pH 7.5, 1 mM DTT, 100 µg/ml BSA) on ice for 15 min. The reactions were cross-linked with 1% glutaraldehyde at 37 °C for 15 min, and the protein-DNA complexes were analyzed on 5% native polyacrylamide gels. For APC/C pull-down from the chromatin fraction using purified recombinant His-RECQ4-FLAG protein fragments, CB fractions were incubated with M2 agarose pre-bound with His-RECQ4-FLAG protein fragments for 4 h at 4 °C. Unbound proteins were removed by washing the beads extensively with FLAG-A-binding buffer. For in vitro ubiquitination assays, cell lysates were prepared from RECQ4 KD HEK293 cells stably overexpressing FLAG-RECQ4 WT or Q757X mutant. To deplete APC/C complexes in cell lysates, 2 µg APC5 antibody or rabbit IgG (control) was added into 100 µl each cell lysate and incubated overnight at 4 °C, and protein A/G beads (Santa Cruz) were used to immunoprecipitate APC/C complexes. Geminin was labeled with Fluorescein isothiocyanate (FITC) by incubating 2 µg Geminin with 100 ng FITC for 2 h at room temperature, then dialyzing against 20 mM Tris pH 7.5, 150 mM NaCl, 0.1 mM EDTA. Ubiquitination assay was carried out by mixing various concentrations of cell lysates with 500 nM FITC-Geminin, 100 nM UBA1 (R&D SYSTEM, catalog: E-305), 250 nM Ube2S (G-Bioscience, catalog: BAN0353), 250 nM Ube2C (R&D SYSTEM, catalog: E2-654), 25 nM CDH1 (AVIVA Systems Biology, catalog: OPCA02549), 60 µM Ubiquitin, and 1 µM ubiquitin aldehyde (AdipoGen Life Sciences, catalog: SBB-PS0031) in reaction buffer (40 mM Tris-HCl (pH 7.5), 1 mM DTT, 5 mM MgCl₂, 3 mM ATP) with or without 0.1% SDS in total 10 μl reaction volume for 1 h at 37 ˚C. The extent of ubiquitination of Geminin was resolved by 10% SDS-PAGE and visualized by Odyssey Fc (LI-COR) at 600 nm.

Statistics and reproducibility

For all experiments, unless stated otherwise, representative analyses from a minimum of three independent experiments with similar results are shown. All in vitro analyses using purified recombinant proteins were performed at least three times using two different sets of purified proteins. For cell growth analyses, each value represents mean ± standard deviation (SD) calculated from a minimum of three biologically independent samples. p values were calculated using two-tailed student’s t-tests for statistically significant differences.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data generated or analyzed during this study are included in this published article (and its Supplementary Information files). The full list of mass spectrometry data generated in this study are provided in Supplementary Data 1 and 2. The mass spectrometry proteomics data generated in this study have been deposited to the ProteomeXchange Consortium via the MassIVE partner repository with the dataset identifier PXD040394 for FLAG-RECQ4 WT and PXD040395 for Q757X chromatin-bound complexes. Source data are provided with this paper.

