Ionomycin ameliorates hypophosphatasia via rescuing alkaline phosphatase deficiency-mediated L-type Ca2+ channel internalization in mesenchymal stem cells

Li, Bei; He, Xiaoning; Dong, Zhiwei; Xuan, Kun; Sun, Wei; Gao, Li; Liu, Shiyu; Liu, Wenjia; Hu, Chenghu; Zhao, Yimin; Shi, Songtao; Jin, Yan

doi:10.1038/s41413-020-0090-7

Download PDF

Article
Open access
Published: 26 April 2020

Ionomycin ameliorates hypophosphatasia via rescuing alkaline phosphatase deficiency-mediated L-type Ca²⁺ channel internalization in mesenchymal stem cells

Bei Li^1,2^na1,
Xiaoning He^1,2^na1,
Zhiwei Dong¹^na1,
Kun Xuan³,
Wei Sun⁴,
Li Gao³,
Shiyu Liu^1,2,
Wenjia Liu^1,2,
Chenghu Hu^1,2,
Yimin Zhao¹,
Songtao Shi^5,6 &
…
Yan Jin ORCID: orcid.org/0000-0002-2586-1152^1,2

Bone Research volume 8, Article number: 19 (2020) Cite this article

3273 Accesses
10 Citations
2 Altmetric
Metrics details

Subjects

Abstract

The loss-of-function mutations in the ALPL result in hypophosphatasia (HPP), an inborn metabolic disorder that causes skeletal mineralization defects. In adults, the main clinical features are early loss of primary or secondary teeth, osteoporosis, bone pain, chondrocalcinosis, and fractures. However, guidelines for the treatment of adults with HPP are not available. Here, we show that ALPL deficiency caused a reduction in intracellular Ca²⁺ influx, resulting in an osteoporotic phenotype due to downregulated osteogenic differentiation and upregulated adipogenic differentiation in both human and mouse bone marrow mesenchymal stem cells (BMSCs). Increasing the intracellular level of calcium in BMSCs by ionomycin treatment rescued the osteoporotic phenotype in alpl^+/− mice and BMSC-specific (Prrx1-alpl^−/−) conditional alpl knockout mice. Mechanistically, ALPL was found to be required for the maintenance of intracellular Ca²⁺ influx, which it achieves by regulating L-type Ca²⁺ channel trafficking via binding to the α2δ subunits to regulate the internalization of the L-type Ca²⁺ channel. Decreased Ca²⁺ flux inactivates the Akt/GSK3β/β-catenin signaling pathway, which regulates lineage differentiation of BMSCs. This study identifies a previously unknown role of the ectoenzyme ALPL in the maintenance of calcium channel trafficking to regulate stem cell lineage differentiation and bone homeostasis. Accelerating Ca²⁺ flux through L-type Ca²⁺ channels by ionomycin treatment may be a promising therapeutic approach for adult patients with HPP.

Salt-inducible kinase 1 regulates bone anabolism via the CRTC1–CREB–Id1 axis

Article Open access 31 October 2019

The structural pathology for hypophosphatasia caused by malfunctional tissue non-specific alkaline phosphatase

Article Open access 08 July 2023

BK ablation attenuates osteoblast bone formation via integrin pathway

Article Open access 30 September 2019

Introduction

A loss-of-function mutation in the liver/bone/kidney alkaline phosphatase (ALPL) gene results in the life-threatening disease hypophosphatasia (HPP) during early developmental periods; HPP is characterized by hypomineralization of the skeleton and teeth.^1,2 Adult patients with HPP showed early loss of primary or secondary teeth, osteoporosis, bone pain, chondrocalcinosis, and fractures. Our previous study found age-related bone mass loss and marrow fat gain in heterozygous Alpl^+/− mice.³ Bone marrow mesenchymal stem cells (BMSCs) are multipotent cells capable of differentiating into various cell lineages, including osteoblasts and adipocytes. As age increases, BMSCs are more inclined to undergo differentiation into adipocytes rather than osteoblasts, resulting in an increased number of adipocytes and a decreased number of osteoblasts, which leads to osteoporosis.⁴ Our previous study also showed that ALPL governed the osteo-adipogenic balance in BMSCs and prevented cell senescence.³ ALPL is a ubiquitous plasma membrane-bound enzyme (ectoenzyme) that functions at physiological (neutral) and alkaline pH to hydrolyze several different molecules, including inorganic pyrophosphate,⁵ pyridoxal-5-phosphate (the active form of vitamin B6),⁶ and nucleotides.^7,8,9 However, the detailed mechanism of ALPL causing age-related osteoporosis is largely unknown.

In severely affected infants with HPP, hypercalcemia, and hypercalciuria are often reported as symptoms.^10,11 However, it is still not clear why calcium metabolism abnormalities are induced by an ALPL mutation, since ALPL plays an important role in generating inorganic phosphate. Meanwhile, whether aberrant calcium metabolism is involved in age-related osteoporosis in heterozygous Alpl^+/− mice is also unclear. It is well accepted that calcium metabolism abnormalities are closely related to calcium channels on the cell surface. Calcium influx is controlled by voltage-gated Ca²⁺ channels (VGCCs) or agonist-dependent and voltage-independent Ca²⁺ entry pathways, which are called ‘store-operated’ Ca²⁺ channels (SOCs). Changes in intracellular Ca²⁺ concentration ([Ca²⁺]_i) play an essential role in regulating motility, apoptosis, differentiation, and many other cellular processes.¹² Aberrant intracellular [Ca²⁺]_i leads to the loss of Ca²⁺ homeostasis, which causes abnormal calcium metabolism and bone disorders.^13,14 Several types of Ca²⁺ channels are reported to regulate intracellular Ca²⁺ homeostasis in BMSCs and osteoblasts to affect bone repair.^15,16,17 Thus, the regulation of Ca²⁺ channels at the membrane plays a central role in BMSC function and in bone-related diseases. However, whether ALPL modulates Ca²⁺ channels to maintain Ca²⁺ homeostasis in BMSCs is unknown.

Currently, specific medical treatment options for HPP are limited to bone-targeted enzyme replacement therapies (asfotase, Strensiq, and Alexion), which have been approved for pediatric-onset HPP.^18,19 At this time, there are no guidelines for selecting adult patients for treatment, evaluating the results of treatment, or determining the optimal duration of treatment. In this study, we used human and mouse models to demonstrate that ALPL is required for the maintenance of intracellular Ca²⁺ influx because it regulates L-type Ca²⁺ channel trafficking via binding to the α2δ subunits, which regulate the internalization of L-type Ca²⁺ channels. This decreased Ca²⁺ flux downregulates Akt/GSK3β-mediated Wnt/β-catenin signaling in BMSCs, leading to an age-related osteoporotic phenotype. Moreover, we found that raising the intracellular level of calcium in BMSCs by treatment with ionomycin rescues the osteoporotic phenotype in alpl^+/− mice and BMSC-specific (Prrx1-alpl^−/−) conditional alpl knockout mice, and the treatment restores stem cell function of BMSCs from HPP patients, suggesting a new strategy for HPP therapy.

Results

ALPL deficiency caused decreased membrane expression of L-type Ca²⁺ channels in BMSCs

Patients with severe ALPL deficiency develop hypercalcemia,^10,11 so we examined the plasma calcium level in alpl^+/− mice and found a marked increase in the level of plasma calcium (Fig. S1a). To explore whether ALPL deficiency contributes to abnormal calcium metabolism in BMSCs, we isolated BMSCs from alpl^+/− mice (Fig. S1b–e) and examined cytosolic Ca²⁺. We found that introducing a lentivirus that overexpressed ALPL (Fig. S2a) into alpl^+/− BMSCs was able to increase the cytosolic Ca²⁺ of alpl^+/− BMSCs (Fig. S2b). Ca²⁺ entry across the plasma membrane occurs via two distinct kinds of channels, SOCs, and VGCCs. To test which type of Ca²⁺ channels might be affected in the absence of ALPL, WT, and alpl^+/− BMSCs were cultured with 10 nmol·L⁻¹ thapsigargin (TG). TG is a noncompetitive inhibitor capable of raising the cytosolic Ca²⁺ concentration via blocking the ability of the cell to pump Ca²⁺ into the sarcoplasmic and endoplasmic reticula to activate plasma membrane Ca²⁺ channels. No significant differences were evident in TG-induced intracellular Ca²⁺ influx that were detected in WT, alpl^+/−, and shALP-treated BMSCs (Fig. S2c, d). These data suggest that ALPL deficiency affects VGCC function in BMSCs. The contribution of ALPL to the function of VGCCs in BMSCs was determined after membrane depolarization using 30 mmol·L⁻¹ KCl. Intracellular Ca²⁺ imaging analysis showed that KCl-induced Ca²⁺ influx was significantly decreased in culture-expanded alpl^+/− and shALP-treated BMSCs compared with that of WT BMSCs (Fig. 1a). Moreover, intracellular Ca²⁺ imaging analysis showed that KCl-induced Ca²⁺ influx was not changed in culture-expanded WT, alpl^+/−, and shALP-treated BMSCs when treated with 10 mmol·L⁻¹ EGTA (Fig. 1b), suggesting that ALPL causes Ca²⁺ elevation mainly due to Ca²⁺ influx with a limited contribution from intracellular Ca²⁺ storage. Overexpression of ALPL in alpl^+/− BMSCs rescued KCl-induced Ca²⁺ influx (Fig. 1c).

