In-solution behavior and protective potential of asparagine synthetase A from Trypanosoma cruzi
Introduction
l-Asparagine synthetase (EC 6.3.1.1) catalyzes the synthesis of l-asparagine from l-aspartate and ammonia upon ATP hydrolysis to AMP and PPi [1,2]. Enzymatic classification divides these enzymes into two families: asparagine synthetase A (AS-A) or asparagine synthetase B (AS-B), with AS-A being found in prokaryotes [[3], [4], [5], [6]] and AS-B being found in eukaryotes [[7], [8], [9], [10]]. Distinct from the majority of eukaryotes, Leishmania and Trypanosoma possess both AS-A and AS-B [11]. Moreover, while AS-A of other organisms are described as strictly ammonia dependent, the AS-A of Trypanosoma cruzi (Tc-AS-A, GenBank XP_812804), a causative agent of Chagas disease, was reported to use glutamine as a nitrogen donor [11]. The ability of using both glutamine and ammonia as nitrogen donors was only previously demonstrated for AS-B enzymes [[12], [13], [14], [15], [16]].
In Latin America, the infection of approximately 8 million people with the neglected Chagas disease placed this region among the endemic areas, where the mortality rate is approximately 10,000 people/year. In addition, more than 25 million people are at risk of infection [17]. Population movement spreads the disease from Latin America to other continents. In the United States of America, it is estimated that approximately 300,000 resident immigrants are infected by T. cruzi [18].
Currently, treatment is most effective in the acute phase of the disease, chronic infections of children under 12 years, congenital infections and laboratory accidents [19]. In addition to not being effective for all patients, drugs also have many side effects, such as hypersensitivity reactions and neuropathies. The treatment is not suitable for pregnant women; patients with systemic infections or heart, respiratory, renal or hepatic failure; untreatable homeopathies and neoplasms; or elderly or very debilitated people [19,20]. Thus, advances in Chagas treatment have been expected for a while.
Tc-AS-A has features that define a good target such as its presence in the parasite but not in the host and its unique biochemical behavior. However, it is indispensable to understand the enzyme functioning to define a better strategy to affect parasite viability through Tc-AS-A. This is especially due to the apparent parasite’s ability to grow using asparagine from the extracellular environment when the levels of AS-A are minimum [11]. Recent work with Trypanosoma brucei AS-A (Tb-AS-A) showed that only a combined therapy using both a Tb-AS-A inhibitor and an extracellular asparagine depletor (e.g., l-asparaginase) or an asparagine transport blocker could inhibit parasite growth [11]. However, a combined therapy could be too expensive and logistically inappropriate for the treatment of African trypanosomiasis [11]. However, whether the same profile would be necessary for the treatment of Chagas disease remains to be established.
In this work, Tc-AS-A was produced as recombinant and purified, and its structure was evaluated by circular dichroism, dynamic light scattering and analytical size exclusion chromatography. Our results indicate that α-β contents were preserved in recombinant expression and that the overall charge of the neutralizing enzyme might be important for its stability and quaternary arrangement. Moreover, Tc-AS-A is a dimer in solution similar to other AS-As. We also analyzed the protective effect of Tc-AS-A immunization. BALB/c mice were immunized with formulations containing Tc-AS-A and later infected with T. cruzi trypomastigotes. Our results indicate that immunization with Tc-AS-A might confer partial protection to infective forms of T. cruzi in this particular model.
Section snippets
Protein cloning and expression
The Tc-AS-A coding sequence was amplified by PCR from the T. cruzi Dm28c genome using the following oligonucleotide primers: Tc-AS-A_F (5 GCTAGCGCTTTTATTCAGCTGCAAGAGCAG) and Tc-AS-A_R (5’ AAGCTTTTA
CAGCAATGGATAATTCTGGCG). The PCR product was cloned into pGEM-T-easy vector and validated by sequencing. The recombinant plasmid pGEM-Tc-AS-A was digested with NheI and HindIII enzymes for subcloning into the pET28a expression vector (Qiagen). His6-tagged recombinant protein was produced in the
Recombinant Tc-AS-A is dimeric and stable in acidic environments
Purified recombinant Tc-AS-A, a protein of 42 kDa, (Fig. 1A-B) presented 23.6% polydispersity (Table 1), indicating a certain degree of structural heterogeneity. The protein was then dialyzed against buffers with different pH values to screen for a condition where the sample became monodisperse. Tc-AS-A monodispersity was achieved in acidic environments (pH ≤ 7, Table 1).