References

Kitao, S. et al. Cloning of two new human helicase genes of the RecQ family: biological significance of multiple species in higher eukaryotes. Genomics 54, 443–452 (1998).
Article CAS PubMed Google Scholar
Larizza, L., Magnani, I. & Roversi, G. Rothmund-Thomson syndrome and RECQL4 defect: splitting and lumping. Cancer Lett. 232, 107–120 (2006).
Article CAS PubMed Google Scholar
Siitonen, H. A. et al. The mutation spectrum in RECQL4 diseases. Eur. J. Hum. Genet. 17, 151–158 (2009).
Article CAS PubMed Google Scholar
Liu, Y. Rothmund-Thomson syndrome helicase, RECQ4: on the crossroad between DNA replication and repair. DNA Repair 9, 325–330 (2010).
Article ADS CAS PubMed Google Scholar
Ickikawa, K., Noda, T. & Furuichi, Y. Preparation of the gene targeted knockout mice for human premature aging diseases, Werner syndrome, and Rothmund-Thomson syndrome caused by the mutation of DNA helicases. Nippon Yakurigaku Zasshi 119, 219–226 (2002).
Article Google Scholar
Mann, M. B. et al. Defective sister-chromatid cohesion, aneuploidy and cancer predisposition in a mouse model of type II Rothmund-Thomson syndrome. Hum. Mol. Genet. 14, 813–825 (2005).
Article CAS PubMed Google Scholar
Abe, T. et al. The N-terminal region of RECQL4 lacking the helicase domain is both essential and sufficient for the viability of vertebrate cells. Role of the N-terminal region of RECQL4 in cells. Biochim. Biophys. Acta 1813, 473–479 (2011).
Article CAS PubMed Google Scholar
Matsuno, K., Kumano, M., Kubota, Y., Hashimoto, Y. & Takisawa, H. The N-terminal noncatalytic region of Xenopus RecQ4 is required for chromatin binding of DNA polymerase alpha in the initiation of DNA replication. Mol. Cell Biol. 26, 4843–4852 (2006).
Article CAS PubMed PubMed Central Google Scholar
Sangrithi, M. N. et al. Initiation of DNA replication requires the RECQL4 protein mutated in Rothmund-Thomson syndrome. Cell 121, 887–898 (2005).
Article CAS PubMed Google Scholar
Xu, X., Rochette, P. J., Feyissa, E. A., Su, T. V. & Liu, Y. MCM10 mediates RECQ4 association with MCM2-7 helicase complex during DNA replication. EMBO J. 28, 3005–3014 (2009).
Article CAS PubMed PubMed Central Google Scholar
Im, J. S. et al. Assembly of the Cdc45-Mcm2-7-GINS complex in human cells requires the Ctf4/And-1, RecQL4, and Mcm10 proteins. Proc. Natl Acad. Sci. USA 106, 15628–15632 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Thangavel, S. et al. Human RECQ1 and RECQ4 helicases play distinct roles in DNA replication initiation. Mol. Cell Biol. 30, 1382–1396 (2010).
Article CAS PubMed PubMed Central Google Scholar
Shin, G., Jeong, D., Kim, H., Im, J. S. & Lee, J. K. RecQL4 tethering on the pre-replicative complex induces unscheduled origin activation and replication stress in human cells. J. Biol. Chem. 294, 16255–16265 (2019).
Article CAS PubMed PubMed Central Google Scholar
Mehrotra, S. & Mittra, I. Origin of genome instability and determinants of mutational landscape in cancer cells. Genes 11, 1101 (2020).
Article CAS PubMed PubMed Central Google Scholar
Yu, M. Generation, function and diagnostic value of mitochondrial DNA copy number alterations in human cancers. Life Sci. 89, 65–71 (2011).
Article CAS PubMed Google Scholar
Clay Montier, L. L., Deng, J. J. & Bai, Y. Number matters: control of mammalian mitochondrial DNA copy number. J. Genet. Genomics 36, 125–131 (2009).
Article PubMed PubMed Central Google Scholar
Wang, J. T., Xu, X., Alontaga, A. Y., Chen, Y. & Liu, Y. Impaired p32 regulation caused by the lymphoma-prone RECQ4 mutation drives mitochondrial dysfunction. Cell Rep. 7, 848–858 (2014).
Article CAS PubMed PubMed Central Google Scholar
Gao, J. et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal 6, pl1 (2013).
Article PubMed PubMed Central Google Scholar
Barford, D. Structural interconversions of the anaphase-promoting complex/cyclosome (APC/C) regulate cell cycle transitions. Curr. Opin. Struct. Biol. 61, 86–97 (2020).
Article CAS PubMed Google Scholar
Ajeawung, N. F. et al. Mutations in ANAPC1, encoding a scaffold subunit of the anaphase-promoting complex, cause Rothmund-Thomson syndrome type 1. Am. J. Hum. Genet. 105, 625–630 (2019).
Article CAS PubMed PubMed Central Google Scholar
Chang, C. W. et al. Pathogenic mutations reveal a role of RECQ4 in mitochondrial RNA:DNA hybrid formation and resolution. Sci. Rep. 10, 17033 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Smits, A. H. et al. Biological plasticity rescues target activity in CRISPR knock outs. Nat. Methods 16, 1087–1093 (2019).