The decrease in Ca²⁺ currents in alpl^+/− BMSCs could arise from the loss of channels at the membrane. The VGCCs comprise ten subsets: Ca_V1.1, Ca_V1.2, Ca_V1.3, Ca_V1.4 (L-type), Ca_V2.1 (P/Q-type), Ca_V2.2 (N-type), Ca_V2.3 (R-type), Ca_V3.1, Ca_V3.2, and Ca_V3.3 (T-type), which are encoded by cacna1s, cacna1c, cacna1d, cacna1f, cacna1a, cacna1b, cacna1e, cacna1g, cacna1h, and cacna1i, respectively.^20,21 To identify which subunits of the VGCCs were regulated by ALPL, we measured the total protein expression of Ca_V1.1, Ca_V1.2, Ca_V1.3, Ca_V2.1, Ca_V2.2, Ca_V2.3, Ca_V3.1, Ca_V3.2, and Ca_V3.3, as Ca_V1.4 expression seems to be restricted to the retina. The results showed that the total protein expression of Ca_V1.2 and Ca_V1.3 was decreased significantly in alpl^+/− BMSCs compared with WT BMSCs (Fig. 1d). Total protein expression of Ca_V1.1, Ca_V2.2, Ca_V2.3, and Ca_V3.3 was not changed (Figs. 1d and S2e). However, total and membrane expression levels of Ca_V2.1, Ca_V3.1, and Ca_V3.2 were increased in alpl^+/− BMSCs compared with WT BMSCs (Fig. S2e, f). The expression of Ca_V2.1, Ca_V3.1, and Ca_V3.2 in the cytoplasm was not changed significantly in alpl^+/− BMSCs compared with that of WT BMSCs (Fig. S2g). We used a plasma membrane protein extraction kit (Abcam, ab65400) to isolate plasma membrane protein, and then we measured the expression levels of membrane Ca_V1.1, Ca_V1.2, and Ca_V1.3. The results showed that alpl^+/− BMSCs expressed similar levels of Ca_V1.1 in the membrane and cytoplasm to what was observed in WT BMSCs (Fig. 1e). Considering the decreased Ca²⁺ influx in alpl^+/− BMSCs, we focused on Ca_V1.2 and Ca_V1.3. Membrane expression of calcium channels affects calcium influx, and we compared the expression of Ca_V1.2 and Ca_V1.3 in the membrane and in the cytoplasm. The results showed that the expression levels of membrane, Ca_V1.2 and Ca_V1.3 were decreased in alpl^+/− BMSCs, but the cytoplasmic levels did not change (Fig. 1e). We also measured KCl-induced Ca²⁺ influx after knockdown of Ca_V1.2 or Ca_V1.3 in WT BMSCs. The results showed that knockdown of Ca_V1.2 or Ca_V1.3 reduced KCl-induced Ca²⁺ influx in WT BMSCs (Fig. S2h). Moreover, we labeled the surface molecules with biotin and used neutravidin ultralink resin beads to capture biotinylated surface proteins. Then, we used western blot analysis to show the expression levels of proteins captured by anti-Ca_V1.2 and Ca_V1.3 antibodies. The results showed that the amount of Ca_V1.2 or Ca_V1.3 on the cell surface was decreased in alpl^+/− BMSCs compared with that of the WT BMSCs (Fig. 1f). However, overexpression of ALPL increased the expression of Ca_V1.2 and Ca_V1.3 on the membrane, as assayed by western blot (Fig. 1g). We also investigated the membrane localization of Ca_V1.2 and Ca_V1.3 in WT and alpl^+/− BMSCs by confocal laser scanning microscopy. The results showed that Ca_V1.2 (FITC-labeled) and Ca_V1.3 (FITC-labeled) were localized to the membrane (as visualized by CellMask™ Deep Red Plasma Membrane Stain) of WT BMSCs (Fig. 1h, i). However, Ca_V1.2 and Ca_V1.3 were absent from the membrane of alpl^+/− BMSCs. Ca_V1.2 and Ca_V1.3 were localized to the cell membrane after overexpression of ALPL in alpl^+/− BMSCs (Fig. 1h, i). These results suggest that ALPL modulates the expression of L-type Ca²⁺ channels, especially Ca_V1.2 and Ca_V1.3.

ALPL-regulated MSC osteogenic/adipogenic lineage differentiation via the L-type Ca²⁺ channel

We knocked down ALPL in BMSCs by siRNA treatment (Fig. S3a) and confirmed that ALPL deficiency decreased the osteogenic differentiation and increased the adipogenic differentiation of BMSCs (Fig. S3b–e). To explore the function of long-lasting voltage-gated calcium channel (L-VGCC) in the osteogenic/adipogenic differentiation of BMSCs, we used L-type Ca²⁺ channel blockers, diltiazem, or nifedipine, to treat WT BMSCs, and we explored their resulting osteogenic and adipogenic differentiation capacities (Fig. S3f–i). We found that both nifedipine and diltiazem inhibited the osteogenic differentiation ability of BMSCs, as evidenced by decreases in mineralized nodule formation and in expression of the osteogenic markers Bglap, Ibsp, RUNX2, and Sp7. In addition, nifedipine promoted the adipogenic differentiation of BMSCs, whereas diltiazem inhibited the adipogenic differentiation of BMSCs, as assessed by oil red O staining. The western blot assay data showed the same changes in the adipogenic regulators PPARγ2 and LPL under adipogenic culture conditions. To further address whether the defect in osteogenic/adipogenic lineage differentiation in ALPL-deficient BMSCs was due to the abnormal membrane expression of VGCCs, especially Ca_V1.2 and Ca_V1.3, we overexpressed Ca_V1.2 and Ca_V1.3 in alpl^+/− BMSCs (oeCa_V1.2 or oeCa_V1.3) (Fig. S3j). Western blot data showed that Ca_V1.2 and Ca_V1.3 were increased on the membrane of alpl^+/− BMSCs after Ca_V1.2 or Ca_V1.3 overexpression (oeCa_V1.2 or oeCa_V1.3) (Fig. S3k). KCl-induced Ca²⁺ influx was elevated after overexpression of Ca_V1.2 or Ca_V1.3 in alpl^+/− BMSCs (Fig. 2a). We also observed the membrane localization of Ca_V1.2 and Ca_V1.3 in alpl^+/− BMSCs after overexpressing Ca_V1.2 or Ca_V1.3 by confocal laser scanning microscopy (Fig. 2b, c). We found that overexpression of Ca_V1.2 or Ca_V1.3 in alpl^+/− BMSCs (oeCa_V1.2 or oeCa_V1.3) rescued the decreased osteogenic differentiation of BMSCs, as evidenced by increases in mineralized nodule formation and in expression of the osteogenic markers RUNX2 and Sp7 (Fig. 2d, e). In contrast, overexpression of Ca_V1.2 or Ca_V1.3 (oeCa_V1.2 or oeCa_V1.3) decreased adipogenic differentiation of BMSCs, as assessed by oil red O staining, showing decreased numbers of adipocytes; further, western blots showed downregulation of the adipogenic regulators PPARγ2 and LPL under adipogenic culture conditions (Fig. 2f, g). However, knockdown of Ca_V1.2 or Ca_V1.3 (by treatment with siCa_V1.2 or siCa_V1.3, respectively) (Fig. S3l, m) in WT BMSCs caused decreased osteogenic and increased adipogenic differentiation (Fig. 2h–k). These data indicate that ALPL regulates osteogenic and adipogenic lineage differentiation through Ca_V1.2- and Ca_V1.3-mediated calcium influx.

ALPL deficiency promoted the internalization of L-type Ca²⁺ channels in BMSCs

To determine whether a lack of ALPL leads to channel internalization resulting in decreased membrane expression of L-type Ca²⁺ channels in BMSCs, we disrupted endocytosis by expressing a dominant-negative mutant of dynamin 1 (DN-Dyn1), which is a GTPase required for the formation of endocytic vesicles from the plasma membrane.²² The expression of DN-Dyn1 in alpl^+/− BMSCs prevented the loss of Ca_V1.2 and Ca_V1.3 on the cell surface (Fig. 3a, b), providing evidence that a lack of ALPL causes internalization of the channels. Western blot analysis showed that the expression levels of membrane Ca_V1.2 and Ca_V1.3 in alpl^+/− BMSCs were increased after DN-Dyn1 transfection. However, the expression levels of cytoplasmic Ca_V1.2 and Ca_V1.3 in alpl^+/− BMSCs were decreased after DN-Dyn1 transfection (Fig. 3c). The expression of DN-Dyn1 also prevented the decrease in KCl-induced Ca²⁺ influx in alpl^+/− BMSCs (Fig. 3e).

