VITO-2, a new SID domain protein, is expressed in the myogenic lineage during early mouse embryonic development
Section snippets
VITO-2 is a new member of the SID containing-family of proteins
Transcriptional control of expression of skeletal muscle-specific genes is mediated by different cis-acting elements, which bind different classes of transcription factors. Certain groups of DNA binding proteins such as the MyoD family of transcription factors (Braun et al., 1992a, Braun et al., 1990, Weintraub et al., 1991) that activate muscle-specific genes show an exclusive or preferential expression in skeletal muscle cells. Alternatively, some transcription factors that control muscles
Plasmids
Selected EST clones were ordered from RZPD Deutsches Ressourcenzentrum für Genomforschung GmbH. In addition, VITO-2 was amplified by RT-PCR using the primers FOR- ATGAGTTGTGCGGAGGTGATG and REV- GTACCAAGTTGATTCTTTGCTC and RNA isolated from embryos at E11.5 and cloned into the TOPO 2.1 vector (Invitrogen) followed by sequencing with ABI 310 Genetic Analyzer sequencer (Perkin Elmer).
RT-PCR
For RT-PCR, the total RNA was extracted with the Trizol™ reagent according to manufacturer’s protocol (Invitrogen).
Acknowledgements
The authors are grateful to Prof. Achim Gossler (Medical University, Hannover, Germany) for the grateful gift of Dll-1 mutant embryos. We thank Marion Wiesnet for supplying isolated adult cardiomyocytes, Dr. Sawa Kostin for help with histological analysis and Sonja Krueger for help with in situ hybridizations. This work was supported by the Max-Planck-Society, the EU Commisson (MYORES network of excellence), and the Excellence Cluster Cardiopulmonary System. The authors declare that they have
References (26)
- et al.
Functional interaction between the p160 coactivator proteins and the transcriptional enhancer factor family of transcription factors
J. Biol. Chem.
(2000) - et al.
Targeted inactivation of the muscle regulatory gene Myf-5 results in abnormal rib development and perinatal death
Cell
(1992) - et al.
Vgl-4, a novel member of the vestigial-like family of transcription cofactors, regulates alpha1-adrenergic activation of gene expression in cardiac myocytes
J. Biol. Chem.
(2004) - et al.
A novel family of developmentally regulated mammalian transcription factors containing the TEA/ATTS DNA binding domain
J. Biol. Chem.
(1996) A Sveinsson’s chorioretinal atrophy-associated missense mutation in mouse Tead1 affects its interaction with the co-factors YAP and TAZ
Biochem. Biophys. Res. Commun.
(2007)- et al.
Mammalian vestigial-like 2, a cofactor of TEF-1 and MEF2 transcription factors that promotes skeletal muscle differentiation
J. Biol. Chem.
(2002) - et al.
Vestigial-like-2b (VITO-1b) and Tead-3a (Tef-5a) expression in zebrafish skeletal muscle, brain and notochord
Gene Expr. Patterns
(2007) - et al.
VITO-1, a novel vestigial related protein is predominantly expressed in the skeletal muscle lineage
Mech. Dev.
(2002) - et al.
A novel family of TEA domain-containing transcription factors with distinct spatiotemporal expression patterns
Biochem. Biophys. Res. Commun.
(1996) - et al.
The Aspergillus nidulans abaA gene encodes a transcriptional activator that acts as a genetic switch to control development
Mol. Cell. Biol.
(1994)
Transient and restricted expression during mouse embryogenesis of Dll-1, a murine gene closely related to Drosophila Delta
Development
Transcriptional activation domain of the muscle-specific gene-regulatory protein myf5
Nature
Inhibition of muscle differentiation by the adenovirus E1a protein: repression of the transcriptional activating function of the HLH protein Myf-5
Genes Dev.
Cited by (27)
Intracellular Role for the Matrix-Modifying Enzyme Lox in Regulating Transcription Factor Subcellular Localization and Activity in Muscle Regeneration
2020, Developmental CellCitation Excerpt :Here, we identify an additional enzymatic role for Lox, demonstrating that on top of its classical roles in the ECM, Lox also acts autonomously within muscle progenitor cells to regulate their differentiation. We find that Lox binds and oxidizes the transcriptional co-activator Vestigial Like 3 (Vgll3) (also known as Vito-2; Mielcarek et al., 2009) that is required for activating myocyte enhancer factor 2 (Mef2) and transcriptional enhancer factor (TEF) (also known as TEAD) target genes during myogenic differentiation (Figeac et al., 2019; Günther et al., 2004; Joshi et al., 2017; Maeda et al., 2002; Pobbati et al., 2012). This oxidation regulates Vgll3 nuclear translocation enabling myogenic differentiation.
Vestigial-like 3 is an inhibitor of adipocyte differentiation
2013, Journal of Lipid ResearchCitation Excerpt :Previous reports have suggested that members of this protein family are associated with muscle development and function (22, 23). For example, Vgll3 has been reported to be expressed in developing muscle tissues of the mouse embryo (24). We showed that the suppression of adipogenesis by Vgll3 was accompanied by the induction of a panel of genes associated with other mesenchymal cell fates, including bone and cartilage.
Biallelic truncating variants in VGLL2 cause syngnathia in humans
2023, Journal of Medical Genetics
- 1
Current address: Department of Medical and Molecular Genetics, King’s College London School of Medicine, Great Maze Pond, London SE1 9RT, UK.
- 2
Current address: Molecular Haematology and Cancer Biology, Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK.