The solution configurations of inactive and activated DntR have implications for the sliding dimer mechanism of LysR transcription factors

Lerche, Michael; Dian, Cyril; Round, Adam; Lönneborg, Rosa; Brzezinski, Peter; Leonard, Gordon A.

doi:10.1038/srep19988

Download PDF

Article
Open access
Published: 28 January 2016

The solution configurations of inactive and activated DntR have implications for the sliding dimer mechanism of LysR transcription factors

Michael Lerche¹,
Cyril Dian²^nAff6,
Adam Round^3,4,
Rosa Lönneborg⁵^nAff7,
Peter Brzezinski⁵ &
…
Gordon A. Leonard¹

Scientific Reports volume 6, Article number: 19988 (2016) Cite this article

2703 Accesses
29 Citations
1 Altmetric
Metrics details

Subjects

Abstract

LysR Type Transcriptional Regulators (LTTRs) regulate basic metabolic pathways or virulence gene expression in prokaryotes. Evidence suggests that the activation of LTTRs involves a conformational change from an inactive compact apo- configuration that represses transcription to an active, expanded holo- form that promotes it. However, no LTTR has yet been observed to adopt both configurations. Here, we report the results of structural studies of various forms of the LTTR DntR. Crystal structures of apo-DntR and of a partially autoinducing mutant H169T-DntR suggest that active and inactive DntR maintain a compact homotetrameric configuration. However, Small Angle X-ray Scattering (SAXS) studies on solutions of apo-, H169T- and inducer-bound holo-DntR indicate a different behaviour, suggesting that while apo-DntR maintains a compact configuration in solution both H169T- and holo-DntR adopt an expanded conformation. Models of the SAXS-obtained solution conformations of apo- andholo-DntR homotetramers in complex with promoter-operator region DNA are consistent with previous observations of a shifting of LTTR DNA binding sites upon activation and a consequent relaxation in the bend of the promoter-operator region DNA. Our results thus provide clear evidence at the molecular level which strongly supports the ‘sliding dimer’ hypothesis concerning LTTR activation mechanisms.

The bacterial multidrug resistance regulator BmrR distorts promoter DNA to activate transcription

Article Open access 08 December 2020

Chengli Fang, Linyu Li, … Yu Zhang

Structure of the transcription open complex of distinct σI factors

Article Open access 13 October 2023

Jie Li, Haonan Zhang, … Ping Zhu

DNA looping mediates cooperative transcription activation

Article 04 January 2024

Shu-Jing Han, Yong-Liang Jiang, … Cong-Zhao Zhou

Introduction

LysR Type Transcriptional Regulators (LTTRs), the largest family of transcription factors found in prokaryotes^1,2, are involved in the regulation of basic metabolic pathways or virulence gene expression³ and share a high degree of structural identity⁴. LTTR monomers (Fig. 1a) comprise approximately 300 amino acid residues containing two principle domains connected by a linker helix: a large C-terminal Regulatory Domain (RD) and a smaller N-terminal winged Helix Turn Helix (wHTH) DNA Binding Domain (DBD). LTTR RDs comprise two Rossmann fold-like sub domains (RD1, RD2). Ligand binding by inducer molecules which activate LTTRs occurs in Inducer Binding Cavities (IBCs) primarily located at the RD1-RD2 interface^5,6,7.

LTTRs generally associate as homotetramers^4,8 in which two DBD dimers flank a central RD tetrameric core (Fig. 1) and regulate the expression of operon genes by binding a divergent promoter region on three different functional subsites: a high affinity Repression Binding Site (RBS), often found near position −65 relative to the transcription start site and two low affinity Activation Binding Sites (ABS’ and ABS”) found near positions −10 and −35 respectively^9,10. Interaction with all three binding sites is essential for the regulation of gene expression by homotetrameric LTTRs. In the current hypothesis – the so-called ‘sliding dimer’ mechanism – LTTR activation leads to a shift in promoter region binding sites from RBS/ABS’ to RBS/ABS”, releasing the −35 box of the promoter region DNA for RNA polymerase recognition and subsequent gene expression.

While there is much biochemical, biophysical and modelling evidence^{9,10,11,12,13} to support the sliding dimer mechanism, definitive evidence at the molecular level is scarce. The current hypothesis^6,7 is that upon activation LTTRs morph from a compact to an expanded homotetrameric configuration (Fig. 1b–d)) thus allowing the DBD dimers to bind to different DNA sites. However, while the crystal structures (Fig. 1b,c) of various full-length LTTR homotetramers adopt either compact (i.e. CbnR¹⁴, DntR⁵, BenM¹⁵) or expanded configurations (i.e. TsaR⁷, ArgP¹², AphB¹⁶, OxyR¹³) no full-length LTTR homotetramer has yet been observed to adopt both. Moreover, in the only case where the crystal structures of a LTTR are available in both apo- and inducer-bound forms (TsaR⁷) both exhibit the same expanded configuration.

To provide further insights into the sliding dimer hypothesis and the conformational changes this might involve, we carried out structural studies of the LTTR DntR, obtaining the crystal structures of inactive apo-DntR and of a partially autoinducing H169T mutant (H169T-DntR). Furthermore, we determined, using Small Angle X-ray Scattering (SAXS), models of the solution states of apo-, H169T- and inducer-bound (i.e. fully activated, salicylate-bound) holo-DntR homotetramers. The crystal structures of apo- and H169T-DntR suggest that both inactive and activated DntR homotetramers have the same compact configuration and that no large conformational changes are required for DntR activation. However, SAXS studies ofapo-, H169T- and holo-DntR reveal a completely different picture, suggesting that in solution apo-DntR maintains a compact quaternary configuration but that both H169T-DntR and holo-DntR homotetramers adopt an expanded conformation. Moreover, putative models bound to promoter DNA regions appear to support the physiological relevance of the solution conformations of apo- andholo-DntR obtained. These models suggest that a shift of binding sites, accompanied by a relaxation of DNA bend, would occur upon activation of DntR. Our results show that a single LTTR can adopt different conformations, depending on activation state, providing compelling structural evidence to support the sliding dimer mechanism for the activation of homotetrameric LTTRs and confirming that this involves a change in quaternary structure from compact to expanded conformations.