We next measured the time course of ALPL-dependent L-type Ca²⁺ channel internalization. To study this process in live BMSCs, we used Dio to label the cell membrane (FITC-labeled) and constructed a plasmid to express Ca_V1.2 (DsRed-Cav1.2) to use in the transfection of cells. We recorded colocalization regions as region of interest (ROI) to record the time-course change of intensity of red fluorescence, and we quantified the red florescence in each ROI over a time-course lapse at 300 s minus 0 s and 600 s minus 0 s to determine changes during the process. The DsRed-Ca_V1.2 signal in alpl^+/− BMSCs declined significantly after 10 min compared with that of the WT, DN-Dyn1-transfected alpl^+/− BMSCs, and ALPL-overexpressed alpl^+/− BMSCs, reflecting the decreased membrane expression of the L-type Ca²⁺ channel (Fig. 3d, f and g). We also selected images at 0 s and 570 s to show the colocalization of DsRed-Ca_V1.2 with the cell membrane of BMSCs. Almost no region of colocalization was found in alpl^+/− BMSCs (Fig. 3h–k), which suggested that ALPL deficiency promoted the internalization of L-type Ca²⁺ channels. To determine whether the expression of DN-Dyn1 rescues differentiation in ALPL-deficient BMSCs, we performed osteogenic and adipogenic induction after transfection. Expression of DN-Dyn1 increased osteogenic differentiation of alpl^+/− BMSCs, as evidenced by increased mineralized nodule formation and expression of the osteogenic markers RUNX2 and Sp7 (Fig. S4a, b). In contrast, expression of DN-Dyn1 decreased adipogenic differentiation of alpl^+/− BMSCs, as assessed by oil red O staining, which showed decreased numbers of adipocytes, and western blotting, which showed downregulation of the adipogenic regulators PPARγ2 and LPL under adipogenic culture conditions (Fig. S4c, d).

ALPL deficiency promoted the internalization of L-type Ca²⁺ channels via binding to α2δ subunits

Given that ALPL has been reported to hydrolyze inorganic pyrophosphate (PPi) and adenosine triphosphate (ATP), we compared the expression of Ca_V1.2 and Ca_V1.3 in BMSCs and BMSCs treated with PPi or ATP. However, the addition of exogenous PPi or ATP hardly changed the membrane expression of Ca_V1.2 and Ca_V1.3 in BMSCs (Fig. S5a). To further explore the molecular mechanism of ALPL-regulated internalization of Ca_V1.2 and Ca_V1.3, we measured the membrane localization of ALPL and calcium channels. We found that Ca_V1.2 and Ca_V1.3 overlapped with ALPL in BMSCs (Fig. 4a, upper panel), suggesting the association of ALPL and L-type Ca²⁺ channels. However, no membrane location of Ca_V1.2 and Ca_V1.3 was found in alpl^+/− BMSCs (Fig. 4a, lower panel). Several regions of ALPL and Ca_V1.2 and Ca_V1.3 colocalization were found in the cytoplasm of alpl^+/− BMSCs (Fig. 4a, lower panel), indicating that ALPL may bind L-type Ca²⁺ channels in the cytoplasm. We also used immunoprecipitation to confirm the association of ALPL and the L-type Ca²⁺ channel. Immunoprecipitation using a control antibody did not isolate either protein, but immunoprecipitation with anti-ALPL resulted in coimmunoprecipitation with Ca_V1.2 or Ca_V1.3 (Fig. 4b). In addition, we found that anti-Ca_V1.2 or anti-Ca_V1.3 immunoprecipitated ALPL (Fig. 4c), suggesting that ALPL associates with Ca_V1.2 and Ca_V1.3 in BMSCs.

We next investigated which regions of Ca_V1.2 and Ca_V1.3 are important for ALPL-regulated internalization. The α₂δ subunit has been reported to traffic α1 subunits, which influences internalization of the channels.^23,24 Floxed alpl mice with Prrx1::Cre mice were crossed to generate early embryonic MSC-specific (Prrx1-alpl^−/−) conditional alpl knockout mice (Fig. S5b, c). We isolated BMSCs from the Prrx1-alpl^−/− mice (ALPL^−/−) and control alpl^f/f littermates (control). Alpl^−/− BMSCs showed decreased expression of ALPL, and treatment with a lentivirus that overexpressed ALPL (Lenti-alp) elevated the membrane expression of ALPL (Fig. S5d). To explore whether ALPL interacted with α₂δ to regulate the internalization of Ca_V1.2 and Ca_V1.3, we expressed ALPL with α₂δ or a mutant α₂δ in alpl^−/− BMSCs and examined the membrane expression of Ca_V1.2 and Ca_V1.3. alpl^−/− BMSCs were isolated from Prrx1-alpl^−/− mice and showed no expression of ALPL, Ca_V1.2, or Ca_V1.3 at the membrane (Fig. 4d). The membrane expression of Ca_V1.2 and Ca_V1.3 was increased, and ALPL was colocalized with Ca_V1.2 and Ca_V1.3 after transfection with ALPL and α₂δ (Fig. 4d). However, the membrane expression of Ca_V1.2 and Ca_V1.3 was not increased, and ALPL was not colocalized with Ca_V1.2 and Ca_V1.3 after transfection with ALPL and mutant α₂δ (Fig. 4d). Western blot analysis also confirmed that the membrane expression of Ca_V1.2 and Ca_V1.3 was increased after transfection with ALPL and α₂δ (Fig. 4e). However, no membrane expression of Ca_V1.2 and Ca_V1.3 was found in alpl^−/− BMSCs and alpl^−/− BMSCs transfected with ALPL and mutant α₂δ (Fig. 4e). Immunoprecipitation using a control antibody did not isolate either protein in WT or alpl^−/− BMSCs, but immunoprecipitation with anti-α2δ in alpl^f/f BMSCs isolated ALPL (Fig. 4f). To confirm that ALPL interacts with α₂δ subunits and thus regulates the lineage differentiation of BMSCs, we transfected alpl^+/− BMSCs with α₂δ or mutant α₂δ and assessed their osteogenic or adipogenic induction. alpl^+/− BMSCs transfected with mutant α₂δ showed decreased osteogenic differentiation and increased adipogenic differentiation compared with alpl^+/− BMSCs transfected with α₂δ (Fig. S5e–h).

ALPL deficiency caused aberrant lineage differentiation of BMSCs through the Wnt/β-catenin pathway

To examine how ALPL deficiency-induced reduction of Ca²⁺ influx affects the osteogenic and adipogenic differentiation of BMSCs, we analyzed three Ca²⁺ downstream pathways (PKC/Erk, PI3K/Akt/GSK3β, and CaMKII/calcineurine A), which are closely linked to Ca²⁺-associated regulation of osteogenic differentiation. We found that the expression level of p-Akt significantly decreased along with the reduction of p-GSK3β in alpl^+/− BMSCs and BMSCs transfected with shALP (Fig. 5a). However, the PKC/Erk and CaMKII/calcineurine A pathways were not changed significantly in alpl^+/− BMSCs or in BMSCs transfected with shALP compared with that of WT BMSCs (Fig. S6a). Because the decrease in GSK3β phosphorylation inhibits the nuclear translocation of β-catenin, which regulates the osteogenic and adipogenic differentiation of BMSCs, we examined the expression levels of total and active β-catenin. We found that the expression of active β-catenin was decreased in both alpl^+/− BMSCs and BMSCs transfected with shALP (Fig. 5a). Moreover, when we overexpressed ALPL in alpl^+/− BMSCs, the expression of p-Akt, p-GSK3β, and active β-catenin was increased to levels similar to those of the WT BMSCs (Fig. 5b). When we overexpressed Ca_V1.2 or Ca_V1.3 in alpl^+/− BMSCs, the expression of p-Akt, p-GSK3β, and active β-catenin was increased (Fig. 5c). In addition, the expression of DN-Dyn1 in alpl^+/− BMSCs also increased the expression of p-Akt, p-GSK3β, and active β-catenin compared with alpl^+/− BMSCs (Fig. 5d). Taken together, these data indicate that ALPL regulates Ca²⁺ influx to affect p-Akt and p-GSK3β expression and subsequently targets the Wnt/β-catenin pathway in BMSCs.

To further determine whether ALPL regulates osteogenic and adipogenic differentiation through the Akt/GSK3β/Wnt/β-catenin pathway, we used activators of Akt phosphorylation (sc79) and GSK3β phosphorylation (LiCl) (Fig. S6b) to treat alpl^+/− BMSCs, and we found that sc79 and LiCl treatment increased osteogenic differentiation, as evidenced by increases in mineralized nodule formation and in expression of RUNX2 and Sp7 (Fig. 5e, f). In contrast, sc79 and LiCl treatment decreased adipogenic differentiation of alpl^+/− BMSCs, as assessed by oil red O staining, which showed a decreased number of adipocytes, and western blotting, which indicated a downregulation of PPARγ2 and LPL under adipogenic culture conditions (Fig. 5g, h). Moreover, we also overexpressed β-catenin (oeβ-cat) in alpl^+/− BMSCs (Fig. S6c) and observed a recovery of lineage differentiation in alpl^+/− BMSCs, as evidenced by the increased osteogenic differentiation and decreased adipogenic differentiation (Fig. 5i–l).

Raising the intracellular level of calcium by ionomycin rescued ALPL deficiency-induced age-related osteoporosis

Ionomycin was reported to cause a robust increase in Ca²⁺ influx and an inhibition in calcium channel endocytosis.²⁵ Therefore, we treated 12-week-old alpl^+/− mice with ionomycin intraperitoneally at a dose of 1 mg·kg⁻¹ per day for 28 days. We confirmed that ionomycin treatment increased the calcium influx and the membrane expression of Ca_V1.2 and Ca_V1.3 in alpl^+/− BMSCs (Fig. S7a, b). MicroCT and histological analyses showed that bone mineral density (BMD), Bone volume relative to tissue volume (BV/TV), and distal femoral trabecular bone number (Tb.N) in 3-month-old alpl^+/− mice were markedly decreased compared with that of the control WT littermates (Fig. 6a, b). We treated alpl^+/− mice with ionomycin, which caused a robust rise in Ca²⁺ influx in cells.²⁵ MicroCT and histological analyses showed that BMD, BV/TV, and Tb.N in 3-month-old alpl^+/− mice treated with ionomycin was markedly increased compared with that in alpl^+/− mice (Fig. 6a, b). To observe changes in osteogenic/adipogenic lineage differentiation in vivo, we examined the number of adipocytes in the bone marrow of WT, alpl^+/− mice, and alpl^+/− mice treated with ionomycin. Interestingly, oil red O staining showed that the number of adipocytes in alpl^+/− mouse bone marrow was markedly increased compared with that of WT littermates (Fig. 6c), indicating that alpl deficiency increased adipogenic lineage differentiation. However, the number of adipocytes in alpl^+/− mouse bone marrow after ionomycin treatment was markedly decreased compared with that of alpl^+/− mice (Fig. 6c). To confirm that alpl deficiency directly contributes to decreased osteogenesis, a calcein double labeling analysis was used to show a decreased bone formation rate in alpl^+/− mice and an elevated bone formation rate in alpl^+/− mice treated with ionomycin (Fig. 6d).

