Abstract
The reaction to Tomato spotted wilt virus (TSWV) was evaluated in 94 accessions of Nicotiana, originating from the Institute of Soil Science and Plant Cultivation tobacco germplasm collection in Puławy, Poland. Tests for resistance were conducted under greenhouse conditions using single TSWV isolate collected from tobacco plantation in Lublin district, Poland. The presence of the virus was verified using DAS-ELISA. SCAR markers associated with TSWV resistance gene were applied. The members of the section Alatae, the genus Nicotiana: N. alata, N. forgetiana, and Nicotiana x sanderae as well as N. tabacum cultivars: ‘Polalta’ and ‘Wiktoria’ with the TSWV resistance gene introduced from N. alata, displayed the hypersensitive reaction (HR) against TSWV (grade 0 on symptom intensity scale). In some of those accessions, the virus spread from the initially infected areas eliciting systemic hypersensitive reaction (SHR). Five accessions of N. alata and three of Nicotiana x sanderae were composed of 6.3–50.0 % of plants in which SHR symptoms appeared. In all of N. forgetiana plants HR reaction was followed by systemic infection (SHR). In N. tabacum ‘Wiktoria’ 21.1 % of plants showed HR reaction, while the remaining were susceptible (S). All of the genotypes which responded with HR or SHR reaction to TSWV infection demonstrated the presence of SCAR markers linked to the resistance gene. The remaining eighty tested accessions were identified as being susceptible upon exposure to TSWV.
Similar content being viewed by others
Introduction
The genus Nicotiana is one of the most numerous in the family Solanaceae. Nicotiana species are native to North and South America, Australia, some Pacific islands and Namibia in Africa. Such an extensive area of origin and evolutionary heterogeneity makes Nicotiana an extremely diversified group. This diversity manifests itself with variation in chromosome number, multiplicity of morphological forms, different responses to day length, presence of different alkaloids, varied resistance responses to pests and diseases (Doroszewska et al. 2009).
For many years, the most popular systematics of the genus was that by Kostoff (1943) and Goodspeed (1954) with subsequent additions made by Burbidge (1960). Recently, a revised systematics based on molecular research was proposed (Chase et al. 2003; Clarkson et al. 2004; Knapp et al. 2004). In the new classification by Knapp et al. (2004) subgenera were dropped and only the division into sections was retained. According to the new classification, N. trigonophylla Dun. was renamed N. obtusifolia Martens et Galeotti, N. affinis Hort is synonymous with N. alata Link et Otto, and N. bigelovii (Torrey) Watson with N. quadrivalvis Pursh. N. sanderae Hort. is currently regarded to be hybrid between N. alata and N. forgetiana Hemsl. (Nicotiana x sanderae) whereas N. eastii Kostoff is an autotetraploid variant of N. suaveolens Lehm. (Chase et al. 2003; Knapp et al. 2004).
The tobacco collection maintained in the Institute of Soil Science and Plant Cultivation in Puławy, Poland, consists of 1027 accessions belonging to 64 species of the genus Nicotiana, including 784 botanical varieties and cultivars of N. tabacum and 95 forms of N. rustica. Collection accessions are examined for various traits but one of the most important items in the evaluation of Nicotiana germplasm is screening for resistance to diseases (Doroszewska and Przybyś 2007; Doroszewska and Depta 2011).
Tomato spotted wilt virus (TSWV) is an economically important pathogen which has been reported worldwide in 1,090 different host species belonging to 85 botanical families, involving such important crops as potatoes, tomatoes, tobacco, pepper, lettuce, papaya, celery, eggplant (Parella et al. 2003). In tobacco, symptoms of TSWV include chlorosis and necrosis of the leaves and stems. Oftentimes, the systemic infection is unilateral. Apical buds frequently twist and bend to about 45°. The infection may ultimately lead to stunting and death of the plants (Mumford et al. 1996).
Tomato spotted wilt virus is the member of the genus Tospovirus, family Bunyaviridae (Francki et al. 1991; Wijkamp et al. 1993), and is transmitted in nature by at least eight species of thrips (Thripidae: Thysanoptera) (Jones 2005). The occurrence of many weed hosts that harbour the pathogen and the transmission by thrips make it difficult to control the virus, therefore screening of Nicotiana accessions for TSWV and introgression of the resistance into commercial tobacco cultivars would be the most effective way to minimize the damage by this disease. Although resistant lines have been developed in tobacco by transforming plants with the TSWV nucleocapsid gene (Herrero et al. 2000), they are not acceptable to the tobacco market.
