Research articleExpression profiling of various genes during the fruit development and ripening of mango
Introduction
Fruit development and ripening are genetically as well as biochemically and physiologically programmed processes. During the development, fruit acts as a sink and grows by accumulating the in-flown material, while ripening is characterized by textural and rheological changes. Cell expansion and softening by cell-wall solubilization, dismantling of the photosynthetic apparatus, degradation of starch and chlorophyll and respiratory and/or ethylene-climacteric are some of the major events of the ripening process [39].
These maturation and ripening events have been probed using a handful of genes, picked either using differential expression studies or by mining the expressed sequence tags (ESTs). Such work is known from several fruits like strawberry [2], melons [22], pineapple [21], and banana [18]. From these attempts, we understand that most of the physiological processes involved in development and ripening of the fruit are specific to this propagule carrying organ. However, fruit's transcriptome reveals the expression of only few organ specific genes. Instead of using completely new set of genes, fruits express the usual plant transcriptome with their own reorganizations in the expression cascades [2]. These observations are valid for both, climacteric and non-climacteric fruits. Roles of several such plant genes have been justified in view of fruit physiology, whereas for many they still remain to be understood.
Among the tropical fruits, mango (Mangifera indica L., Anacardiaceae), is the most popular one and Alphonso is its most favorite cultivar; it is also the most exported mango cultivar of India. It has gained a worldwide popularity [33] because of its delightful flavor, attractive color, ample, sweet, low fiber containing pulp and long shelf life. In spite of possessing so many virtues, it is onerous for farmers due to its erratic and shy bearing, cultivation locality dependent and environment-governed variation in the fruit quality, susceptibility to fungal pathogens and insect pests, and physiological disorders like spongy tissue [33], [36]. To understand the basis of such demerits, first of all the knowledge of biochemistry and molecular biology of fundamental metabolic processes underlying the development and ripening of mango is necessary and most importantly, the markers for the determination of important development and ripening stages such as harvesting maturity, exact ripeness are required. We initiated a program to generate this knowledge and in this direction, earlier we reported the chemistry of these processes and demonstrated that the volatile profiles vary remarkably through the fruit life; in fact, volatiles were proposed to be the useful indicators of development and ripening [26]. A step further, in the present work we hypothesized that the dynamic biochemistry of these fundamental processes of fruit is the function of transcriptomic changes and expression levels of various genes can also be the indicators of the advancement of these processes.
It is known that terpenoids are the dominant compounds throughout the life of mango fruit [26], [29], [25]. More importantly, they also display dynamic qualitative as well as quantitative changes along with the progress of development and ripening [26]. Therefore, we selected to analyze the transcriptional dynamics of the terpene metabolism related genes in the present work. Glucosyltransferase (GT) and isochorismate hydrolase (IsoCH) genes, which are responsible for the further modification of terpene products was considered along with the terpene biosynthesis pathway related genes. Secondly, in our pilot experiments for tracking the transcriptomic changes by differential display RT-PCR (DDRT-PCR) [17], we found that the abundance of several transcripts sharply varied between the early and late ripening stages (data not shown); earlier based on their volatile emissions, these stages were reported to be the critical ones for the determination of fruit quality [26]. These transcripts corresponded to numerous and functionally diverse genes that have never been reported from mango. However, these genes were often reported in the transcriptomic analyses of several fruits [2]. This prompted us to test if their expression profiles correlate with each other and, whether all of them indicate the important stages of mango development and ripening. These genes involved monodehydrogenase ascorbate reductase (MDHAR) that helps to maintain the antioxidant homeostasis during the rapid cellular activities in the fruit. Among the abiotic stress related genes, metallothionin (MT) and 14–3–3 were the multifunctional, signal transduction related genes, whereas methyltransferase (MeTr) and low molecular weight/ small heat shock protein (sHSP) were the ones involved in the management of temperature stress. Lipoxygenase (LOX), chitinase and cysteine protease inhibitor (CysPI) genes were the contributors of biotic stress management. A transcription factor involved in ethylene response (ERF) and a ubiquitin-protein ligase (UbqPL) that manages the protein turnover were also profiled.
Consequently, we studied the temporal (during the development and ripening of fruit) dynamics of expression of these 18 assorted genes in Alphonso. Our earlier work also unveiled a positive correlation between the volatile profiles of developing and ripening fruits to those of leaf and flower [26]. There is no further information available on this phenomenon in mango; therefore, to find whether such correlation also exists between the patterns of gene expression in these tissues, we opted to analyze the spatial (in leaf, flower and fruit) regulation of the expression of these genes. To elucidate the expression profiles of these genes and establish the comparisons between different tissues, we applied the principle of relative quantitation of transcripts [26].
Section snippets
Results and discussion
Fruits are fathomed mainly by their flavor and color. Flavor, the combination of aroma, taste and texture [32], is an important criterion in deciding the market value of any fruit, when different varieties or cultivars are available for comparison. Often, volatiles comprise the major part of flavor and impart the distinguishable characters to it. Mango presents a unique example, where each cultivar shows high odorant diversity; in addition, the concentrations of these compounds have been found
Conclusion
Overall, this analysis revealed the temporal and spatial regulation of the analyzed genes during the development and ripening of Alphonso mango. Zeroing down of the expression of many genes at 2DAH stage advocated our a priori hypothesis about the ‘zero day’ stage that 90DAP fruit upon harvesting may carry the continuation of in planta processes and therefore, can be regarded as ‘virtual’ zero day, whereas within two days, almost complete halting of in planta processes may take place to
Plant material
Alphonso fruit matures in about 90 days after the fruit-set and ripens in further 15 to 20 days when harvested and incubated at 28°C [26]. Therefore, fruits of 5, 15, 30, 60 and 90 days after pollination (DAP) and of 2, 5, 10, 15 and 20 days after harvesting (DAH) were collected from the orchards of the Regional Fruit Research Station (RFRS) of Dr. Balasaheb Savant Kokan Krishi Vidyapeeth [(DBSKKV) (Dr. Balasaheb Savant Kokan Agricultural University)], at Deogad (Maharashtra, India). According
Acknowledgements
This work was funded by DSIR (NWP P23 CMM0002); Sagar S. Pandit and Ram S. Kulkarni thank CSIR, for fellowships.
References (40)
- et al.
Glycosyltransferases: managers of small molecules
Curr. Opin. Plant Biol.
(2005) - et al.
RNA methylation under heat shock control
Mol. Cell
(2000) - et al.
The secondary metabolism of Arabidopsis thaliana: growing like a weed
Curr. Opin. Plant Biol.
(2005) - et al.
Antioxidant activity and oxygen-scavenging system in orange pulp during fruit ripening and maturation
Sci. Hortic. Amersterdam
(2007) - et al.
Plant 14–3–3 proteins catch up with their mammalian orthologs
Curr. Opin. Plant Biol.
(2009) - et al.
Cultivar relationships in mango based on fruit volatile profiles
Food Chem.
(2009) Metabolome diversity: too few genes, too many metabolites?
Phytochemistry
(2003)- et al.
Novel analytical tools for food flavours
Food Res. Int.
(2000) - et al.
Cloning and characterization of differentially expressed genes of internal breakdown in mango fruit (Mangifera indica L.) cv. Alphonso
J. Plant Physiol.
(2006) - et al.
Gain and loss of fruit flavor compounds produced by wild and cultivated strawberry species
Plant Cell
(2004)
Gene expression analysis of strawberry achene and receptacle maturation using DNA microarrays
J. Exp. Bot.
Protein prenylation: mad bet for Rab
Nature
Differential gene expression in ripening banana fruit
Plant Physiol.
Differential screening indicates a dramatic change in mRNA profiles during grape berry ripening. Cloning and characterization of cDNAs encoding putative cell wall and stress response proteins
Plant Physiol.
The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers
Proc. Natl. Acad. Sci. U.S.A.
What's new in chitinase research?
Experientia
Production locality affects mango fruit quality
Aus. J. Exp. Agric.
Changes in oxidative processes and components of the antioxidant system during tomato fruit ripening
Planta
Plant chitinases – regulation and function
Cell. Mol Biol. Lett.
Distribution of aroma volatile compounds in different parts of mango fruit
J. Hortic. Sci. Biotechnol.
Cited by (57)
Phosphomevalonate kinase regulates the MVA/MEP pathway in mango during ripening
2023, Plant Physiology and BiochemistryOmics of mango: A tropical fruit tree
2022, Omics in Horticultural CropsData on metabolic profiling of spongy tissue disorder in Mangifera indica cv. Alphonso
2019, Data in BriefCitation Excerpt :Quantitative real-time PCR was performed using the Fast Start Universal SYBR Green master mix (Roche Inc. Indianapolis, Indiana, USA) and elongation factor 1α (EF1α) as an endogenous reference gene for which primers were reported earlier [9]. Hydroperoxide lyase gene was amplified using gene specific primers (MiHPL_F1 CGTCCTTGACATTCTGAAACGC and MiHPL_R1 CCTTCGCAGAGATGCTTGTTTC) covering amplicon size of 100 bp.
- 1
Present address: Department of Molecular Ecology, Max Planck Institute for Chemical Ecology, Jena, Germany.