Results and Discussion

The crystal structures of apo-DntR and H169T-DntR

The crystal structure of apo-DntR is isostructural with those of DntR in complex with either acetate or thiocyanate (Table 1,Fig. 2)⁵. As for acetate- or thiocyanate-bound DntR, the asymmetric unit (a.u) contains two DntR molecules with a homotetramer adopting a compact configuration (Fig. 2a) being constructed by the association of two symmetry-related dimers. However, in contrast to the crystal structures of acetate/thiocyanate-bound DntR the crystal structure reported here shows well-defined electron density for the wHTH regions. The crystal structure ofapo-DntR thus represents the first of a full length DntR homotetramer, although this is extremely similar to the model of a full-length thiocyanate-bound DntR homotetramer⁵ produced by Smirnova and colleagues (r.m.s. deviation in C_α positions of 1.04 Å for 1190 residues aligned).

Table 1 Data processing and structure refinement statistics for apo-DntR and H169T-DntR.

Full size table

The IBCs in the crystal structure of apo-DntR are devoid of any ligands (Fig. 2b), confirming the apo- nature of the homotetramers. Indeed, a comparison of the apo-DntR IBC conformation with those of the IBCs of ‘open-hinge region’ salicylate-bound DntR RDs⁶ (Fig. 2c) shows that if DntR IBCs maintain the conformation seen in the crystal structure ofapo-DntR they cannot bind salicylate and DntR cannot be activated. The crystal structure of apo-DntR thus seems to confirm that inactiveapo-DntR homotetramers adopt a compact homotetrameric configuration. Interestingly, a comparison of the configuration of apo-IBCs with those of the IBCs seen in the crystal structures of acetate- or thiocyanate-bound DntR (Fig. 2d) shows them to be very similar. This suggests that acetate/thiocyanate molecules bound in IBCs of DntR homotetramers serve to reinforce the apo- IBC configuration rather than, as previously suggested⁵, acting as mimics of bound salicylate.

The crystals of H169T-DntR we obtained show very similar unit cell dimensions and the same space group to those of apo-DntR (Table 1). Similar to apo-DntR, in the crystal structure of H169T-DntR contains a dimer in the a.u. with a homotetramer adopting a compact configuration formed by the association of two symmetry-related dimers. The quality of the electron density map for H169T-DntR did not allow the building of the wHTH regions, hence the final model obtained essentially includes only that of a thiocyanate-bound (Fig. 2e) H169T-DntR RD homotetramer. This adopts an identical quaternary structure to the central RD homotetramer seen in crystals of apo-DntR (r.m.s.d. in C_α positions, 0.36 Å; 428 atoms superposed in the RD dimers seen in the a.u.). However, a superposition of the crystal structure of H169T-DntR with that of ‘open-hinge’ inducer-bound DntR RDs⁶ (Fig. 2f) shows, in contrast to what we report forapo-DntR above, the conformations of their IBCs to be very similar. This observation seems to provide a rational explanation as to why the H169T mutation autoinduces transcription (Fig. 2g) and suggests that upon activation DntR homotetramers could maintain a compact configuration.

The solution conformations of apo- and H169T-DntR

The conclusion, based on the crystal structures described above, that both inactive and active forms of DntR homotetramers maintain a compact configuration is inconsistent with the results of thermal stability analyses (TSAs) ofapo-, H169T- and holo-DntR (Table 2). These show the melting temperature (T_m) of H169T-DntR is increased by 9 °C relative to that of apo-DntR, suggesting that, in solution, there are larger conformational differences betweenapo- and H169T-DntR homotetramers than are seen in the crystal structures described above.

Table 2 Melting temperatures (T_m) and SAXS invariant parameters forapo-DntR, H169T-DntR and apo-DntR pre-incubated with various concentrations of salicylate.

Full size table

It is generally accepted that, in many cases, the packing interactions required for the formation of crystals can lock a particular macromolecule in a single conformation and there are an increasing number of examples where solution structures reveal physiologically relevant conformations of biological macromolecules that are unobtainable in crystals^17,18,19,20. We therefore examined the crystal packing interactions for both apo- (Fig. 3a) and H169T-DntR and found these interactions constrain the H169T-DntR tetramer to adopt a compact configuration similar to that adopted by apo-DntR. In order to verify whether these compact configurations represent the physiological states of apo-DntR and H169T-DntR homotetramers, we carried out SAXS experiments (Table 2, Figs 3,4 and 5).

For apo-DntR homotetramers in solution, the Guinier region of the scattering curve obtained yields a radius of gyration of 39 Å and analysis of the pair distribution function (P(r)) derived from the scattering curve obtained suggests a maximum intramolecular distance of 118.2 Å. This latter is significantly shorter than the maximum distance (130.5 Å) observed in the apo-DntR crystal structure and suggests, as does the poor agreement (χ² = 2.1) of a fit (Fig. 4a) of the experimentally measured scattering curve and a scattering curve calculated using the homotetramer seen in the crystal structure, that the conformation of apo-DntR homotetramers in solution is different to that observed in the crystal. To test whether, in solution, apo-DntR homotetramers adopt an expanded configuration form similar to that seen in the crystal structure of TsaR⁷ (Fig. 1b) we constructed a homology model of such a homotetramer using Swiss-Model²¹. A fit of the calculated scattering curve based on this model and the experimental scattering curve also results in a rather poor agreement (χ² = 1.9, Fig. 4a). Therefore, in order to obtain a model of the conformation of apo-DntR homotetramers in solution we employed rigid body refinement procedures. The resulting model provides very good fits to both theab-initio molecular envelope obtained from our SAXS experiments (Fig. 5a) and to the experimental scattering curve (χ² = 1.0; Fig. 4a) and shows that in solution apo-DntR maintains a compact tetrameric conformation. However and as expected from the value of D_max derived from the P(r) function, the solution shape ofapo-DntR is less elongated than is seen in the crystal with the DBD dimers – the positions of which may also be influenced by lattice constraints in the crystal - packed closer to the tetrameric core (Fig. 5a,b).