Moreover, we found that the intracellular level of Ca²⁺ in alpl^+/− BMSCs was decreased compared with that of WT BMSCs, and ionomycin treatment elevated the intracellular level of Ca²⁺ in alpl^+/− BMSCs (Fig. 6e). We observed impaired osteogenic differentiation and increased adipogenic differentiation in alpl^+/− BMSCs, as evidenced by decreased mineralized nodule formation and an elevated numbers of adipocytes (Fig. 6f, h). The decreased expression of the osteogenic markers RUNX2 and Sp7 and increased expression of the adipogenic regulators PPARγ2 and LPL were shown by western blotting (Fig. 6g, i). Ionomycin treatment increased the osteogenic differentiation and decreased adipogenic differentiation of alpl^+/− BMSCs (Fig. 6f–i).

Ionomycin treatment rescued osteoporosis in BMSC-specific conditional alpl knockout mice

To further determine whether ALPL deficiency in BMSCs caused altered osteogenesis and adipogenesis in vivo, we assessed BV/TV and Tb.N in 3-month-old Prrx1-alpl^−/− mice, and we found that they were markedly decreased compared with that of their control alpl^f/f littermates (Fig. 7a, b). Floxed alpl littermates (alpl^f/f) were used as controls. MicroCT and histological analyses showed that, BMD, BV/TV, and Tb.N in 3-month-old Prrx1-alpl^−/− mice treated with ionomycin were markedly increased compared with what was observed in the Prrx1-alpl^−/− mice (Fig. 7a, b). To further detect changes in osteogenic/adipogenic lineage differentiation in BMSCs, we examined the number of adipocytes in the bone marrow of alpl^f/f, Prrx1-alpl^−/− mice, and Prrx1-alpl^−/− mice treated with ionomycin. Oil red O staining showed that the number of adipocytes in Prrx1-alpl^−/− bone marrow was markedly increased compared with that in the control alpl^f/f littermates (Fig. 7c). However, the number of adipocytes in Prrx1-alpl^−/− bone marrow after ionomycin treatment was markedly decreased compared with that of the Prrx1-alpl^−/− mice (Fig. 7c). Calcein double labeling analysis showed a decreased bone formation rate in Prrx1-alpl^−/− mice relative to that of control alpl^f/f mice (Fig. 7d). Ionomycin treatment reversed the impaired osteogenesis in Prrx1-alpl^−/− mice. Moreover, the serum levels of RANKL and OPG were not significantly changed, as assessed by ELISA (Fig. S7c, d), suggesting that osteoclasts may not be altered in Prrx1-alpl^−/− mice. The intracellular level of Ca²⁺ in alpl^−/− BMSCs was decreased compared with that in the control BMSCs, and ionomycin treatment elevated the intracellular level of Ca²⁺ in alpl^−/− BMSCs (Fig. 7e). In addition, BMSCs from Prrx1-alpl^−/− mice showed decreased osteogenic differentiation and increased adipogenic differentiation compared with BMSCs from alpl^f/f mice (Fig. 7f–i). BMSCs from Prrx1-alpl^−/− mice treated with ionomycin showed increased osteogenic and decreased adipogenic differentiation (Fig. 7f–i). These results indicate that ALPL deficiency in BMSCs induces an age-related osteoporosis phenotype and that ionomycin treatment reversed this phenotype.

ALPL deficiency promoted the internalization of L-type Ca²⁺ channels in HPP patient-derived BMSCs

We also collected bone marrow BMSCs from two HPP patients with mutations in the ALPL gene (A1 and A2, Table S1). The expression of ALPL on the membrane and cytoplasm was decreased in BMSCs from the two HPP patients compared with normal human bone marrow BMSCs (control) (Fig. 8a). We further determined whether the lack of ALPL resulted in decreased KCl-induced Ca²⁺ influx in A1 and A2 BMSCs. KCl-induced Ca²⁺ influx was significantly decreased in culture-expanded A1 and A2 BMSCs compared with that of control BMSCs (Fig. 8b), and overexpression of ALPL elevated KCl-induced Ca²⁺ influx (Fig. 8c, d) in A1 and A2 BMSCs. Moreover, we also found that the expression of DN-Dyn1 prevented the decrease in KCl-induced Ca²⁺ influx in A1 and A2 BMSCs (Fig. 8c, d). The overexpression of ALPL or expression of DN-Dyn1 in A1 and A2 BMSCs increased the membrane expression of Ca_V1.2 and Ca_V1.3, as shown by confocal images (Fig. 8e), suggesting that ALPL deficiency causes channel internalization of Ca_V1.2 and Ca_V1.3 in a human model. To confirm that ALPL regulates the lineage differentiation of BMSCs, we overexpressed ALPL in A1 and A2 BMSCs and assessed their osteogenic or adipogenic ability after induction. A1 and A2 BMSCs transfected with the ALPL vector showed increased osteogenic differentiation and decreased adipogenic differentiation (Fig. S8a–d). All of the above data show that ALPL regulates lineage differentiation of MSCs through association with the α2δ subunit of L-type Ca²⁺ channels and through inhibiting the internalization of L-type Ca²⁺ channels, thus increasing Ca²⁺ influx (Fig. S9).

Discussion

The deficiencies caused HPP are currently treated by bone anabolic and/or enzyme replacement strategies. Bone anabolic treatment, such as treatment with recombinant human parathyroid hormone analogs yielded debatable efficacy.²⁶ Asfotase alfa (Strensiq, Alexion), a bone-targeted enzyme replacement therapy, was approved for the long-term treatment of pediatric-onset HPP in the United States, Europe, Canada, and Japan. However, there are no guidelines for selecting adult patients for treatment, evaluating the results of treatment, or determining the optimal duration of treatment at this time. Patients with HPP can also develop secondary osteoporosis, bone marrow edema, and delayed fracture healing or difficulties with implant failure.²⁶ Thus, there is an urgent need to identify further bone-targeted treatment options for adult HPP patients.

Our previous study showed that the Alpl deficiency results in premature bone aging characterized by bone mass loss and simultaneous marrow fat gain. Although a pivotal role for ALPL in skeletal matrix mineralization has been established, the mechanism of ALPL regulating BMSC differentiation remains uncertain. Hypercalcemia was found in severely affected infants with HPP, which suggests that ALPL may modulate calcium homeostasis. In this study, we found that raising the intracellular level of calcium in BMSCs by ionomycin rescued ALPL deficiency-induced age-related osteoporosis, which suggests that targeting calcium channels is a new approach for adult HPP treatment. Moreover, our study showed a new function for ALPL in controlling Ca²⁺ influx by regulating the internalization of calcium channels, which balanced the osteogenic and adipogenic differentiation of BMSCs.

Voltage-dependent calcium channels are an important route by which Ca²⁺ enters cells upon membrane depolarization to regulate calcium homeostasis. A previous study showed that VGCCs in BMSCs and osteoblasts regulate bone formation and that manipulating VGCCs promotes bone repair.^27,28 Of note, the L-VGCC, a major channel of calcium influx, is a part of the high-voltage activated family of VGCCs. L-type calcium channels are considered to play an important role in regulating BMSC function.^15,16 L-VGCCs, which consist of four subunits (Ca_V1.1, Ca_V1.2, Ca_V1.3, and Ca_V1.4), are expressed in a tissue-specific fashion.²⁹ Ca_V1.2 and Ca_V1.3 constitute the major fraction of L-type calcium channels in mammals.^30,31,32 However, how Ca_V1.2 and Ca_V1.3 are regulated in BMSCs is still unknown. Here, we found that a lack of ALPL caused a decreased number of Ca_V1.2 and Ca_V1.3 cells in the membrane and a decrease in Ca²⁺ influx in BMSCs, which led to the aberrant lineage differentiation of BMSCs.

The involvement of ALPL in channel internalization leads to a change in the Ca_V1.2 and Ca_V1.3 number at the surface of cells. Several other proteins have been found to regulate the membrane expression of VGCCs, including calmodulin, Akap15, Akap9, and eIF3e, and these associations play an important role in connecting VGCCs and intracellular signaling pathways.²⁵ Of these proteins, ALPL is unusual because it is an ectoenzyme that hydrolyzes several substrates. Our study showed a new function for ALPL in in BMSCs; it controls Ca²⁺ influx by regulating the internalization of Ca_V1.2 and Ca_V1.3. The results suggest that ectoenzymes on the cell membrane may bind channels in the cell and regulate their trafficking. Precisely how ALPL regulates L-type Ca²⁺ channel trafficking is unclear. Our colocalization data indicate that there is direct contact between ALPL and L-type Ca²⁺ channels. The α2δ subunit of the L-type Ca²⁺ channel is responsible for regulating the trafficking of channels.^23,24 Our colocalization data indicate that ALPL may bind to the α2δ subunit to regulate L-type Ca²⁺ channel trafficking. A mutation in the α2δ subunit reduced the expression of Ca_V1.2 and Ca_V1.3 at the membrane of cells. However, further studies are required to explore the detailed mechanism of L-type Ca²⁺ channel trafficking. Conditional binding of ALPL to Ca_V1.2 and Ca_V1.3 suggests that the composition of the Ca_V1.2 and Ca_V1.3 protein complex with ALPL may play an important role in regulating channel trafficking. On the other hand, our previous study showed that ALPL deficiency in BMSCs enhanced ATP release and reduced ATP hydrolysis.³ ATP, as the energy source used in channel trafficking, may also play a critical role in L-type Ca²⁺ channel internalization in ALPL deficiency conditions.