Genetic resistance to TSWV is scarce in cultivated host species. A few sources of resistance have been identified and incorporated into commercial cultivars of tomato and pepper. Sw-5 gene from Solanum peruvianum L. has been broadly utilized in tomato breeding (Stevens et al. 1992). Additionally, Sw-6 gene was found in S. peruvianum and introgressed to S. lycopersicum L. ‘UPV-1' line (Rosello et al. 2001). Sw-7 gene from S. chilense (Dun.) Reiche ‘LA 1938’ was transferred to S. lycopersicum ‘Y118’ (Canady et al. 2001). In Capsicum chinense Jacq. and C. annuum L. the only locus to bring on TSWV resistance was named Tsw (Black et al. 1991; Boiteux 1995; Roggero et al. 1999).
Of the wild Nicotiana species, the following were the most frequently reported as potential sources for TSWV resistance: N. alata Link et Otto (Opoka 1969; Gajos 1978; Ivancheva-Gabrovska 1978; Jankowski 1980; Kovalenko et al. 1987; Palakarcheva and Yancheva 1989), N. sanderae Hort. (Ivancheva-Gabrovska 1978; Jankowski 1980; Kovalenko et al. 1987; Palakarcheva and Yancheva 1989; Shcherbatenko and Oleshchenko 2006), N. glauca Graham (Opoka 1969; Ivancheva-Gabrovska 1978; Pop 1979; Kovalenko et al. 1987; Shcherbatenko and Oleshchenko 2006), N. langsdorfii Weinm. (Gajos 1978; Pop 1979; Kovalenko et al. 1987; Palakarcheva and Yancheva 1989), N. longiflora Cav. (Pop 1979; Jankowski 1980), N. trigonophylla Dun. (Jankowski 1980; Kovalenko et al. 1987), N. forgetiana Hemsl. (Ivancheva-Gabrovska 1978), N. fragrans Hook. (Jankowski 1980), N. noctiflora Hook. (Opoka 1969), N. palmeri Gray (Kovalenko et al. 1987).
The latest host-lists of TSWV (Cho et al. 1987; Edwardson and Christie 1997; Gognalos et al. 1999; Parella et al. 2003; Scott 2012) contradict much of those earlier reports on TSWV resistance. They contain as many as 61 susceptible Nicotiana species, including all of the mentioned above, except N. forgetiana.
There are no commercially exploited TSWV-resistant tobacco cultivars either in Poland or elsewhere in the world. Some of the Nicotiana wild species cited above as resistant were tried as sources of resistance to TSWV in tobacco breeding. Transfer of the resistance from N. alata was tried by the conventional breeding method (Stoyanova 1979; Gajos 1981, 1988, 1993; Ivancheva-Gabrovska and Manolov 1982; Berbeć 1987) as well as using in vitro culture techniques (Dorossiev et al. 1978; Patrascu and Paunescu 1997; Laskowska and Berbeć 2005; Shcherbatenko and Oleshchenko 2006) and by somatic hybridization (Nagao 1982; Flick and Evans 1983; Dimanov and Atanassov 1989). The cross-breeding between Nicotiana x sanderae and cultivated tobacco was conducted by Skucińska et al. (1977), Ivancheva-Gabrovska and Manolov (1982), Palakarcheva and Yancheva (1985), Dorossiev and Palakarcheva (1990), Kovalenko et al. (1989), Shcherbatenko and Oleshchenko (2006). Occasionally, the potentials of N. glauca and N. noctiflora as germplasm sources for TSWV resistance were also studied (Kovalenko et al. 1989; Dorossiev and Palakarcheva 1990; Shcherbatenko and Oleshchenko 2006).
In spite of the efforts made by numerous breeders, up to now only two tobacco (N. tabacum L.) cultivars, both released in Poland—‘Polalta’ and ‘Wiktoria’—carry a confirmed TSWV resistance response of the hypersensitive type from N. alata (Gajos 1988, 1993; Yancheva 1990; Moon and Nicholson 2007). The gene transfer mechanism leading to the development of ‘Polalta’ lacks adequate documentation, but N. otophora seems to be involved as a bridging species in the transfer (Gajos 1981). Further multiple crossing of the interspecies hybrid (N. tabacum × N. alata) with Virginia cultivars has resulted in developing the cultivar ‘Wiktoria’ (Gajos 1993). However, when those resistant cultivars are crossed with other N. tabacum genotypes morphological deformations such as thickened and ribbon-shaped leaves, irregular venation, or tumours appear in the resulting progeny and successive segregating generations (Kennedy and Nielsen 1993, Moon and Nicholson 2007). ‘Polalta’ and ‘Wiktoria’ are not grown commercially because of poor agronomic performance caused by the introgressed DNA from N. alata or N. otophora (Kennedy and Nielsen 1993; Moon and Nicholson 2007). AFLP and SCAR markers linked with the N. alata DNA segment conferring resistance to TSWV were identified by Moon and Nicholson (2007) in N. tabacum ‘Polalta’. The molecular sequence of the gene encoding TSWV resistance in that segment has not yet been established.