In SAXS analysis of solutions of H169T-DntR the Guinier region of the scattering curve obtained yields a radius of gyration value of 42 Å, larger than the 39 Å observed in solution for apo-DntR. D_max (135 Å) as derived from the pair distribution (P(r)) function is also significantly larger than that seen in solution forapo-DntR (118 Å). SAXS experiments thus indicate that the solution shape of H169T-DntR homotetramers is different to that of inactive apo-DntR homotetramers. This observation is reinforced by the results of fits of the experimental scattering curve of H169T-DntR to curves calculated from various structural models (Fig. 4b). Here, calculated curves based on either the solution (χ² = 3.4) or crystal (χ² = 2.4) structures ofapo-DntR reported here result in very poor matches. However, a scattering curve based on our homology model of a TsaR-type expandedapo-DntR homotetramer provides an improved fit (χ² = 1.5). This suggests that in solution H169T-DntR adopts a conformation similar to that of the expanded homotetramers seen in the crystal structure of TsaR. As H169T-DntR activates transcription even in the absence of its inducer molecule salicylate, implying that it more easily adopts an activated conformation than doesapo-DntR, these results indicate that an expanded conformation is the activated state of DntR and, as previously hypothesised⁷, of LTTR family homotetramers in general.

The solution model of holo-DntR

We have been unable to crystallise full-length DntR in the presence of salicylate and therefore examined the solution conformation of holo- (i.e. active) DntR in a series of SAXS experiments. The invariant parameters (R_g, I (0), D_max, Porod Volume) derived from scattering curves obtained and the resulting P(r) functions are shown in Table 2. Incubation of apo-DntR with 20 μM sodium salicylate produces no significant change compared to apo-DntR while incubation with either 100 μM or 5000 μM sodium salicylate yields increased values of R_g and D_max. However, values of I(0) and Porod volume in the presence of 5000 μM sodium salicylate increase markedly compared to those obtained for apo-DntR, indicating the presence of sufficient inter-particle effects to make this scattering curve unreliable for further analysis. This is in contrast to values obtained following incubation with 100 μM sodium salicylate. The scattering curve (Fig. 3a) obtained for apo-DntR incubated with 100 μM sodium salicylate was therefore used in further analysis of the solution conformation of holo-DntR.

For holo-DntR a fit of the Guinier region (Fig. 3b) of the scattering curve yields a radius of gyration of 41.4 Å, similar to that obtained for H169T-DntR in solution but larger than that seen for apo-DntR. D_max (142 Å) is also similar to that obtained for H169T-DntR in solution and significantly larger than is seen for apo-DntR (Fig. 3c). As for H169T-DntR, comparisons of the experimental scattering curve of holo-DntR with scattering curves based on the solution (χ² = 2.2) and crystal structures (χ² = 2.1) of apo-DntR homotetramers show poor fits while that with a curve calculated using the TsaR type homology model of a DntR tetramer is clearly improved (χ² = 1.6) (Fig. 4c). This suggests, again as for H169T-DntR, that the solution conformation of holo-DntR homotetramers is closer to the expanded configuration observed for the crystal structure of TsaR than to either of the solution or crystal structures of apo-DntR described here.

To obtain a clearer idea of the solution structure of activated holo-DntR homotetramers rigid body modelling was employed. While the scattering curve calculated from the resulting model provides a good fit (χ² = 1.2) to the experimental curve (Fig. 4d), poor agreement at higher q values indicates local differences between this model and the true solution structure. A plausible explanation is that the RDs treated as rigid bodies in the modelling procedure derive from the crystal structure of acetate-/thiocyanate bound DntR which, as has been shown above (Fig. 2c,d), cannot bind salicylate. In an attempt to obtain a better fit these were replaced with RDs observed in the crystal structure of doubly-salicylate-bound holo-ΔN90DntR (PDB 2Y7K, chain A and B)⁶. Here, the IBCs are expanded to accommodate salicylate and the RD is slightly closed around the ligand. This results in a model for the solution structure of holo-DntR which provides an excellent fit to theab-initio molecular envelope obtained (Fig. 5b) and for which the calculated scattering curve provides a very good fit to the experimental scattering curve over the entire q range (χ² = 1.0, Fig. 4d).

Our SAXS experiments thus indicate that, in solution, both H169T-DntR (autoinducing) and holo-DntR (fully activated) homotetramers do not adopt the compact conformation seen in solution for apo-DntR homotetramers but that both adopt similar, TsaR-type expanded configurations. This observation is consistent with TSA measurements showing that both H169T-DntR andholo-DntR have similar T_ms which are significantly higher than that seen for apo-DntR (Table 2). Our SAXS experiments thus show the solution conformation of activated DntR to be that of an expanded form homotetramer with an open central cavity and very reminiscent in nature to the conformation seen in the crystal structure of TsaR.

Models of the binding of the solution conformations of apo- andholo-DntR to promoter region DNA

DntR and other members of the LTTR family, are bound to DNA in both inactive and active states^5,11. Activation of transcription by LTTRs must therefore be coupled to conformational differences between active and inactive states prompted by the binding of inducer molecules. The results of our SAXS studies (Fig. 5) suggest, as previously hypothesised^6,7, that this conformational change involves a transformation from a compact homotetrameric configuration which represses expression to an expanded configuration that promotes it.

Our SAXS studies of holo-DntR also suggest, as we have previously postulated⁶, that the driving force for the transition from compact to expanded homotetrameric configurations is a closure upon inducer binding of the RDs making up the core of the tetramer which, if the compact form of the homotetramer were maintained, would result in steric clashes between RD2 subdomains at the tetramer interface. Our SAXS studies also indicate that upon activation, as might be expected from an analysis of the crystal structure of TsaR⁷ which the SAXS-obtained solution conformation ofholo-DntR closely resembles, DntR homotetramers adopt a much flatter configuration than is seen for apo-DntR (Fig. 5). In this activated conformation, the separation between the recognition helices in the HTH dimers flanking the central RD tetrameric core is significantly increased compared to that seen in solution for apo-DntR, suggesting both different promoter region DNA binding sites for inactive and activated DntR and a relaxation in the bend of promoter region DNA upon the transition from the inactive to active conformations of DntR.

In the absence of bound inducer molecules, inactive tetramers of the LTTR BenM binds to two palindromic sites (RBS and ABS’) on p_benA promoter region DNA repressing expression. Upon activation, DNA binding sites shift to the RBS and ABS” sites of p_benA and transcription occurs¹¹. A similar ‘sliding’ of the DNA binding sites of inactive and active LTTRS has also been observed for OccR²² and OxyR²³. While the exact nature of the DntR RBS and ABS’ and ABS” binding sites in its p_dnt promoter region DNA have yet to be determined, alignment of p_dnt with the nucleotide sequences of p_benA and p_nahr (the latter the promoter-operator region of another homologous LTTR, NahR) suggests that these will be found in similar regions in all three promoter regions (Fig. 6a). In order to verify that the models obtained here for the solution conformations of apo- and holo-DntR are physiologically relevant, we constructed models of both species bound to p_benA.

Here, the 3D-DART server (http://haddock.science.uu.nl/dna/dna.php)²⁴ was used to generate series of models of p_benA (75bp in length) each with a total DNA bending angle distributed homogenously along the DNA sequence. The most convincing DNA model allowing interaction between the solution structure ofapo-DntR and both the RBS and ABS’ binding sites of p_benA was obtained with a DNA displaying a bend angle of 240° (Fig. 6b). In this model, as seen in the crystal structure of wHTH DNA binding domain (DBDs) of BenM in complex with RBS of p_benA²⁵, the recognition helices and wings of both wHTH dimers interact with consecutive major and minor grooves of each binding site.

A similar approach was performed for holo-DntR (Fig. 6b) with the resulting model suggesting that a 94° bending of the p_benA region is required to satisfy the simultaneous interaction of its RBS and ABS” binding sites with the two wHTH dimers flanking the heterotetrameric core. Here, however, our model predicts that the ABS” binding region of activated DntR is shifted more towards the −10 region than is predicted for BenM. This observation may explain why no conserved ABS” binding motif has yet been deduced for LTTRs²⁶.

The models described above are consistent both with a sliding of DntR promoter region binding sites and a significant relaxation of promoter region DNA bend upon the activation of LTTRs^27,28,29 and suggest the solution conformations obtained here for apo- and holo-DntR are physiologically relevant. However, while the bending angles of bound promoter-operator region DNA (94^o for active DntR, 240° for its inactivated counterpart) deduced from our models are not inconsistent with relatively high degrees of DNA bend that can induced in short DNA sequences^30,31,32 they are much more pronounced than those measured for LTTRs in circular permutation experiments (0–50° and 50–100° for active and inactivated LTTRs, respectively)⁸. This is intriguing and we therefore constructed a second series of models (Fig. 6c) to try to predict how LTTR homotetramers might bind to DNA promoter-operator regions with lower bending angles. Our model in which the p_benA DNA promoter-operator region is bent by 50^o (i.e. close to that measured for active LTTR homotetramers) shows that simultaneous binding of RBS and ABS” can be achieved by a homotetrameric LTTR although this will have a conformation very different to those described here for activated or inactivated DntR. Our model of LTTR binding to p_benA with a DNA bending angle in the region of 100° (i.e. close to that measured for inactive LTTRs) shows that simultaneous binding of RBS and ABS’ regions cannot be achieved if DntR and thus other LTTRs, maintain a homotetrameric conformation. Indeed, this model predicts that in their inactive states LTTRs will bind to RBS and ABS’ as dimers and implies that the activation process involves changes in the affinity of a LTTR dimer such that ABS” is preferred for binding over the ABS’ and that binding to the ABS” results in the formation of a LTTR homotetramer. Given that LTTRs generally associate as homotetramers^4,8 when not bound to DNA this scenario appears unlikely and our ‘high-angle’ DNA models (Fig. 6b) thus seem both to confirm the physiological relevance of the solution structures of inactive and activated DntR described here and to indicate, as has been previously suggested³³, that the bending angles reported for LTTR promoter-operator regions based on circular permutation experiments are underestimated.

Previous studies have shown small basal (i.e. in the absence of inducer molecules) levels of transcription in genes placed upstream of the promoter region controlled by DntR³⁴. This might suggest that in vivo apo-DntR exists in equilibrium between the compact configurations shown in Fig. 5a and the expanded configuration shown in Fig. 5b. Both our modelling of the DNA binding of the solution conformations we have obtained for the repressor form of DntR (apo- state) and activator-form form of DntR (holo- form) (see above) and DNA footprinting/binding assays accumulated on LTTRs^11,22,35 do not seem consistent with this hypothesis. However, we do not rule out that apo-DntR exists in an equilibrium of inactive and active conformations with the fraction of the latter too small to be detected in our SAXS experiments. We also do not rule out that apo-DntR can exist in an equilibrium of conformations between a form that completely represses transcription and a form that incompletely represses it. A possibility for a conformation that incompletely represses transcription is that seen in the crystal structures of apo-DntR and H169T-DntR reported here. Again, however, we see no evidence for such an equilibrium of conformations in our SAXS analysis of apo-DntR.

Conclusions

The current consensus is that LTTRs regulate transcription through large conformational changes which modify LTTR DNA binding sites promoter region DNA. Previous structural studies^6,7,12 have inferred that the change in question is a transition from compact to expanded form tetramers but real structural evidence for this idea has thus far been scarce. In particular, no full-length LTTR homotetramer has yet been observed to adopt both conformations. The results presented here provide the first clear evidence both that a single LTTR homotetramer can adopt both conformations and that the conformation adopted by the homotetramer is a function of activation state. In solution, inactive apo-DntR homotetramers adopt a compact configuration in which DBD dimers pack closely against a compact RD tetrameric core (Fig. 5a) while activated DntR homotetramers adopt a more open quaternary configuration (Fig. 5b) highly reminiscent of the configuration seen in the crystal structure of TsaR. That these configurations of active and inactive DntR are physiologically relevant is supported by models of the binding of these two distinct homotetrameric arrangements to promoter region DNA which are consistent both with a sliding of DntR binding sites and a significant relaxation of DNA bend upon activation. Given the level of structural similarity of LTTR family members this work appears to confirm, as previously proposed¹², that a switch from compact to expanded configurations is likely to be a general activation mechanism for the largest family of transcription factors found in prokaryotes. However, a number of fundamental questions remain to be answered. In particular, the high angles of the bending LTTR promoter region DNA predicted in the models presented here are incommensurate with those measured for other LTTRs in permutation experiments. Further studies will clearly be required to fully validate our conclusions.

Methods

Cloning, expression and purification

DntR-His₆ (DntR) from Burkholderia sp. was expressed and purified as previously described⁵ with the exceptions that two pellets of cOmplete Protease Inhibitor Cocktail Tablets (Roche; http://www.roche-applied-science.com) per litre of culture were added during cell lysis and that purification was conducted at 4 ^oC. To produce H169T-DntR-His₆ (H169T-DntR) site-directed mutagenesis using PCR primers containing the mutation was carried out (Stratagene, La Jolla, USA; forward primer 5′cggcgcctctttcgcacccgctacgtatgcat3′; reverse primer 5′atgcatacgtagcgggtgcgaaagaggcgccg3′). H169T-DntR was then expressed and purified as for wild-type DntR. Once purified, both proteins were stored at various concentrations in a buffer comprising 1 M NaCl, 2 mM MgSO₄, 1 mM DTT, 17% (v/v) glycerol, 25 mM NaH₂PO₄-NaOH (pH 8.0). These solutions were then used as stocks in both crystallisation protocols and SAXS experiments.

Crystallisation, data collection, structure solution and refinement

Crystals of apo-DntR were grown at 18 ^oC in hanging-drops by mixing 1 μL of the protein stock solution (~5 mg/mL) with 1 μL of a reservoir solution consisting of 0.2 M sodium potassium tartrate, 0.1 M Tris-HCl pH 8.0, 5% (w/v) PEG 6000. Crystals of H169T-DntR were obtained as previously described for thiocyanate-bound wtDntR⁵ from drops prepared by mixing 1 μL of the protein stock solution with 1 μL of a reservoir solution comprising 0.2 M sodium tartrate, 0.2 M potassium thiocyanate, 0.5 mM sodium salycilate, 0.1 M Tris (pH 8.5) and 20% (w/v) PEG 8000. Crystals were cryoprotected in the relevant reservoir solution supplemented with of 20% (v/v) glycerol and flash frozen in liquid nitrogen. Diffraction data (Table 1) were collected on ID29 (apo-DntR) and ID23-1 (H169TDntR) of the European Synchrotron Radiation Facility (ESRF^36,37). Diffraction images were integrated and scaled using XDS³⁸, symmetry-related intensities merged using SCALA³⁹ and structure factors derived using TRUNCATE⁴⁰. For both apo-DntR and H169T-DntR structure solution was carried out using Molecular Replacement (MR) in the program PHASER⁴¹ using the crystal structure of acetate-bound DntR (PBD ID, 1UTB⁵) stripped of water molecules and other ligands as a search model. Structure refinements (Table 1) were carried out in REFMAC5⁴² and PHENIX⁴³ interspersed with rounds of manual rebuilding in COOT⁴⁴. The crystal structure of apo-DntR was refined to d_min = 2.64 Å resulting in a model providing R_work = 19.9% and R_free = 22.7%. The crystal structure of H169T-DntR was refined to d_min = 3.30 Å and resulted in a model providing R_work = 18.8% and R_free = 24.0%.

Small-angle X-ray Scattering (SAXS)

SAXS measurements were carried out on ESRF beamline ID14-3⁴⁵ at λ = 0.931 Å or ESRF beamline BM29⁴⁶ at λ = 0.992 Å. Scattering curves were recorded in the momentum transfer range 0.04 < q < 0.61 Å⁻¹ (q = 4π sin (θ)/λ, 2θ is the scattering angle) using a Pilatus 1M detector (Dectris Ltd., Baden, Switzerland). Prior to experiments all solutions were centrifuged at 16,000 xg for 10 minutes to remove aggregated particles. In static SAXS experiments 30 μL of protein solution loaded into a sample capillary using a liquid handling robot were exposed to X-rays and scattering data collected using multiple exposures (see below for details of number and length). Matched buffer measurements taken before and after every sample measurement were averaged and used for background subtraction. Individual exposures were processed automatically and independently using PyFAI⁴⁷ as implemented in the EDNA framework yielding radially averaged curves of normalized intensity versus scattering angle. For each exposure series additional data reduction used the automatic data processing tools of EMBL-Hamburg ATSAS package⁴⁸ to combine individual measurements, exclude any data points affected by aggregation induced by radiation damage and yield an average scattering curve. Merging of scattering curves obtained at different sample concentrations and downstream analysis were performed manually as described in the literature⁴⁹. Here, the forward scattering I(0) and radius of gyration (Rg) were calculated from the Guinier approximation⁵⁰. Particle volume and the maximum particle size (D_max) were determined from the pair distribution function P(r) as computed by GNOM⁵¹ using PRIMUS⁵². Scattering curves from solutions of apo-DntR (buffer as for the stock solution described above) were measured at sample concentrations of 3, 1 and 0.5 mg/mL. For all concentrations, images were recorded using 10 exposures each of 10 seconds and the scattering curves obtained at each concentration scaled and averaged to produce the final solution scattering curve. Ab initio models of the solution shape of apo-DntR were derived from the experimental scattering curve using DAMMIF⁵³, imposing P22 symmetry as well as standard P1. To produce a final molecular envelope 20 independently generated ab initio models were aligned, averaged and filtered using DAMAVER⁵⁴. Theoretical scattering curves of apo-DntR and the TsaR type homology model were calculated and used to generate fits against experimentally-obtained scattering curves using CRYSOL⁵⁵. Rigid body modelling of the model of the solution conformation of apo-DntR was carried out in the program SASREF⁵⁶. Here, using the previously postulated model of the structure of a full-length DntR tetramer⁵ as a basis, the four RDs and two DBD dimers that make up a LTTR tetramer (Fig. 1) were treated as separate rigid entities and their positions refined against the experimental scattering curve employing a connectivity restraint of 3Å between residues T85 and A86 of each DntR monomer. Scattering curves from solutions of apo-H169T-DntR (same buffer as for the stock solution described above) were measured at a sample concentration of 0.7 mg/mL. 10 × 10 frames each of 2 seconds exposure time were recorded and averaged. Given the limited resolution of the scattering curve obtained rigid body modelling of the solution conformation of apo-H169T-DntR was not attempted. The solution shape of holo-DntR was elucidated from a scattering curve obtained from a solution of apo-DntR pre-incubated with 100 μM sodium salicylate. Ab initio models of the solution conformation of holo-DntR were obtained as forapo-DntR with the exception that no symmetry restrictions were imposed. Rigid body modelling of the solution conformation ofholo-DntR was carried out as for apo-DntR. To verify that results obtained from static SAXS experiments using solutions ofapo-DntR and of holo-DntR were not artefacts due to interparticle interactions, experiments were repeated, this time coupled with size exclusion chromatography (SEC, Viscotek RImax, Malvern; Superdex 200 column) immediately prior to sample injection⁵⁷. Solutions were applied to a gel filtration column and the eluent exposed directly to the X-ray beam. For each solution applied to the column 3500 frames were collected. Individual scattering curves yielding similar values of R_g were then processed and averaged. The scattering curves obtained were rather noisy as the concentration of proteins in the eluent is low. Nevertheless, it was possible to obtain satisfactory Guinier regions and P(r) plots from which invariant parameters were derived (Table 2). These are near identical to those obtained in our static SAXS measurements, confirming that models for the solution conformations of apo-DntR and of holo-DntR derived from higher q-range experiments are valid.

Thermofluor assays

Thermofluor assays of solutions of apo-DntR, apo-H169T-DntR andholo-DntR were carried out by the EMBL Grenoble Outstation High Throughput Crystallisation Laboratory (https://embl.fr/htxlab/) a platform of the Grenoble Partnership for Structural Biology (PSB; http://www.psb-grenoble.eu/) using a previously published experimental protocol⁵⁸.

Flow cytometric analysis of whole cell systems

The H169T mutation was introduced to the wild-type DntR gene carried on the plasmid pQEwtdntRHis6:PDNT:gfp using a site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions. E. coli DH5α cells transformed with the plasmids containing pQEwtdntRHis6:PDNT:gfp or pQEH169TdntR:PDNT:gfp as previously described³⁴ were grown overnight in 5 mL LB medium, then inoculated with 1 mL growth media to an OD₆₀₀ of 0.05. After 2 h, 500 μM salicylate in DMSO or only DMSO was added to the cultures. After a further 4 hours cells were taken for Fluorescence-activated Cell Sorting (FACS) analysis performed on a FACS Calibur instrument (BD Biosciences, San Jose, CA, USA). Flow cytometric data were analysed using the FlowJo software and the mean fluorescence intensity for each cell population was measured.

Additional Information

How to cite this article: Lerche, M. et al. The solution configurations of inactive and activated DntR have implications for the sliding dimer mechanism of LysR transcription factors. Sci. Rep.6, 19988; doi: 10.1038/srep19988 (2016).