Skeletal defects in HPP, include rickets, osteomalacia, fractures, bone pain, and various dental defects.^33,34 To understand the physiological role of ALPL and evaluate the potential treatments, several lines of ALPL knockout mice were generated.^35,36 Homozygous mice show severe bone disease, but they often die before puberty.³⁷ However, here, we found that ALPL deficiency in BMSCs caused decreased osteogenic differentiation and increased adipogenic differentiation. The alpl^+/− mouse model phenocopies adult patients with HPP, and these mice showed inhibited bone formation but increased adipose tissue in the bone matrix. Moreover, bone formation was inhibited when we generated alpl conditional knockout mice of BMSCs, which was consistent with recent reports.³⁷ Further, other recent data have shown that increased marrow adipose tissue is correlated with dysfunction of bone and hematopoietic regeneration.³⁸ We also found that bone formation was inhibited but adipose tissue was increased in the bone matrix of alpl conditional knockout mice, which suggests that ALPL regulates the osteogenic/adipogenic differentiation of BMSCs and causes osteoporosis in patients with HPP.

Our findings regarding the involvement of ALPL in calcium homeostasis revealed a molecular mechanism underlying the BMSC balance between osteogenic and adipogenic differentiation. The change in Ca²⁺ influx in BMSCs following H₂S exposure regulates osteogenic differentiation through the PCK/Erk/Wnt pathway.³⁹ Here, we demonstrated that the Akt/GSK3β/Wnt/β-catenin pathway was downstream of ALPL-mediated regulation of Ca²⁺ influx. The Akt/GSK3β/Wnt/β-catenin pathway further balanced the osteogenic and adipogenic differentiation of BMSCs and bone formation. In our study, we found that ALPL was required to maintain intracellular Ca²⁺ influx by regulating internalization of the L-type Ca²⁺ channel via binding to the α2δ subunits in BMSCs. Altered intracellular Ca²⁺ influx caused by the ALPL deficiency resulted in an osteoporotic phenotype due to downregulated osteogenic differentiation and upregulated adipogenic differentiation in both human and mouse BMSCs. Inhibition of calcium channel internalization by ionomycin increased calcium influx and enhanced bone formation in alpl^+/− mice and Prrx1-alpl^−/− mice, suggesting that targeting calcium channel internalization is a potential treatment strategy for adult patients with HPP.

Materials and methods

Mice

C57BL/6J and B6.129S7-Alpl^tm1Sor/J mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA). We produced mice that were homozygous for ALPL^flox using the CRISPR/Cas9 system; an ALPL allele was generated in which the DNA segment includes exons 3 and 4 was flanked by loxP sites. By coinjection of Cas9/sgRNAs and the ALPL targeting vector into zygotes, we generated ALPL-floxed heterozygous mice. To generate a tissue-specific Cre-mediated ALPL knockout model, Prrx1-Cre (C57BL/6-Prrx1^tm1(iCre)/Bcgen) (Beijing Biocytogen Co., Ltd Beijing, China) mice were mated with mice heterozygous for the ALPL-floxed allele. The offspring inherited Prrx1-Cre and two ALPL-floxed alleles. Routine mouse genotyping was performed by PCR. The following primer pairs were used for Cre and floxed alleles: Prrx1^iCre primer 1: AGCGTTTGGTGTTGATTCGAGC; Prrx1^iCre primer 2: AGTCCCGGTGACTCCAGCAG; Prrx1^iCre primer 3: TGGTGCACAGTCAGCAGGTTG; ALPL-3′loxP-F: CCTGCTACCTGCTTGCTGGCAATGG; ALPL-3′loxP-R: AGGACACCAAAGACCAGGGACACTA. All animal experiments were performed in accordance with institutionally approved protocols for the use of animal research (University of Fourth Military Medical University protocol number k9-024).

Isolation of mouse bone marrow mesenchymal stem cells

Bone marrow cells were flushed from the bone cavities of mouse femurs and tibias with 2% heat-inactivated fetal bovine serum (FBS; Hangzhou Sijiqing Biological Engineering Materials Co., Ltd Zhejiang, China) in PBS. A single-cell suspension of all nucleated cells was obtained by passing all bone marrow cells through a 70 μm cell strainer (BD Bioscience, NJ, USA). Single cells (1 × 10⁶) were seeded in 100 mm culture dishes (Corning, NY, USA) and initially incubated for 48 h at 37 °C and 5% CO₂. To eliminate the nonadherent cells, the cultures were washed with PBS twice on the second day. The attached cells were cultured for 16 days in alpha minimum essential medium (α-MEM, Gibco BRL, Gaithersburg, MD, USA) supplemented with 20% FBS, 2 mmol·L⁻¹ l-glutamine (Invitrogen Life Technology, Carlsbad, CA, USA), 55 μmol·L⁻¹ 2-mercaptoethanol (Invitrogen), 100 U·mL⁻¹ penicillin, and 100 μg·mL⁻¹ streptomycin (Invitrogen). To confirm that the cells had mesenchymal stem cell characteristics, we used flow cytometric analysis to show that these BMSCs were positive for Sca-1, CD44, and CD73 and were negative for CD34 and CD45 (BD Biosciences, San Diego, CA, USA).

Isolation of human bone marrow mesenchymal stem cells

Two HPP patients aged 10 (male) and 2.5 (female) years were treated by the Affiliated Hospital of Fourth Military Medical University for osteodynia and missing teeth. Healthy human BM samples were collected from five teenagers aged 10–13 years (male) who underwent alveolar bone cleft repair by autoilium transplantation. The cells were purified from the BM using a Percoll density gradient centrifugation method, and then they were cultured in α-MEM supplemented with 10% FBS (Gibco BRL), 2 mmol·L⁻¹ L-glutamine (Invitrogen), 100 U·mL⁻¹ penicillin, and 100 mg·mL⁻¹ streptomycin (Invitrogen) at 37 °C in 5% CO₂.³ BMSCs in their third passage were used in experiments.

Calcium imaging

Calcium imaging was performed using confocal laser microscopy (Zeiss, Oberkochen FV1000, Germany). The intracellular Ca²⁺ level ([Ca²⁺]_i) was determined by Fluo-3 fluorescence intensity, as described previously.⁴⁰ Briefly, BMSCs were cultured in 12-well plates and were incubated with 5 μmol·L⁻¹ Fluo-3/AM dye (Invitrogen, Life Technology, Carlsbad, CA, USA) for 30 min in α-MEM at 37 °C. BMSCs were again washed three times with calibrated EGTA/Ca²⁺ solutions. KCl (30 mmol·L⁻¹) or TG (20 μmol·L⁻¹, Sigma-Aldrich, St. Louis, MO, USA) was added to test which type of calcium channel was affected. Images were collected every 4 s at 2 Hz with excitation at 488 nm and emission at 530 nm. Data are presented as the Fluo-3 fluorescence intensity increase ratio: R = ΔF/F₀, where ΔF = F – F₀. F is the fluorescence value detected, and F₀ is the minimum fluorescence value.

Confocal microscopy

Confocal images were acquired with a Zeiss Oberkochen FV1000 confocal laser scanning microscope using a ×60 oil immersion objective. BMSCs were fixed with 3.7% paraformaldehyde in distilled water at 4 °C for 10 min and then were incubated overnight with primary antibodies, which were followed by incubation with secondary antibodies for 1 h. The nuclei were stained with 1 μg·mL⁻¹ Hoechst 33342. The plasma membrane was stained with 5 μg·mL⁻¹ of the membrane marker CellMask™ Deep Red Plasma Membrane Stain (Thermo Fisher Scientific, MA, USA). Images were acquired using an argon laser (excitation, 488 nm; emission, BP505-530 nm emission filter) for FITC-labeled Ca_V1.2 or Ca_V1.3, a UV laser for excitation and a BP385-470 nm emission filter for Hoechst 33342, and a He–Ne laser (excitation, 543 nm; emission filter, LP650 nm) for Cy3-labeled ALPL. BMSCs (1 × 10⁵) were plated onto coverslips, and the next day cells were treated with 10 μmol·L⁻¹ ATP, 10 μmol·L⁻¹ ppi, or 1 μg·mL⁻¹ ionomycin for 1 h before immunofluorescence staining for Ca_V1.2 or Ca_V1.3. Plasma membrane localization of Ca_V1.2 or Ca_V1.3 in BMSCs, as visualized by staining with anti-Ca_V1.2 or anti-Ca_V1.3 antibodies, was recorded for more than ten cells. Colocalization of the L-type Ca²⁺ channel (Ca_V1.2 or Ca_V1.3) and ALPL was also observed using a laser scanning confocal microscope, and images were obtained using FV10-ASW Viewer 4.2 (Zeiss, Oberkochen FV1000, Germany).

