The pathogenic neisseriae contain an inactive rpoN gene and do not utilize the pilE σ54 promoter
Introduction
Type 4 pili synthesized by the pathogenic neisserial species, Neisseria gonorrhoeae and Neisseria meningitidis, have been shown to be essential for the initial attachment to human epithelial and endothelial cells (McGee et al., 1981; Virji et al., 1992). Since the original cloning and sequencing of the gene encoding the N. gonorrhoeae pilin subunit, pilE, there has been considerable interest in the transcriptional regulation of this gene. Upstream of the major pilE transcription start site are two overlapping consensus promoter sequences, one for a σ70 promoter (P1), and the other for a σ54-dependent promoter (P3) (Fyfe et al., 1995). An additional σ70 promoter (P2) is located downstream of these two promoters. Genes transcribed from σ70 promoters may or may not be subject to regulation, whereas transcription from σ54-dependent promoters absolutely requires both the alternative σ factor (RpoN) and an activator protein, which generally binds to an upstream activator site (UAS) (Merrick, 1993). On the basis of results obtained from the transcriptional analysis of the Pseudomonas aeruginosa pilA gene (Ishimoto and Lory, 1989), it was reported that transcription of pilE in N. gonorrhoeae was σ54-dependent (Thony and Hennecke, 1989). When expressed in an Escherichia coli strain containing an intact rpoN gene, but lacking an appropriate activator protein, transcription from the σ70 promoter P1 is repressed by the competitive binding of RpoN to the overlapping promoter sequence (Boyle-Vavra et al., 1993; Fyfe et al., 1995). Transcription from the σ54 promoter can take place in E. coli in the presence of the cloned nifA gene (Boyle-Vavra et al., 1993), and also in P. aeruginosa where PilR (the activator protein required for the σ54-dependent transcription of the pilA gene), is able to bind to a sequence approximately 100 nt upstream of the pilE promoter (Fyfe et al., 1995; Carrick et al., 1997). Klimpel et al. (1989)identified a 90-kDa gonococcal protein which co-purified with RNA polymerase, and reacted with a monoclonal antibody raised against the Salmonella typhimurium RpoN. However, it was later shown that pilE transcription in N. gonorrhoeae strain MS11-A, at least when grown in vitro, was independent of the σ54 promoter. Site-directed mutagenesis of the −24 box had no effect on the expression of a PpilE::cat transcriptional fusion, when compared with a similar construct with all the promoters intact (Fyfe et al., 1995). This observation suggested that under these growth conditions, the putative gonococcal RpoN was either not produced, or was unable to bind to the promoter.
In this study, we report evidence that the pathogenic neisseria do not produce a functional RpoN. A transcriptional fusion of the pilE promoter to lacZ, with both the σ70 promoters (P1 and P2) mutated and only the σ54 promoter (P3) intact, has no detectable transcriptional activity in N. gonorrhoeae. We identified a nt sequence in several isolates of N. gonorrhoeae and N. meningitidis that shares a sequence similarity with the rpoN gene from E. coli, but it encodes a deleted version. This rpoN-like sequence (RLS) contains a large deletion incorporating the region that would encode the helix–turn–helix (HTH) motif, a region essential for promoter recognition, and subsequently alters the reading frame.
Section snippets
Bacterial strains and plasmids and culture conditions
The bacterial strains and plasmids used in this study are listed in Table 1. The media and culture conditions used have been described previously (Fyfe et al., 1995).
DNA techniques
Methods for DNA manipulation, PCR and nt sequencing have been described previously (Fyfe et al., 1995). The oligo primers used in this study were as follows: 4525 (5′ GACGAGCAGGGCTACCTG), 4877 (5′ TCGTCCACGCCCAAGTCC), 4878 (5′ TTATTCTGCGGTTTTGCG), 4941 (5′ TTGTTCATGGTCAGATGG), 102 (5′ TTAACGCGTGAATTCAAAAAT), and TN3RU (5′
Construction and transcriptional analysis of PpilE::lacZ fusions containing mutated promoters
Previous studies have used transcriptional fusions of the pilE promoter to cat to examine pilE transcription. However, constructs lacking the major σ70 promoter P1 gave no CmR transformants of N. gonorrhoeae. This result suggested that P1 was necessary for pilE transcription, but provided no way to measure pilE transcription directly from the potential σ54 promoter in N. gonorrhoeae. To circumvent this difficulty, promoter constructs containing an intact σ54 promoter (P3) or no intact promoter
Discussion
We have reported previously that the N. gonorrhoeae pilE gene has a potentially functional σ54 promoter (P3) that binds RpoN in E. coli, and can direct transcription in E. coli or P. aeruginosa when the appropriate activator is present (Boyle-Vavra et al., 1993; Fyfe et al., 1995; Carrick et al., 1997). However, mutagenesis of this promoter had no effect on pilE transcription in N. gonorrhoeae. Now we have shown that no transcription is initiated from the region upstream of pilE if the σ54
References (26)
- et al.