Because of the poor breeding progress, the contradictory data available in the literature and the necessity to diversify available sources of resistance, there is a continued need to search for possible new resistant accessions. Our objective was to re-examine the reaction of Nicotiana germplasm accessions mechanically inoculated with TSWV in combination with the use of SCAR markers (Moon and Nicholson 2007) to detect the presence of the DNA segment bearing the TSWV resistance-conferring gene.
Materials and methods
Plant materials
Ninety-four entries, belonging to 62 species of the genus Nicotiana, including seven botanical varieties and two cultivars of N. tabacum, twelve varieties of N. rustica, five of N. quadrivalvis, seven populations of N. alata of diverse origin, and four of Nicotiana x sanderae (Table 1), were used in this study. All of them came from the collection of the Institute of Soil Science and Plant Cultivation—State Research Institute in Puławy, Poland.
Species and section names were given according to the current classification by Knapp et al. (2004).
Resistance tests
The TSWV isolate used for inoculation tests was collected from one plant that showed typical systemic symptoms of TSWV infection on a tobacco plantation in Łąkoć, Lublin district, eastern Poland. The isolate was multiplied on the N. tabacum ‘Samsun’ plants, resistant to Tobacco mosaic virus, according to the method given below. In order to avoid possible changes in the inoculum after repeated mechanical inoculations, the isolate was multiplied only three times. Serological methods were used to confirm that the TSWV isolate was free from the contamination with common tobacco viruses (Potato virus Y, Tobacco mosaic virus). Infected plant tissues from ‘Samsun’ leaves prepared in 2009 were deep-freezed (−80 °C) and thawed prior to resistance tests. Inoculum was prepared as follows: thawed tissues were ground in phosphate buffer (9.078 g/l KH2PO4 and 11.867 g/l Na2HPO4) with the addition of 0.5 % mercapthoethanol and 1 % carborundum (400 mesh) (Tsakiridis and Gooding 1972). The proportion was 1 g tissue to 2 ml of buffer.
The isolates were multiplied, collection accessions were grown, and resistance tests were conducted in a cabinet in constant conditions of 25 °C under a 15/9 h light/dark cycle at a light intensity of 12,000 Lux. Plants were germinated in a sterilized peat soil mixture in small pots (7.0 cm × 6.0 cm × 6.0 cm). One-week-old seedlings were transplanted to 160 plastic cell trays, ten cells for each accession. Four to eight weeks after sowing, when the seedlings developed at least three pairs of true leaves, they were individually planted to pots of 16 cm in diameter, containing steamed soil.
Resistance tests were conducted in 2010 and 2011. About 200 plants were inoculated in one series. Eight plants were prepared per accession, from which two plants were used as the blank controls. In each resistance test, eight plants of standard control cultivars: susceptible ‘Wiślica' and resistant ‘Polalta' were included. In N. alata, N. sanderae, N. forgetiana, N. tabacum‘Polalta’ and N. tabacum ‘Wiktoria' accessions, six to fifteen plants were additionally tested, depending on availability of seeds.
Virus was transmitted to six-leaved plants using mechanical inoculation. Blank controls were inoculated only with phosphate buffer and carborundum. These controls were used as negatives for the ELISA test. Plants were monitored for the progress of disease symptoms 5, 7, 14, 21 and 35 days after inoculation. The symptoms were determined as: HR—hypersensitive reaction—score 0 on the symptoms intensity scale, SHR—systemic hypersensitive reaction, S—susceptible. The intensity of the symptoms in plants which developed systemic infection was scored on the following scale: 1—chlorotic spots, vein clearing, 2—necrotic spots, stem and leaves necrosis, curving of the apex, flower deformation, wrinkled upper leaves, 3—inhibited growth, plants die out. TSWV infection was confirmed by a standard DAS-ELISA as described by Clark and Adams (1977), using a commercial polyclonal antiserum against TSWV proteins (Bioreba AG, Switzerland). Absorbance after serological reaction was measured at the optical density of 405 nm with a Tecan microplate reader. Samples were taken from the top leaves of each plant. In all N. alata, N. sanderae, N. forgetiana, N. tabacum ‘Polalta' and N. tabacum ‘Wiktoria' plants, samples were taken from two stalk positions—top leaves (without or with symptoms) and bottom leaves with necrotic local lesions. All leaf samplings for ELISA tests were taken 1 week after development of the TSWV symptoms. Plants were considered as susceptible when samples thereof showed an absorbance value of at least twice that of the absorbance reading in the negative controls.