Article CAS PubMed Google Scholar
Lygerou, Z. & Nurse, P. Cell cycle. License withheld−geminin blocks DNA replication. Science 290, 2271–2273 (2000).
Article CAS PubMed Google Scholar
Greenberg, A. & Simon, I. S phase duration is determined by local rate and global organization of replication. Biology 11, 718 (2022).
Article CAS PubMed PubMed Central Google Scholar
Ge, X. Q., Jackson, D. A. & Blow, J. J. Dormant origins licensed by excess Mcm2-7 are required for human cells to survive replicative stress. Genes Dev. 21, 3331–3341 (2007).
Article CAS PubMed PubMed Central Google Scholar
Woodward, A. M. et al. Excess Mcm2-7 license dormant origins of replication that can be used under conditions of replicative stress. J. Cell Biol. 173, 673–683 (2006).
Article CAS PubMed PubMed Central Google Scholar
Hayakawa, T., Suzuki, R., Kagotani, K., Okumura, K. & Takebayashi, S. I. Camptothecin-induced replication stress affects DNA replication profiling by E/L Repli-Seq. Cytogenet Genome Res. 161, 437–444 (2021).
Article CAS PubMed Google Scholar
Masai, H., You, Z. & Arai, K. Control of DNA replication: regulation and activation of eukaryotic replicative helicase, MCM. IUBMB Life 57, 323–335 (2005).
Article CAS PubMed Google Scholar
Yang, Y., Tsuchiya, D. & Lacefield, S. Bub3 promotes Cdc20-dependent activation of the APC/C in S. cerevisiae. J. Cell Biol. 209, 519–527 (2015).
Article CAS PubMed PubMed Central Google Scholar
Sudakin, V., Chan, G. K. & Yen, T. J. Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J. Cell Biol. 154, 925–936 (2001).
Article CAS PubMed PubMed Central Google Scholar
Yamano, H. APC/C: current understanding and future perspectives. F1000Res. 8, F1000 Faculty Rev-725 (2019).
Zhang, S., Tischer, T. & Barford, D. Cyclin A2 degradation during the spindle assembly checkpoint requires multiple binding modes to the APC/C. Nat. Commun. 10, 3863 (2019).
Article ADS PubMed PubMed Central Google Scholar
Tada, S. Cdt1 and geminin: role during cell cycle progression and DNA damage in higher eukaryotes. Front Biosci. 12, 1629–1641 (2007).
Article CAS PubMed Google Scholar
Sivaprasad, U., Machida, Y. J. & Dutta, A. APC/C−the master controller of origin licensing? Cell Div. 2, 8 (2007).
Article PubMed PubMed Central Google Scholar
Machida, Y. J. & Dutta, A. The APC/C inhibitor, Emi1, is essential for prevention of rereplication. Genes Dev. 21, 184–194 (2007).
Article CAS PubMed PubMed Central Google Scholar
Marino, F. et al. Structural and biochemical characterization of an RNA/DNA binding motif in the N-terminal domain of RecQ4 helicases. Sci. Rep. 6, 21501 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
McGarry, T. J. & Kirschner, M. W. Geminin, an inhibitor of DNA replication, is degraded during mitosis. Cell 93, 1043–1053 (1998).
Article CAS PubMed Google Scholar
Schrock, M. S., Stromberg, B. R., Scarberry, L. & Summers, M. K. APC/C ubiquitin ligase: functions and mechanisms in tumorigenesis. Semin Cancer Biol. 67, 80–91 (2020).
Article CAS PubMed PubMed Central Google Scholar
Bashir, T., Dorrello, N. V., Amador, V., Guardavaccaro, D. & Pagano, M. Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase. Nature 428, 190–193 (2004).
Article ADS CAS PubMed Google Scholar
Mailand, N. & Diffley, J. F. CDKs promote DNA replication origin licensing in human cells by protecting Cdc6 from APC/C-dependent proteolysis. Cell 122, 915–926 (2005).
Article CAS PubMed Google Scholar
Kim, Y. & Kipreos, E. T. Cdt1 degradation to prevent DNA re-replication: conserved and non-conserved pathways. Cell Div. 2, 18 (2007).
Article PubMed PubMed Central Google Scholar
Liu, E., Li, X., Yan, F., Zhao, Q. & Wu, X. Cyclin-dependent kinases phosphorylate human Cdt1 and induce its degradation. J. Biol. Chem. 279, 17283–17288 (2004).
Article CAS PubMed Google Scholar
Jang, S.-M. et al. The replication initiation determinant protein (RepID) modulates replication by recruiting CUL4 to chromatin. Nat. Commun. 9, 2782 (2018).
Article ADS PubMed PubMed Central Google Scholar
Hochegger, H. et al. An essential role for Cdk1 in S phase control is revealed via chemical genetics in vertebrate cells. J. Cell Biol. 178, 257–268 (2007).
Article CAS PubMed PubMed Central Google Scholar