Shuttle mutagenesis: two mini-transposons for gene mapping and for lacZ transcriptional fusions in Neisseria gonorrhoeae
Gene
(1993) - et al.
Transcriptional control of gonococcal pilE expression: involvement of an alternative sigma factor
Gene
(1993) - et al.
The normally silent σ54 promoters upstream of the pilE genes of both Neisseria gonorrhoeae and Neisseria meningitidis are functional when transferred to Pseudomonas aeruginosa
Gene
(1997) - et al.
The repertoire of silent pilus genes in Neisseria gonorrhoeae: evidence for gene conversion
Cell
(1986) - et al.
pACYC184-derived cloning vectors containing the multiple cloning site and lacZa reporter gene of pUC8/9 and pUC18/19 plasmids
Gene
(1988) - et al.
Transcription of glnA in E. coli is stimulated by activator bound to sites far from the promoter
Cell
(1986) - et al.
Role of chromosomal rearrangement in N. gonorrhoeae pilus phase variation
Cell
(1985) - et al.
Molecular cloning and characterization of a proline iminopeptidase gene from Neisseria gonorrhoeae
Mol. Microbiol.
(1993) - et al.
A promoter associated with the neisserial repeat (NR) can be used to transcribe the uvrB gene from Neisseria gonorrhoeae
J. Bacteriol.
(1995) - et al.
The cloning and characterization of the glnF (ntrA) gene of Klebsiella pneumoniae: role of glnF (ntrA) in the regulation of nitrogen fixation (nif) and other nitrogen assimilation genes
Mol. Gen. Genet.
(1983)
Species-specific uptake of DNA is mediated by a 10-base-pair sequence
J. Bacteriol.
A novel determinant (comA) essential for natural transformation competence in Neisseria gonorrhoeae and the effect of a comA defect on pilin variation
Mol. Microbiol.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd
Science
Cited by (34)
Animal Models of Immunity to Female Genital Tract Infections and Vaccine Development
2015, Mucosal Immunology: Fourth EditionGenome-wide survey for PilR recognition sites of the metal-reducing prokaryote Geobacter sulfurreducens
2010, GeneCitation Excerpt :However, this region appears to be no longer functionally active in Neisseria. In vitro studies demonstrated that transcription of the pilE gene in species of Neisseria is regulated by RpoD, while the RpoN promoter is silent (Fyfe et al., 1995), and the N. gonorrhoeae genome does not contain or express a functional rpoN gene (Laskos et al., 1998). Additional evidence comes from the finding that a mutation in the Neisseria rsp gene, the homolog of both pilS and pilR of other bacteria, does not have an effect on N. gonorrhoeae piliation controlled by the pilE expression, even though the rsp gene, when expressed in P. aeruginosa, is capable of repressing the RpoN-dependent transcription of P. aeruginosa pilA gene, by binding to the upstream PilR binding region of that gene (Carrick et al., 2000).
HPr kinase/phosphorylase, a Walker motif A-containing bifunctional sensor enzyme controlling catabolite repression in Gram-positive bacteria
2004, Biochimica et Biophysica Acta - Proteins and ProteomicsA developmentally regulated two-component signal transduction system in Chlamydia
2003, Journal of Biological ChemistryCitation Excerpt :However, a disadvantage is that this mode of transcription requires long stretches of intergenic DNA, thereby dictating an additional requirement for a larger chromosome. Therefore, the pressures that select for compact bacterial genomes may also select against ς54holoenzyme-mediated transcription (36). The chlamydial genome is very small in comparison to other eubacteria (11), and the missing DNA-binding domain of CtcC suggests that binding to an upstream enhancer-like element is not necessary for ς54activation.
Transcriptional, chemosensory and cell-contact-dependent regulation of type IV pilus expression
2002, Current Opinion in Microbiology