Detection of markers linked to TSWV resistance
Detections of markers were preceded by isolation of DNA carried out according to the methodology described by Czubacka and Doroszewska (2010). DNA was amplified by polymerase chain reaction (PCR). Four AFLP markers: AAC/CCC172, ACT/CTA169, AAG/CGA228, ACT/CTA268, previously determined to be closely associated in coupling with the TSWV resistance gene present in cultivar Polalta (Moon and Nicholson 2007) were used in this study. Those markers use pairs of SCAR primers: AGCTTCTTTTCTCTTTCCATTTTT and CAGAAGAAAAACTGCTGGAGCTAT, ACTTTTCACACCAAAAACTCACG and GTAGATGATAAAGATTGAAGAAAACAA, TAGATGTCATGAATGGAACTACGG and TTTTGATCGAAAAACCCAACC, CTGATCGTTCCAGCAGGTTCTTAT and GGAGCTATTTCCAGACACGAA, respectively. The size of the PCR-amplified products of the first three markers were 117, 105 and 117 bp. The ATC/CTA268 marker generates two PCR-amplified products (161 and 200 bp) in genotypes carrying the TSWV resistance gene and one product (200 bp) in genotypes that do not possess that gene. The amount of 1 μl plant DNA (approximately 20 ng/μl) was added to the mixture containing 1.9 units of Taq polymerase (Fermentas) and 4.5 pmol of each primer per 20 μl reaction, 1.5 × PCR buffer, 2 mM MgCl2, 312.5 μM dNTPs. The PCR was done in a termocycler using the following amplification procedure: for 2 min at 94 °C followed by 30 cycles: 30 s at 94 °C, 30 s at 53.5, 50, 53.5 and 55 °C for individual markers, 40 s at 72 °C and a final elongation step 5 min at 72 °C. The products of PCR were analysed by electrophoresis in 2 % agarose gels in 1 × TBE buffer (100 mM Tris, 90 Mm H3BO3, 1 mM EDTA, pH 8.5) at 7–10 V/cm.
PCR analysis was done on all TSWV tested plants of N. alata, N. forgetiana, Nicotiana x sanderae, N. langsdorfii, N. longiflora, N. plumbaginifolia, N. tabacum ‘Polalta', N. tabacum ‘Wiktoria' and on susceptible plants of N. tabacum ‘Wiślica' as a control.
Results
The symptoms of TSWV varied greatly depending on the species involved. N. alata, Nicotiana x sanderae, N. forgetiana, N. tabacum ‘Polalta' and some plants of N. tabacum ‘Wiktoria' showed the typical hypersensitive reaction (HR). In those accessions local yellow discolorations which evolved into concentric necrotic local spots appeared in 5–7 days after inoculation. In N. alata, Nicotiana x sanderae and N. forgetiana necrotic spots were 6–7 mm in diameter and in ‘Polalta’ and ‘Wiktoria’—2–3 mm. In some plants of those accessions local lesions were subsequently accompanied by chlorotic spots, and in 14 days the systemic infection set in, at first manifested as fast-growing and coalescing chlorotic necrotic spots, which ultimately led to leaf and apex distortion (systemic hypersensitive reaction—SHR) (Table 1).
In plants with HR reaction TSWV was detected only in the inoculated leaves that showed localized concentric lesions but not in the newly developed, non-inoculated leaves. No systemic symptoms developed in these plants within 5 weeks after inoculation. Two of the seven N. alata populations, one of the four Nicotiana x sanderae as well as N. tabacum ‘Polalta’ were found to be composed entirely of plants that showed HR response. In the remaining N. alata and Nicotiana x sanderae accessions listed in the Table 1, plants with SHR symptoms appeared. In those plants, TSWV spread out of the necrotic lesions into the inoculated leaves and was able to bring about systemic infection. SHR plants accounted for 6.3—50.0 % of N. alata populations under study and from 16.7 to 50.0 % of Nicotiana x sanderae. Four out of 19 ‘Wiktoria’ plants screened for the reaction to TSWV showed HR response, the remaining were susceptible (S). In N. forgetiana TSWV induced a hypersensitive response, shown by the appearance of necrotic local lesions 5 days post inoculation, but severe systemic symptoms developed in all of the tested plants within the next 10 days (SHR reaction). Virus accumulation in the newly developed, non-inoculated leaves of all of the SHR plants showed ELISA absorbance values within a range of 0.369–2.747.