References

Henikoff, S., Haughn, G. W., Calvo, J. M. & Wallace, J. C. A large family of bacterial activator proteins. Proc Natl Acad Sci USA 85, 6602–6606 (1988).
Article CAS PubMed PubMed Central Google Scholar
Pareja, E. et al. ExtraTrain: a database of Extragenic regions and Transcriptional information in prokaryotic organisms. BMC Microbiol 6, 29 (2006).
Article CAS PubMed PubMed Central Google Scholar
Liu, Z. et al. Vibrio cholerae anaerobic induction of virulence gene expression is controlled by thiol-based switches of virulence regulator AphB. Proc Natl Acad Sci USA 108, 810–815 (2011).
Article CAS PubMed Google Scholar
Momany, C. & Neidle, E. L. Defying stereotypes: the elusive search for a universal model of LysR-type regulation. Mol Microbiol 83, 453–456 (2012).
Article CAS PubMed Google Scholar
Smirnova, I. A. et al. Development of a bacterial biosensor for nitrotoluenes: the crystal structure of the transcriptional regulator DntR. J Mol Biol 340, 405–418 (2004).
Article CAS PubMed Google Scholar
Devesse, L. et al. Crystal structures of DntR inducer binding domains in complex with salicylate offer insights into the activation of LysR-type transcriptional regulators. Molecular Microbiology 81, 354–367 (2011).
Article CAS PubMed Google Scholar
Monferrer, D. et al. Structural studies on the full-length LysR-type regulator TsaR from Comamonas testosteroni T-2 reveal a novel open conformation of the tetrameric LTTR fold. Mol Microbiol 75, 1199–1214 (2010).
Article CAS PubMed Google Scholar
Maddocks, S. E. & Oyston, P. C. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology 154, 3609–3623 (2008).
Article CAS PubMed Google Scholar
Tropel, D. & van der Meer, J. R. Bacterial transcriptional regulators for degradation pathways of aromatic compounds. Microbiol Mol Biol Rev 68, 474–500, table of contents (2004).
Article CAS PubMed PubMed Central Google Scholar
Porrua, O., Garcia-Jaramillo, M., Santero, E. & Govantes, F. The LysR-type regulator AtzR binding site: DNA sequences involved in activation, repression and cyanuric acid-dependent repositioning. Mol Microbiol 66, 410–427 (2007).
Article CAS PubMed Google Scholar
Bundy, B. M., Collier, L. S., Hoover, T. R. & Neidle, E. L. Synergistic transcriptional activation by one regulatory protein in response to two metabolites. Proc Natl Acad Sci USA 99, 7693–7698 (2002).
Article CAS PubMed PubMed Central Google Scholar
Zhou, X. et al. Crystal structure of ArgP from Mycobacterium tuberculosis confirms two distinct conformations of full-length LysR transcriptional regulators and reveals its function in DNA binding and transcriptional regulation. J Mol Biol 396, 1012–1024 (2010).
Article CAS PubMed Google Scholar
Jo, I. et al. Structural details of the OxyR peroxide-sensing mechanism. P Natl Acad Sci USA 112, 6443–6448 (2015).
Article CAS Google Scholar
Muraoka, S. et al. Crystal structure of a full-length LysR-type transcriptional regulator, CbnR: unusual combination of two subunit forms and molecular bases for causing and changing DNA bend. J Mol Biol 328, 555–566 (2003).
Article CAS PubMed Google Scholar
Ruangprasert, A., Craven, S. H., Neidle, E. L. & Momany, C. Full-length structures of BenM and two variants reveal different oligomerization schemes for LysR-type transcriptional regulators. J Mol Biol 404, 568–586 (2010).
Article CAS PubMed Google Scholar
Taylor, J. L. et al. The crystal structure of AphB, a virulence gene activator from Vibrio cholerae, reveals residues that influence its response to oxygen and pH. Mol Microbiol 83, 457–470 (2012).
Article CAS PubMed PubMed Central Google Scholar
Aleshin, A. E. et al. Crystal and Solution Structures of a Prokaryotic M16B Peptidase: an Open and Shut Case. Structure 17, 1465–1475 (2009).
Article CAS PubMed PubMed Central Google Scholar
Krukenberg, K. A., Forster, F., Rice, L. M., Sali, A. & Agard, D. A. Multiple conformations of E-coli Hsp90 in solution: Insights into the conformational dynamics of Hsp90. Structure 16, 755–765 (2008).
Article CAS PubMed PubMed Central Google Scholar
Liu, X. et al. Structural insights into the interaction of IL-33 with its receptors. P Natl Acad Sci USA 110, 14918–14923 (2013).
Article CAS Google Scholar
Rambo, R. P. & Tainer, J. A. Bridging the solution divide: comprehensive structural analyses of dynamic RNA, DNA and protein assemblies by small-angle X-ray scattering. Curr Opin Struc Biol 20, 128–137 (2010).
Article CAS Google Scholar
Arnold, K., Bordoli, L., Kopp, J. & Schwede, T. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195–201 (2006).
Article CAS PubMed Google Scholar
Wang, L. & Winans, S. C. The sixty nucleotide OccR operator contains a subsite essential and sufficient for OccR binding and a second subsite required for ligand-responsive DNA bending. J Mol Biol 253, 691–702 (1995).
Article CAS PubMed Google Scholar
Toledano, M. B. et al. Redox-dependent shift of OxyR-DNA contacts along an extended DNA-binding site: a mechanism for differential promoter selection. Cell 78, 897–909 (1994).
Article CAS PubMed Google Scholar
Lu, X. J. & Olson, W. K. 3DNA: a software package for the analysis, rebuilding and visualization of three-dimensional nucleic acid structures. Nucleic Acids Res 31, 5108–5121, 10.1093/nar/gkg680 (2003).
Article CAS PubMed PubMed Central Google Scholar
Alanazi, A. M., Neidle, E. L. & Momany, C. The DNA-binding domain of BenM reveals the structural basis for the recognition of a T-N-11-A sequence motif by LysR-type transcriptional regulators. Acta Crystallogr D 69, 1995–2007, 10.1107/S0907444913017320 (2013).
Article CAS PubMed Google Scholar
Porrua, O., Platero, A. I., Santero, E., del Solar, G. & Govantes, F. Complex interplay between the LysR-type regulator AtzR and its binding site mediates atzDEF activation in response to two distinct signals. Molecular Microbiology 76, 331–347, 10.1111/j.1365-2958.2010.07100.x (2010).
Article CAS PubMed Google Scholar
Hryniewicz, M. M. & Kredich, N. M. The cysP promoter of Salmonella typhimurium: characterization of two binding sites for CysB protein, studies of in vivo transcription initiation and demonstration of the anti-inducer effects of thiosulfate. J Bacteriol 173, 5876–5886 (1991).
Article CAS PubMed PubMed Central Google Scholar
Huang, J. Z. & Schell, M. A. In vivo interactions of the NahR transcriptional activator with its target sequences. Inducer-mediated changes resulting in transcription activation. J Biol Chem 266, 10830–10838 (1991).
CAS PubMed Google Scholar
Ogawa, N., McFall, S. M., Klem, T. J., Miyashita, K. & Chakrabarty, A. M. Transcriptional activation of the chlorocatechol degradative genes of Ralstonia eutropha NH9. J Bacteriol 181, 6697–6705 (1999).
CAS PubMed PubMed Central Google Scholar
Swigon, D., Coleman, B. D. & Olson, W. K. Modeling the Lac repressor-operator assembly: The influence of DNA looping on Lac repressor conformation. P Natl Acad Sci USA 103, 9879–9884, 10.1073/pnas.0603557103 (2006).
Article CAS Google Scholar
Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F. & Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 angstrom resolution. Nature 389, 251–260 (1997).
Article CAS PubMed Google Scholar
Vafabakhsh, R. & Ha, T. Extreme Bendability of DNA Less than 100 Base Pairs Long Revealed by Single-Molecule Cyclization. Science 337, 1097–1101, 10.1126/science.1224139 (2012).
Article CAS PubMed PubMed Central Google Scholar
Wang, L., Helmann, J. D. & Winans, S. C. The a-Tumefaciens Transcriptional Activator Occr Causes a Bend at a Target Promoter, Which Is Partially Relaxed by a Plant Tumor Metabolite. Cell 69, 659–667, 10.1016/0092-8674(92)90229-6 (1992).
Article CAS PubMed Google Scholar
Lonneborg, R. & Brzezinski, P. Factors that influence the response of the LysR type transcriptional regulators to aromatic compounds. BMC Biochem 12, 49 (2011).
Article CAS PubMed PubMed Central Google Scholar
Tsai, C. S., Chen, C. S. & Winans, S. C. Most Mutant OccR Proteins That Are Defective in Positive Control Hold Operator DNA in a Locked High-Angle Bend. J Bacteriol 193, 5442–5449, 10.1128/Jb.05352-11 (2011).
Article CAS PubMed PubMed Central Google Scholar
de Sanctis, D. et al. ID29: a high-intensity highly automated ESRF beamline for macromolecular crystallography experiments exploiting anomalous scattering. J Synchrotron Radiat 19, 455–461 (2012).
Article CAS PubMed Google Scholar
Nurizzo, D. et al. The ID23-1 structural biology beamline at the ESRF. J Synchrotron Radiat 13, 227–238 (2006).
Article CAS PubMed Google Scholar
Kabsch, W. Xds. Acta Crystallogr D Biol Crystallogr 66, 125–132 (2010).
Article CAS PubMed PubMed Central Google Scholar
Evans, P. An introduction to data reduction: space-group determination, scaling and intensity statistics. Acta Crystallographica Section D 67, 282–292 (2011).
Article CAS Google Scholar
French, S. & Wilson, K. On the treatment of negative intensity observations. Acta Crystallographica Section A 34, 517–525 (1978).
Article Google Scholar
McCoy, A. J. et al. Phaser crystallographic software. J Appl Crystallogr 40, 658–674 (2007).
Article CAS PubMed PubMed Central Google Scholar
Murshudov, G. N. et al. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr D Biol Crystallogr 67, 355–367 (2011).
Article CAS PubMed PubMed Central Google Scholar
Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213–221 (2010).
Article CAS PubMed PubMed Central Google Scholar
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallographica Section D 66, 486–501 (2010).
Article CAS Google Scholar
Pernot, P. et al. New beamline dedicated to solution scattering from biological macromolecules at the ESRF. Xiv International Conference on Small-Angle Scattering (Sas09) 247 (2010).
Pernot, P. et al. Upgraded ESRF BM29 beamline for SAXS on macromolecules in solution. J Synchrotron Radiat 20, 660–664 (2013).
Article CAS PubMed PubMed Central Google Scholar
Kieffer, J. & Karkoulis, D. PyFAI, a versatile library for azimuthal regrouping. J Phys Conf Ser 425 (2013).
Konarev, P. V., Petoukhov, M. V., Volkov, V. V. & Svergun, D. I. ATSAS 2.1, a program package for small-angle scattering data analysis. J Appl Crystallogr 39, 277–286 (2006).
Article CAS Google Scholar
Putnam, C. D., Hammel, M., Hura, G. L. & Tainer, J. A. X-ray solution scattering (SAXS) combined with crystallography and computation: defining accurate macromolecular structures, conformations and assemblies in solution. Quarterly Reviews of Biophysics 40, 191–285 (2007).
Article CAS PubMed Google Scholar
Guinier, A. The diffusion of x-rays under the extremely weak angles applied to the study of fine particles and colloidal suspension. Cr Hebd Acad Sci 206, 1374–1376 (1938).
CAS Google Scholar
Svergun, D. I. Determination of the Regularization Parameter in Indirect-Transform Methods Using Perceptual Criteria. J Appl Crystallogr 25, 495–503 (1992).
Article CAS Google Scholar
Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J. & Svergun, D. I. PRIMUS: a Windows PC-based system for small-angle scattering data analysis. J Appl Crystallogr 36, 1277–1282 (2003).
Article CAS Google Scholar
Franke, D. & Svergun, D. I. DAMMIF, a program for rapid ab-initio shape determination in small-angle scattering. J Appl Crystallogr 42, 342–346 (2009).
Article CAS PubMed PubMed Central Google Scholar
Volkov, V. V. & Svergun, D. I. Uniqueness of ab initio shape determination in small-angle scattering. J Appl Crystallogr 36, 860–864 (2003).
Article CAS Google Scholar
Svergun, D., Barberato, C. & Koch, M. H. J. CRYSOL - A program to evaluate x-ray solution scattering of biological macromolecules from atomic coordinates. J Appl Crystallogr 28, 768–773 (1995).
Article CAS Google Scholar
Petoukhov, M. V. & Svergun, D. I. Global rigid body modeling of macromolecular complexes against small-angle scattering data. Biophys J 89, 1237–1250 (2005).
Article CAS PubMed PubMed Central Google Scholar
Round, A. et al. Determination of the GH3.12 protein conformation through HPLC-integrated SAXS measurements combined with X-ray crystallography. Acta Crystallogr D Biol Crystallogr 69, 2072–2080 (2013).
Article CAS PubMed Google Scholar
Dupeux, F., Rower, M., Seroul, G., Blot, D. & Marquez, J. A. A thermal stability assay can help to estimate the crystallization likelihood of biological samples. Acta Crystallogr D Biol Crystallogr 67, 915–919 (2011).
Article CAS PubMed Google Scholar
Weiss, M. S. Global indicators of X-ray data quality. J Appl Crystallogr 34, 130–135 (2001).
Article CAS Google Scholar
Karplus, P. A. & Diederichs, K. Linking Crystallographic Model and Data Quality. Science 336, 1030–1033, 10.1126/science.1218231 (2012).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Drs Christoph Mueller-Dieckmann and Montserrat Soler Lopez for critical readings of the manuscript. This work was supported by grants from the Swedish Research Council and the award of an ESRF PhD Studentship to M.L.