To record the time-course change of internalization of Ca_V1.2, a plasmid encoding DsRed-Cav1.2 was generated and transfected into the BMSCs. The plasmid was constructed by introducing a DsRed segment into the Ca_V1.2 plasmid (Addgene plasmid #26572) according to the instructions of a ClonExpress® II One Step Cloning kit (Vazyme, Nanjing, China). Dio (Thermo Fisher Scientific, MA, USA) was used to label the cell membrane, and DAPI (Thermo Fisher Scientific) was used to label the nucleus. The average colocalization intensity was determined by selecting an ROI corresponding to the cell’s footprint in the first image and measuring the average intensity in that region over the entire time course. The ROI was visually selected in a region of the Dio-labeled plasma membrane. Cells that were outside of this ROI were excluded from analysis. The amount of time channels spent at the membrane was measured for more than 15 ROIs for at least five cells per condition. We recorded the time-dependent red fluorescence intensity of these regions. Quantitative data are presented as the fluorescence intensity increase ratio: R = F/F₀. F is the fluorescence value detected, and F₀ is the first detected fluorescence value. Quantification of the fluorescence density of ROIs at 0 s, 300 s, and 600 s was analyzed by NIH ImageJ software.

Cell-surface protein isolation

The expression level of Ca²⁺ channels in the surface membrane was determined by isolating cell-surface proteins using a plasma membrane protein extraction kit (Abcam, Cambridge, UK). In brief, the cells were lysed using homogenization buffer containing protease inhibitor cocktail. The homogenate was centrifuged for 10 min at 700 g, and the pellet was discarded. The supernatant was then centrifuged for 30 min at 10 000 g and 4 °C to obtain the total cellular membrane protein. Then, purification of the plasma membrane proteins was carried out according to the manufacturer’s protocol. The protein concentrations were measured with a Bradford protein assay kit (Beyotime, Shanghai, China). Then, equal amounts of the cytoplasmic and membrane proteins were saved as direct input for immunoblot experiments.

Osteogenic differentiation

BMSCs were cultured under osteogenic culture conditions in growth medium containing 2 mmol·L⁻¹ β-glycerophosphate (Sigma-Aldrich, St. Louis, MO, USA), 100 μmol·L⁻¹ L-ascorbic acid 2-phosphate (MP Biomedicals, Irvine, CA, USA), and 10 nmol·L⁻¹ dexamethasone (Sigma-Aldrich, St. Louis, MO, USA). Two weeks after induction, staining was performed with 1% alizarin red S (Sigma-Aldrich) for 3 min at room temperature to detect matrix mineralization. Then, 10 μmol·L⁻¹ SC79 or 10 mmol·L⁻¹ LicL was added to the osteogenic culture medium for induction. The stained areas were quantified using NIH ImageJ software and are shown as a percentage of the total area.

Adipogenic differentiation

For adipogenic induction, 500 nmol·L⁻¹ isobutylmethylxanthine (MP Biomedicals, Irvine, CA, USA), 60 μmol·L⁻¹ indomethacin (Sigma-Aldrich), 500 nmol·L⁻¹ hydrocortisone (MP Biomedicals, Irvine, CA, USA), 10 μg·mL⁻¹ insulin (Sigma-Aldrich), and 100 nmol·L⁻¹ L-ascorbic acid phosphate were added into the growth medium. Then, 10 μmol·L⁻¹ SC79 or 10 mmol·L⁻¹ LicL was added to the adipogenic culture medium for induction. After 7 days, the cultured cells were stained with oil red O (Sigma-Aldrich), and positive cells were quantified under microscopy and are shown as a percentage of the total cells.

Western blotting

Cells were lysed using M-PER mammalian protein extraction reagent (Thermo, MA, USA) with protease and phosphatase inhibitors (Roche, Basel, Switzerland), and proteins were quantified using protein assays (Bio-Rad Laboratories, Shanghai, China). Twenty micrograms of protein was separated by SDS-PAGE and then were transferred to nitrocellulose membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 0.1% Tween-20 and 5% BSA for 1 h before overnight incubation with a primary antibody diluted in blocking solution. Antibodies against mouse ALP were purchased from R&D Systems, and antibodies against Ca_V1.1, Ca_V1.2, Ca_V1.3, Ca_V2.1, Ca_V2.2, Ca_V3.1, Ca_V3.2, Ca_V3.3, and Ca_Vα2δ1 were purchased from Alomone Labs (Alomone, Jerusalem, Israel). Antibodies against mouse phospho-Erk1/2 (Thr202/Tyr204), Erk1/2, GSK3β, phospho-GSK3β, phospho-AKT, β-catenin, RUNX2, SP7, Bglap, PPARγ2, LPL, phospho-PKC, PKC, phospho-CamkII, and AKT were purchased from Abcam (Cambridge, UK). Antibodies against mouse Ibsp were purchased from Absin (Shanghai, China). Antibodies against mouse CamkII and active β-catenin were obtained from Millipore (Billerica, MA, USA). Antibodies against mouse β-actin were purchased from Boster (Wuhan, China). The membranes were incubated for 1 h in HRP-conjugated secondary antibody diluted at 1:40 000 in blocking solution. Immunoreactive proteins were detected using an enhanced chemiluminescence kit (Amersham Biosciences, Piscataway, NJ, USA). The intensity of bands was measured using NIH ImageJ software, and data were normalized to β-actin.

Coimmunoprecipitation

To test whether ALPL and L-VGCC (Ca_V1.2 or Ca_V1.3) interact in cells, coimmunoprecipitation was performed as previously described.⁴¹ The cells were completely lysed in cell lysis buffer for western blotting and IP (Beyotime, Shanghai, China). The lysates were incubated with primary antibodies overnight at 4 °C, and then protein A/G magnetic beads (Millipore, USA) were added for 2 h at 4 °C. Immunocomplexes were washed three times with PBS containing 0.1% Tween-20 and were subsequently subjected to western blot analysis.

Biotinylation assays

A surface biotinylation assay was performed following the manufacturers’ protocols for EZ-link Sulfo-NHS-LC-LC-biotin and Immobilized/NeutrAvidin Ultralink Resin (Thermo Fisher Scientific, MA, USA). For the surface biotinylation assay, the cells were incubated with 1 mg·mL⁻¹ EZ-linked Sulfo-NHS-LC-LC-biotin in DPBS for 30 min at room temperature, and unreacted biotin was quenched with cold 100 mmol·L⁻¹ glycine in DPBS. Then, we used neutravidin ultralink resin beads to capture biotinylated surface proteins. The beads were washed three times with lysis buffer (50 mmol·L⁻¹ Tris/HCl [pH 7.4], 1 mmol·L⁻¹ EDTA, 150 mmol·L⁻¹ NaCl, and protease inhibitors), and then elution was performed with loading buffer. After SDS-PAGE, western blot analysis of the captured proteins was performed with anti-Ca_V1.2 and anti-Ca_V1.3 antibodies (Alomone, Jerusalem, Israel).

Plasmid construction

For shRNA knockdown experiments, we constructed an shALPL lentiviral vector according to the protocol of the pLKO.1-TRC cloning vector.⁴² In brief, to generate oligos for cloning into pLKO.1, we synthesized the following oligonucleotides: forward oligo: CCGGGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAATTCATACTGCTTTTTG, reverse oligo: AATTCAAAAAGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAATTCATACTGC.

Then, the forward and reverse oligos were annealed and ligated into the pLKO.1 vector, producing a final plasmid that expressed an shRNA targeting ALPL. To overexpress ALPL in BMSCs, we constructed a lentiviral vector with ALPL cDNA. The ALPL (GenBank Accession No. NM_000478.5) cDNA was amplified by PCR using the primer pairs: forward: 5′-ACTGGATCCTCCAGGGATAAAGCAGGTCT-3′; reverse: 5′- TATCTCGAGTGGGAAGTTGGCATCTGTC-3′. Then, the ALPL gene was inserted into the vector pENTR^TM2B (Invitrogen Life Technology, Carlsbad, CA, USA), and a Gateway LR recombination reaction between the ALPL clone vector and pLenti6.3/V5-DEST was performed to generate the expression clone Lenti-ALPL. The cDNA encoding β-catenin (GenBank Accession No. NM_007614.3) was amplified by TaKaRa LA Taq polymerase with GC Buffer (TaKaRa, Japan). Primers were used as follows: forward: 5′-CGGGGAGGCGGAGACGGAGCAC-3′, reverse: 5′-CCAGCCCACCCCTCGAGCCCTCTC-3′. Then, the restriction enzymes SalI and BamHI were used to introduce the above fragment into the backbone vector pIRES2-EGFP (Clonetech, USA).

pDsRed-Cav1.2 was constructed using a ClonExpress Ultra One Step Cloning kit according to the manufacturer’s protocol (Vazyme, Nanjing, China). In brief, Cav1.2 was amplified by primers: forward: 5′-GGGGTACCATGGTCAATGAAAACACGAGG-3′, reverse: 5′-ATAAGAATGCGGCCGC CTACAGGTTGCTGACGTAGGAC-3′ from pCa_V1.2 (Addgene, Plasmid #26572). Then, the fragment was introduced into the vector pCa_V1.2 by restriction enzymes KpnI and NotI to construct the recombinant plasmid pCa_V1.2-KN. DsRed was amplified from pLVX-EF1α-DsRed-monomer-N1 (Biovector NTCC Inc., Beijing, China) with the following primers: forward 5′-GGGAGACCCAAGCTGGCTAGC ATGGACAACACCGAGGACGTCAT-3′, and reverse: 5′-GTTTTCATTGACCATGGTACC CTGGGAGCCGGAGTGGCG-3′. Finally, the DsRed fragment was ligated with linearized pCa_V1.2-KN by ExnaseII to construct pDsRed-Cav1.2.