CD data indicated that Tc-AS-A is composed of alpha-helix and beta-strain structures, as observed from the circular dichroism
Conclusions
This work showed that Tc-AS-A is stable and dimeric in acidic environments. The overall charge of the neutralizing enzyme might be important for Tc-AS-A stability and quaternary arrangement. Indeed, our structural inspection showed that the recombinant Tc-AS-A structure is dimeric, similar to other AS-As, and is stable in features that greatly resemble prokaryotic AS-A, although biochemical peculiarities of Tc-AS-A have been previously reported.
Surprisingly, immunization with Tc-AS-A might
Financial support
This work was supported by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and FIOCRUZ.
Author contributions
FSM, SBM and EC conducted most of the experiments. AVPW performed recombinant expression. CLC performed immunologic analyses. MTM, PPF, SFYO and TACBS contributed to the experimental design, provided technical assistance and wrote the paper together with other authors.
Competing interests
All authors declare they have no conflict of interest.
References (49)
17. Asparagine synthesis
The Enzymes
(1974)- et al.
Crystal structure of the archaeal asparagine synthetase: interrelation with aspartyl-tRNA and asparaginyl-tRNA synthetases
J. Mol. Biol.
(2011) - et al.
Nucleotide sequence of Escherichia coli asnB and deduced amino acid sequence of asparagine synthetase B
J. Biol. Chem.
(1990) - et al.
Expression of human asparagine synthetase in Escherichia coli
J. Biol. Chem.
(1989) - et al.
Glutamine-dependent nitrogen transfer in Escherichia coli asparagine synthetase B. Searching for the catalytic triad
J. Biol. Chem.
(1994) - et al.
A kinetic comparison of asparagine synthetase isozymes from higher plants
Plant Physiol. Biochem. PPB.
(2011) - et al.
Glutamine-dependent asparagine synthetase from leukemia cells. Chloride dependence, mechanism of action, and inhibition
J. Biol. Chem.
(1972) - et al.
Asparagine biosynthesis by the Novikoff Hepatoma isolation, purification, property, and mechanism studies of the enzyme system
J. Biol. Chem.
(1968) - et al.
Toxic and therapeutic effects of Nifurtimox and Benznidazol on Trypanosoma cruzi ex vivo infection of human placental chorionic villi explants
Acta Trop.
(2014) - et al.
A factor preventing the major head protein of bacteriophage T4 from random aggregation
J. Mol. Biol.
(1970)
Identification and functional characterization of a novel bacterial type asparagine synthetase a: a tRNA SYNTHETASE PARALOG FROM LEISHMANIA DONOVANI
J. Biol. Chem.
Trypanosoma cruzi: IL-10, TNF, IFN-gamma, and IL-12 regulate innate and acquired immunity to infection
Exp. Parasitol.
Parasite polyclonal activators: new targets for vaccination approaches?
Int. J. Parasitol.
Acute Trypanosoma cruzi infection is associated with anemia, thrombocytopenia, leukopenia, and bone marrow hypoplasia: reversal by nifurtimox treatment
Microbes Infect. Inst. Pasteur.
Role of the antibody Fc in the immune clearance of Trypanosoma cruzi
Immunol. Lett.
Overexpression and purification of asparagine synthetase from Escherichia coli
Biosci. Biotechnol. Biochem.
Genetic and biomedical studies demonstrating a second gene coding for asparagine synthetase in Escherichia coli
J. Bacteriol.
Asparagine synthetases of Klebsiella aerogenes: properties and regulation of synthesis
J. Bacteriol.
Crystallization and preliminary X-ray diffraction data of an archaeal asparagine synthetase related to asparaginyl-tRNA synthetase
Acta Crystallogr. D Biol. Crystallogr.
Molecular cloning and expression of two cDNAs encoding asparagine synthetase in soybean
Plant Mol. Biol.
Unusual domain architecture of aminoacyl tRNA synthetases and their paralogs from Leishmania major
BMC Genomics
Knockdown of asparagine synthetase A renders Trypanosoma brucei auxotrophic to asparagine
PLoS Negl. Trop. Dis.
Synthesis and activation of asparagine in asparagine auxotrophs of Saccharomyces cerevisiae
Eur. J. Biochem.
WHO, Chagas disease. 2017
Cited by (1)
Enhancing L-Asparagine Bioproduction Efficiency Through L-Asparagine Synthetase and Polyphosphate Kinase-Coupled Conversion and ATP Regeneration
2024, Applied Biochemistry and Biotechnology
- 1
Authors contributed equally to this work.