Author information

Cyril Dian
Present address: CNRS, Institut des Sciences du Végétal, 1 Avenue de la Terrasse, Bât 23A, F-91198, Gif sur Yvette, France
Rosa Lönneborg
Present address: School of Education and Communication in Engineering Science (ECE), KTH Royal Institute of Technology, SE-100 44, Stockholm, Sweden

Authors and Affiliations

Structural Bioloy Group, European Synchrotron Radiation Facility (ESRF), CS 40220, Grenoble, Cedex 9, 38043, France
Michael Lerche & Gordon A. Leonard
Institut de Biologie Structurale Jean-Pierre Ebel, 71 avenue des Martyrs, CS 10090, Grenoble, Cedex 9, 38044, France
Cyril Dian
European Molecular Biology Laboratory, Grenoble Outstation, Grenoble, Cedex 9, 38042, France
Adam Round
Unit for Virus Host-Cell Interactions, University Grenoble Alpes-EMBL-CNRS, Grenoble, Cedex 9, 38042, France
Adam Round
Department of Biochemistry and Biophysics, Arrhenius Laboratories for Natural Sciences, Stockholm University, SE-106 91, Stockholm, Sweden
Rosa Lönneborg & Peter Brzezinski

Authors

Michael Lerche
View author publications
You can also search for this author in PubMed Google Scholar
Cyril Dian
View author publications
You can also search for this author in PubMed Google Scholar
Adam Round
View author publications
You can also search for this author in PubMed Google Scholar
Rosa Lönneborg
View author publications
You can also search for this author in PubMed Google Scholar
Peter Brzezinski
View author publications
You can also search for this author in PubMed Google Scholar
Gordon A. Leonard
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

G.A.L., C.D. and P.B. conceived the study. M.L., C.D. and G.A.L. performed X-ray crystallography and analysed the data. M.L. and A.R. performed SAXS experiments and, along with C.D. analysed the data. R.L. performed the flow cytometric analysis and analysed the data. M.L., C.D. and G.A.L. wrote the manuscript. All authors reviewed the manuscript.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Rights and permissions

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and permissions

About this article

Cite this article

Lerche, M., Dian, C., Round, A. et al. The solution configurations of inactive and activated DntR have implications for the sliding dimer mechanism of LysR transcription factors. Sci Rep 6, 19988 (2016). https://doi.org/10.1038/srep19988

Download citation

Received: 23 July 2015
Accepted: 21 December 2015
Published: 28 January 2016
DOI: https://doi.org/10.1038/srep19988

This article is cited by

Functional and structural analysis of catabolite control protein C that responds to citrate
- Wei Liu
- Jinli Chen
- Yongbin Xu
Scientific Reports (2021)
A novel 3-hydroxypropionic acid-inducible promoter regulated by the LysR-type transcriptional activator protein MmsR of Pseudomonas denitrificans
- Nam Hoai Nguyen
- Satish Kumar Ainala
- Sunghoon Park
Scientific Reports (2019)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.