Transfection

For transfecting experiments, BMSCs (0.5 × 10⁶) were seeded on a six-well culture plate and then were transfected with Ca_V1.2 siRNA or Ca_V1.3 siRNA (Santa Cruz, Dallas, TX, USA) using X-tremeGENE siRNA Transfection Reagent (Roche, Basel, Switzerland) according to the manufacturer’s instructions.

To downregulate or overexpress ALPL in BMSCs, we first produced lentiviruses carrying shALPL or ALPL cDNA. The lentiviral vector and the ViraPower Packaging Mix were cotransfected into 293T cells to produce a lentiviral stock according to the protocol provided by the manufacturer. Virus-containing supernatants were harvested 48 h after transfection, and then they were pooled and filtered through 0.45-µm filters. Cells were treated with a lentivirus at a multiplicity of infection of 100 at 37 °C and 5% CO₂. The plates were swirled every 15 min, and fresh medium was added after 1 h of incubation. The cells were exposed to lentivirus for 48 h, which was followed by protein extraction for western immunoblotting or differentiation induction.

The following plasmids were used in transfection experiments: pCatenin-EGFP, pCa_V1.2 (Addgene, Plasmid #26572), pCa_V1.3 (Addgene, Plasmid #49332), DN-Dyn1 (Addgene, Plasmid #55795), pCa_Vα2δ1 (Addgene, Plasmid #26575), and pCa_Vα2δ1mut (Addgene, Plasmid #58730). Transfections were performed according to the protocol of X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland). After transfection, protein was extracted from cells for western immunoblotting, differentiation induction, and confocal imaging.

MicroCT analysis

Femurs were harvested and analyzed using a desktop microCT system (eXplore Locus SP, GE Healthcare, USA). The scanner was set at a voltage of 80 kVp, a current of 80 μA and a resolution of 8 μm per pixel. Cross-sectional images of middiaphysis femurs were used to perform three-dimensional histomorphometric analysis of trabecular bone. Cross-sectional volumetric BMD was measured for the right femur middiaphysis with a density phantom. Using three-dimensional images, an ROI in the secondary spongiosa was manually drawn near the endocortical surface. Bone volume relative to tissue volume (BV/TV) and Tb.N were assessed as cancellous bone morphometric parameters.

Histology

To assess the areas of trabecular bone and bone marrow, femurs and tibias were fixed in 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) and then were decalcified with 5% EDTA (pH 7.4), which was followed by paraffin embedding. The 6 μm paraffin sections were stained with hematoxylin and eosin (H&E) and were analyzed using NIH ImageJ software. To label the matrix mineralization, the mice were given intraperitoneal injections of calcein (Sigma-Aldrich, USA, 20 mg·kg⁻¹ body weight) at day 10 and day 3 before sacrifice. Bone dynamic histomorphometric analyses for MAR were performed according to the standardized nomenclature for bone histomorphometry using fluorescence microscopy (Leica DM 6000B, German).

In vivo oil red O staining

To assess adipose tissue in trabecular areas, femurs were fixed in 4% paraformaldehyde and were decalcified with 5% EDTA (pH 7.4), which was followed by cryosectioning. Sections were stained with oil red O, and positive areas were quantified under microscopy and are shown as a percentage of the total area. Briefly, sections were washed with 60% isopropanol and then were incubated in fresh oil red O staining solution for 15 min at room temperature before being counterstained with hematoxylin. All reagents for oil red O staining were purchased from Sigma-Aldrich.

Ionomycin treatment

Ionomycin (Alomone, Jerusalem, Israel) was dissolved in DMSO. For in vivo treatment, ionomycin was intraperitoneally administered to 12-week-old alpl^+/− mice and alpl^−/− CKO mice at a dose of 1 mg·kg⁻¹ per day for 28 days. The control mice were treated with only the vehicle. After ionomycin treatment, all groups of mice were healthy.

Statistics

All experimental group sizes were chosen to ensure adequate statistical power despite the highly variable nature of the studies performed. No animals were excluded, and animals were randomly assigned groups for the studies. Experiments were not performed in a blinded fashion. Data were assessed for normal distribution and similar variance between groups. Comparisons between two groups were performed using independent unpaired two-tailed Student’s t tests, and comparisons between more than two groups were analyzed using one-way ANOVA with the Bonferroni adjustment. P values of less than 0.05 were considered statistically significant.