Lee, H. O., Davidson, J. M. & Duronio, R. J. Endoreplication: polyploidy with purpose. Genes Dev. 23, 2461–2477 (2009).
Article CAS PubMed PubMed Central Google Scholar
Wang, L. L. et al. Association between osteosarcoma and deleterious mutations in the RECQL4 gene in Rothmund-Thomson syndrome. J. Natl Cancer Inst. 95, 669–674 (2003).
Article CAS PubMed Google Scholar
Kaiser, S., Sauer, F. & Kisker, C. The structural and functional characterization of human RecQ4 reveals insights into its helicase mechanism. Nat. Commun. 8, 15907 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Wasilewski, M., Chojnacka, K. & Chacinska, A. Protein trafficking at the crossroads to mitochondria. Biochim. Biophys. Acta Mol. Cell Res. 1864, 125–137 (2017).
Article CAS PubMed Google Scholar
Yang, Y. & Lacefield, S. Bub3 activation and inhibition of the APC/C. Cell Cycle 15, 1–2 (2016).
Article PubMed PubMed Central Google Scholar
McLean, J. R., Chaix, D., Ohi, M. D. & Gould, K. L. State of the APC/C: organization, function, and structure. Crit. Rev. Biochem. Mol. Biol. 46, 118–136 (2011).
Article CAS PubMed PubMed Central Google Scholar
Gandarillas, A., Molinuevo, R. & Sanz-Gómez, N. Mammalian endoreplication emerges to reveal a potential developmental timer. Cell Death Differ. 25, 471–476 (2018).
Article PubMed PubMed Central Google Scholar
Wu, J., Capp, C., Feng, L. & Hsieh, T. S. Drosophila homologue of the Rothmund-Thomson syndrome gene: essential function in DNA replication during development. Dev. Biol. 323, 130–142 (2008).
Article CAS PubMed PubMed Central Google Scholar
Gonzalez, M. A. et al. Geminin is essential to prevent endoreduplication and to form pluripotent cells during mammalian development. Genes Dev. 20, 1880–1884 (2006).
Article CAS PubMed PubMed Central Google Scholar
Sanders, E., Nguyen, P. A., Rogers, C. M. & Bochman, M. L. Comprehensive synthetic genetic array analysis of alleles that interact with mutation of the Saccharomyces cerevisiae RecQ helicases Hrq1 and Sgs1. G3 10, 4359–4368 (2020).
Article CAS PubMed PubMed Central Google Scholar
Larizza, L., Roversi, G. & Volpi, L. Rothmund-Thomson syndrome. Orphanet J. Rare Dis. 5, 2 (2010).
Article PubMed PubMed Central Google Scholar
Kellermayer, R. The versatile RECQL4. Genet. Med. 8, 213–216 (2006).
Article CAS PubMed Google Scholar
Icard, P. et al. ATP citrate lyase: a central metabolic enzyme in cancer. Cancer Lett. 471, 125–134 (2020).
Article CAS PubMed Google Scholar
Xu, X., Wang, J. T., Li, M. & Liu, Y. TIMELESS suppresses the accumulation of aberrant CDC45.MCM2-7.GINS replicative helicase complexes on human chromatin. J. Biol. Chem. 291, 22544–22558 (2016).
Article CAS PubMed PubMed Central Google Scholar
Tian, J. & Andreadis, S. T. Independent and high-level dual-gene expression in adult stem-progenitor cells from a single lentiviral vector. Gene Ther. 16, 874–884 (2009).
Article CAS PubMed PubMed Central Google Scholar
Peng, J. & Gygi, S. P. Proteomics: the move to mixtures. J. Mass Spectrom. 36, 1083–1091 (2001).
Article ADS CAS PubMed Google Scholar
Magli, A. et al. Pax3 cooperates with Ldb1 to direct local chromosome architecture during myogenic lineage specification. Nat. Commun. 10, 2316 (2019).
Article ADS PubMed PubMed Central Google Scholar
Yang, X., Triboulet, R., Liu, Q., Sendinc, E. & Gregory, R. I. Exon junction complex shapes the m6A epitranscriptome. Nat. Commun. 13, 7904 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Jackson, D. A. & Pombo, A. Replicon clusters are stable units of chromosome structure: evidence that nuclear organization contributes to the efficient activation and propagation of S phase in human cells. J. Cell Biol. 140, 1285–1295 (1998).
Article CAS PubMed PubMed Central Google Scholar
Xu, X. & Liu, Y. Dual DNA unwinding activities of the Rothmund-Thomson syndrome protein, RECQ4. EMBO J. 28, 568–577 (2009).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Dr. Sarah Wilkinson for her comments and expert editing of this paper. Y.L. is supported by grants from NIH (R01GM127602, R01CA225843, and R01CA130899). N.L. is supported by a grant from NIH (T32CA186895). Research reported in this publication included work performed in the Analytical Cytometry Core, Light Microscopy Digital Imaging Core, and Drug Discovery & Structural Biology Core supported by the NCI of NIH under grant number P30CA033572. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.