References

Millan, J. L. & Whyte, M. P. Alkaline phosphatase and hypophosphatasia. Calcif. Tissue Int. 98, 398–416 (2016).
Article CAS PubMed Google Scholar
Whyte, M. P. Hypophosphatasia—aetiology, nosology, pathogenesis, diagnosis and treatment. Nat. Rev. Endocrinol. 12, 233–246 (2016).
Article CAS PubMed Google Scholar
Liu, W. et al. Alpl prevents bone ageing sensitivity by specifically regulating senescence and differentiation in mesenchymal stem cells. Bone Res. 6, 27 (2018).
Article PubMed PubMed Central CAS Google Scholar
Li, C. J. et al. Long noncoding RNA Bmncr regulates mesenchymal stem cell fate during skeletal aging. J. Clin. Investig. 128, 5251–5266 (2018).
Article PubMed Google Scholar
Russell, R. G. Excretion of inorganic pyrophosphate in hypophosphatasia. Lancet 2, 461–464 (1965).
Article CAS PubMed Google Scholar
Whyte, M. P., Mahuren, J. D., Vrabel, L. A. & Coburn, S. P. Markedly increased circulating pyridoxal-5’-phosphate levels in hypophosphatasia. Alkaline phosphatase acts in vitamin B6 metabolism. J. Clin. Investig. 76, 752–756 (1985).
Article CAS PubMed Google Scholar
Scheibe, R. J., Kuehl, H., Krautwald, S., Meissner, J. D. & Mueller, W. H. Ecto-alkaline phosphatase activity identified at physiological pH range on intact P19 and HL-60 cells is induced by retinoic acid. J. Cell. Biochem. 76, 420–436 (2000).
Article CAS PubMed Google Scholar
Zimmermann, H. Nucleotide signaling in nervous system development. Pflug. Arch. 452, 573–588 (2006).
Article CAS Google Scholar
Ciancaglini, P. et al. Kinetic analysis of substrate utilization by native and TNAP-, NPP1-, or PHOSPHO1-deficient matrix vesicles. J. Bone Miner. Res. 25, 716–723 (2010).
CAS PubMed Google Scholar
Belachew, D. et al. Infantile hypophosphatasia secondary to a novel compound heterozygous mutation presenting with pyridoxine-responsive seizures. JIMD Rep. 11, 17–24 (2013).
Article PubMed PubMed Central Google Scholar
Barcia, J. P., Strife, C. F. & Langman, C. B. Infantile hypophosphatasia: treatment options to control hypercalcemia, hypercalciuria, and chronic bone demineralization. J. Pediatr. 130, 825–828 (1997).
Article CAS PubMed Google Scholar
Berridge, M. J., Lipp, P. & Bootman, M. D. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1, 11–21 (2000).
Article CAS PubMed Google Scholar
Cui, M., Li, Q., Johnson, R. & Fleet, J. C. Villin promoter-mediated transgenic expression of transient receptor potential cation channel, subfamily V, member 6 (TRPV6) increases intestinal calcium absorption in wild-type and vitamin D receptor knockout mice. J. Bone Miner. Res. 27, 2097–2107 (2012).
Article CAS PubMed PubMed Central Google Scholar
Hoenderop, J. G. et al. Renal Ca²⁺ wasting, hyperabsorption, and reduced bone thickness in mice lacking TRPV5. J. Clin. Investig. 112, 1906–1914 (2003).
Article CAS PubMed Google Scholar
Wen, L. et al. L-type calcium channels play a crucial role in the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells. Biochem. Biophys. Res. Commun. 424, 439–445 (2012).
Article CAS PubMed Google Scholar
Barradas, A. M. et al. A calcium-induced signaling cascade leading to osteogenic differentiation of human bone marrow-derived mesenchymal stromal cells. Biomaterials 33, 3205–3215 (2012).
Article CAS PubMed Google Scholar
Jung, H., Best, M. & Akkus, O. Microdamage induced calcium efflux from bone matrix activates intracellular calcium signaling in osteoblasts via L-type and T-type voltage-gated calcium channels. Bone 76, 88–96 (2015).
Article PubMed Google Scholar
Whyte, M. P. et al. Asfotase alfa treatment improves survival for perinatal and infantile hypophosphatasia. J. Clin. Endocrinol. Metab. 101, 334–342 (2016).
Article CAS PubMed Google Scholar
Whyte, M. P. et al. Enzyme-replacement therapy in life-threatening hypophosphatasia. N. Engl. J. Med. 366, 904–913 (2012).
Article CAS PubMed Google Scholar
Tsien, R. W., Lipscombe, D., Madison, D. V., Bley, K. R. & Fox, A. P. Multiple types of neuronal calcium channels and their selective modulation. Trends Neurosci. 11, 431–438 (1988).
Article CAS PubMed Google Scholar
Catterall, W. A. Structure and regulation of voltage-gated Ca²⁺ channels. Annu. Rev. Cell Dev. Biol. 16, 521–555 (2000).
Article CAS PubMed Google Scholar
Praefcke, G. J. & McMahon, H. T. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol. 5, 133–147 (2004).
Article CAS PubMed Google Scholar
Canti, C. et al. The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of alpha2delta subunits is key to trafficking voltage-gated Ca²⁺ channels. Proc. Natl Acad. Sci. USA 102, 11230–11235 (2005).
Article CAS PubMed Google Scholar
Tetreault, M. P. et al. Identification of glycosylation sites essential for surface expression of the CaValpha2delta1 subunit and modulation of the cardiac CaV1.2 channel activity. J. Biol. Chem. 291, 4826–4843 (2016).
Article CAS PubMed PubMed Central Google Scholar
Green, E. M., Barrett, C. F., Bultynck, G., Shamah, S. M. & Dolmetsch, R. E. The tumor suppressor eIF3e mediates calcium-dependent internalization of the L-type calcium channel CaV1.2. Neuron 55, 615–632 (2007).
Article CAS PubMed PubMed Central Google Scholar
Seefried, L. et al. Efficacy of anti-sclerostin monoclonal antibody BPS804 in adult patients with hypophosphatasia. J. Clin. Investig. 127, 2148–2158 (2017).
Article PubMed Google Scholar
Sun, X., Kishore, V., Fites, K. & Akkus, O. Osteoblasts detect pericellular calcium concentration increase via neomycin-sensitive voltage gated calcium channels. Bone 51, 860–867 (2012).
Article CAS PubMed Google Scholar
Zhang, J., Li, M., Kang, E. T. & Neoh, K. G. Electrical stimulation of adipose-derived mesenchymal stem cells in conductive scaffolds and the roles of voltage-gated ion channels. Acta Biomater. 32, 46–56 (2016).
Article CAS PubMed Google Scholar
Snutch, T. P. & Reiner, P. B. Ca²⁺ channels: diversity of form and function. Curr. Opin. Neurobiol. 2, 247–253 (1992).
Article CAS PubMed Google Scholar
Hell, J. W. et al. Identification and differential subcellular localization of the neuronal class C and class D L-type calcium channel alpha 1 subunits. J. Cell Biol. 123, 949–962 (1993).
Article CAS PubMed Google Scholar
Ludwig, A., Flockerzi, V. & Hofmann, F. Regional expression and cellular localization of the alpha1 and beta subunit of high voltage-activated calcium channels in rat brain. J. Neurosci. 17, 1339–1349 (1997).
Article CAS PubMed PubMed Central Google Scholar
Takimoto, K., Li, D., Nerbonne, J. M. & Levitan, E. S. Distribution, splicing and glucocorticoid-induced expression of cardiac alpha 1C and alpha 1D voltage-gated Ca²⁺ channel mRNAs. J. Mol. Cell. Cardiol. 29, 3035–3042 (1997).
Article CAS PubMed Google Scholar
Foster, B. L. et al. Tooth root dentin mineralization defects in a mouse model of hypophosphatasia. J. Bone Miner. Res. 28, 271–282 (2013).
Article CAS PubMed PubMed Central Google Scholar
Foster, B. L. et al. Rare bone diseases and their dental, oral, and craniofacial manifestations. J. Dent. Res. 93, 7S–19S (2014).
Article CAS PubMed PubMed Central Google Scholar
Waymire, K. G. et al. Mice lacking tissue non-specific alkaline phosphatase die from seizures due to defective metabolism of vitamin B-6. Nat. Genet. 11, 45–51 (1995).
Article CAS PubMed Google Scholar
Narisawa, S., Frohlander, N. & Millan, J. L. Inactivation of two mouse alkaline phosphatase genes and establishment of a model of infantile hypophosphatasia. Dev. Dyn. 208, 432–446 (1997).
Article CAS PubMed Google Scholar
Foster, B. L. et al. Conditional alpl ablation phenocopies dental defects of hypophosphatasia. J. Dent. Res. 96, 81–91 (2017).
Article CAS PubMed Google Scholar
Ambrosi, T. H. et al. Adipocyte accumulation in the bone marrow during obesity and aging impairs stem cell-based hematopoietic and bone regeneration. Cell Stem Cell 20, 771–784 e776 (2017).
Article CAS PubMed PubMed Central Google Scholar
Liu, Y. et al. Hydrogen sulfide maintains mesenchymal stem cell function and bone homeostasis via regulation of Ca(2+) channel sulfhydration. Cell Stem Cell 15, 66–78 (2014).
Article CAS PubMed PubMed Central Google Scholar
Merritt, J. E., McCarthy, S. A., Davies, M. P. & Moores, K. E. Use of fluo-3 to measure cytosolic Ca²⁺ in platelets and neutrophils. Loading cells with the dye, calibration of traces, measurements in the presence of plasma, and buffering of cytosolic Ca²⁺. Biochem J. 269, 513–519 (1990).
Article CAS PubMed PubMed Central Google Scholar
Jin, O. U. et al. Interaction of alpha1-adrenoceptor subtypes with different G proteins induces opposite effects on cardiac L-type Ca²⁺ channel. Circ. Res. 102, 1378–1388 (2008).
Article CAS Google Scholar
Moffat, J. et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283–1298 (2006).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This study was funded by grants from the National Natural Science Foundation of China (Nos. 81620108007 and 81870768), the National Key Research and Development Program of China (Nos. 2016YFC1101400 and 2017YFA0104800), the Scientific Young Alma of Shaanxi province (2018KJXX-015) and a Schoenleber pilot grant from the University of Pennsylvania School of Dental Medicine.

Author information

These authors contributed equally: Bei Li, Xiaoning He, Zhiwei Dong

Authors and Affiliations

State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi International Joint Research Center for Oral Diseases, Center for Tissue Engineering, School of Stomatology, The Fourth Military Medical University, Xi’an, 710032, Shaanxi, China
Bei Li, Xiaoning He, Zhiwei Dong, Shiyu Liu, Wenjia Liu, Chenghu Hu, Yimin Zhao & Yan Jin
Xi’an Institute of Tissue Engineering and Regenerative Medicine, Xi’an, China
Bei Li, Xiaoning He, Shiyu Liu, Wenjia Liu, Chenghu Hu & Yan Jin
Department of Pediatric Dentistry, School of Stomatology, Fourth Military Medical University, Xi’an, China
Kun Xuan & Li Gao
Institute for Biomedical Sciences of Pain, Tangdu Hospital, Fourth Military Medical University, Xi’an, China
Wei Sun
Department of Anatomy and Cell Biology, University of Pennsylvania School of Dental Medicine, Philadelphia, PA, USA
Songtao Shi
South China Center of Craniofacial Stem Cell Research, Guanghua School of Stomatology, Sun Yat-sen University, 74 Zhongshan 2Rd, Guangzhou, Guangdong, China
Songtao Shi

Authors

Bei Li
View author publications
You can also search for this author in PubMed Google Scholar
Xiaoning He
View author publications
You can also search for this author in PubMed Google Scholar
Zhiwei Dong
View author publications
You can also search for this author in PubMed Google Scholar
Kun Xuan
View author publications
You can also search for this author in PubMed Google Scholar
Wei Sun
View author publications
You can also search for this author in PubMed Google Scholar
Li Gao
View author publications
You can also search for this author in PubMed Google Scholar
Shiyu Liu
View author publications
You can also search for this author in PubMed Google Scholar
Wenjia Liu
View author publications
You can also search for this author in PubMed Google Scholar
Chenghu Hu
View author publications
You can also search for this author in PubMed Google Scholar
Yimin Zhao
View author publications
You can also search for this author in PubMed Google Scholar
Songtao Shi
View author publications
You can also search for this author in PubMed Google Scholar
Yan Jin
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

B.L., X.H., and Z.D. performed the animal experiments, immunofluorescence staining and immunoblotting, cultured cells, collected data, analyzed the data, and produced all figures and tables. K.X. collected the cells from patients, and W.S. and L.G. helped with the immunofluorescence staining and participated in the animal surgery. S.L., W.L., C.H., and Y.Z. helped with data analysis. S.S. and Y.J. designed the experiments, oversaw the collection of the results and data interpretation and drafted the reports. All authors have seen and approved the final version of this paper.

Corresponding authors

Correspondence to Songtao Shi or Yan Jin.

Ethics declarations

Competing interests

The authors declare no competing interests.

Supplementary information

supplementary data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Li, B., He, X., Dong, Z. et al. Ionomycin ameliorates hypophosphatasia via rescuing alkaline phosphatase deficiency-mediated L-type Ca²⁺ channel internalization in mesenchymal stem cells. Bone Res 8, 19 (2020). https://doi.org/10.1038/s41413-020-0090-7

Download citation

Received: 06 March 2019
Revised: 02 October 2019
Accepted: 05 January 2020
Published: 26 April 2020
DOI: https://doi.org/10.1038/s41413-020-0090-7

This article is cited by

ALPL regulates pro-angiogenic capacity of mesenchymal stem cells through ATP-P2X7 axis controlled exosomes secretion
- Jiayi Dong
- Wanmin Zhao
- Hongzhi Zhou
Journal of Nanobiotechnology (2024)
Reactive Oxygen Species Scavenging Hydrogel Regulates Stem Cell Behavior and Promotes Bone Healing in Osteoporosis
- Yuanjian Ye
- Haobo Zhong
- Shaowei Zheng
Tissue Engineering and Regenerative Medicine (2023)