Author information

These authors contributed equally: Kenneth Omabe, Nhung Le, Yi-Hsuan Chen, Feng Liang.

Authors and Affiliations

Thermo Fisher Scientific, 5781 Van Allen Way, Carlsbad, CA, 92008, USA
Xiaohua Xu
Vesigen Therapeutics, 790 Memorial Drive, Suite 103, Cambridge, MA, 02139, USA
Chou-Wei Chang
Department of Cancer Genetics and Epigenetics, Beckman Research Institute, City of Hope, Duarte, CA, 91010-3000, USA
Min Li, Kenneth Omabe, Nhung Le & Yilun Liu
Department of Computer Science, University of Southern California, Los Angeles, CA, 90089, USA
Yi-Hsuan Chen
Neuroscience Graduate Program, University of Southern California, Los Angeles, CA, 90089, USA
Feng Liang

Authors

Xiaohua Xu
View author publications
You can also search for this author in PubMed Google Scholar
Chou-Wei Chang
View author publications
You can also search for this author in PubMed Google Scholar
Min Li
View author publications
You can also search for this author in PubMed Google Scholar
Kenneth Omabe
View author publications
You can also search for this author in PubMed Google Scholar
Nhung Le
View author publications
You can also search for this author in PubMed Google Scholar
Yi-Hsuan Chen
View author publications
You can also search for this author in PubMed Google Scholar
Feng Liang
View author publications
You can also search for this author in PubMed Google Scholar
Yilun Liu
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

X.X. and Y.L. conceived the study. X.X. performed most of the experiments. C.W.C. generated key materials, including recombinant RECQ4 proteins, and performed DNA binding analysis. M.L. performed in vitro ubiquitination assays. K.O. performed immunoprecipitation of endogenous RECQ4 IP during the cell cycle. N.L. performed in vitro APC/C pull-down using purified recombinant RECQ4 N-terminal fragments. Y.H.C. assisted in the APC5 shRNA knockdown experiment. F.L. assisted in DNA binding analysis of purified recombinant RECQ4 proteins. X.X. and Y.L. analyzed and interpreted the data. Y.L. wrote the manuscript. All experiments presented in the manuscript were performed by the authors while employed at City of Hope.

Corresponding author

Correspondence to Yilun Liu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Carl Walkley, Yong-jie Xu and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Supplementary Data 2

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Xu, X., Chang, CW., Li, M. et al. DNA replication initiation factor RECQ4 possesses a role in antagonizing DNA replication initiation. Nat Commun 14, 1233 (2023). https://doi.org/10.1038/s41467-023-36968-1

Download citation

Received: 08 December 2021
Accepted: 27 February 2023
Published: 04 March 2023
DOI: https://doi.org/10.1038/s41467-023-36968-1

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.