In the remaining entries listed in Table 1, typical systemic symptoms (S) of the TSWV infection were observed with varying intensity. In N. petunioides, N. benavidesii, N. velutina, N. otophora, N. setchelli, N. obtusifolia, N. palmeri, N. arentsii, N. wigandioides, vein clearing as well as individual chlorotic spots were observed, without necrotic symptoms. Frequently unilateral vein clearing occurred, involving only one half of the leaf (a score of 1 on the symptoms scale). DAS-ELISA absorbance values in the non-inoculated leaves (from 0.490 to 2.890) confirm their susceptibility. The remaining 71 accessions listed in Table 1 developed more severe symptoms. In the typical course of the disease, chlorotic and necrotic rings and irregular spots on the inoculated leaves appeared seven days after infection and grew into large chlorotic and necrotic areas. During the next 14 days the infection symptoms, including vein clearing, leaf distortions, and the characteristic curving of the apex, spread to the upper portion of the plant. This systemic infection was often unilateral (score of 2 on the symptom intensity scale). Stunting and death, (score of 3) followed in some of those accessions. The content of TSWV in the upper leaves of the accessions with scores of 2 or 3, resulted in DAS-ELISA absorbance values from 0.299 to 3.194 and was not correlated with symptoms manifested by the plants.
Plants of N. alata, N. forgetiana, Nicotiana x sanderae and N. tabacum ‘Polalta’ responded to all four TSWV resistance-linked markers (Table 2; Fig. 1). Of the 19 N. tabacum ‘Wiktoria’ tested plants, four (21.1 %) which showed HR reaction to TSWV responded to all four markers and the others failed to show response to any. The remaining entries listen in Table 2 did not respond to any of the markers. All plants of the genotypes which showed the HR or SHR reactions responded to TSWV resistance-linked molecular markers.
Discussion
In this study, only the members of the section Alatae: N. alata, N. forgetiana, and Nicotiana x sanderae as well as cultivars of N. tabacum: ‘Polalta’ and ‘Wiktoria’, with the resistance gene introduced from N. alata (Gajos 1988, 1993; Yancheva 1990; Moon and Nicholson 2007) showed localized induced cell death at the site of TSWV infection.
The resistance to TSWV is in various plant species associated with a hypersensitivity response (HR). This type of reaction was detected in tomato (Solanum lycopersicum L. ‘Steven’) carried by the Sw-5 gene of resistance (Stevens et al. 1992) as well as in peanut (Arachis hypogaea L.), cultivar ‘C11-2-39’ (Mandal et al. 2002). The same symptoms followed by abscising of cotyledons and leaves developed on resistant plants of Capsicum chinense Jacq. and C. annuum L. (‘PI 152225’ and ‘PI 159236’) which carried the Tsw gene (Black et al. 1991).
A hypersensitive response (HR) is defined as rapid death of plant cells at the site of pathogen ingress in association with the restraint on pathogen growth, which confines the pathogen to the initial infection area (Goodman and Novacky 1994). This kind of “gene-for-gene” resistance in plants, in which resistant host and the avirulent pathogen are incompatible, is termed as R-Avr-mediated defense response (Flor 1971). The arrest of an avirulent virus is associated with induction of a variety of defense-related genes including pathogenesis-related (PR) proteins and a wide range of physiological changes (Hammond-Kosack and Jones 1996).
Some N. alata and Nicotiana x sanderae populations investigated in this study were composed entirely of HR plants whereas some other segregated for the HR and SHR plants, in which virus-induced HR was followed by SHR. In N. forgetiana all plants developed SHR. This could be the reason for some discrepancies in the literature regarding the resistance of these species and their suitability as potential sources of resistance to TSWV in tobacco improvement (Ivancheva-Gabrovska 1978; Jankowski 1980; Kovalenko et al. 1987; Palakarcheva and Yancheva 1989) or susceptibility (Opoka 1969; Ruter and Gitaitis 1993). Elicitation of SHR, instead of localized HR, is quite frequent in the interactions involving avirulent viruses and resistant plants. Similar to our findings, Mandal et. al. (2002) observed, that in 17.6–46.7 % plants of the peanut ‘C11-2-39’ initial HR was followed by systemic infection. In Solanum lycopersicum up to 8.0 % of plants were found to be infected with TSWV (Stevens et al. 1992; Rosello et al. 1998). Also in Capsicum a small but significant proportion of plants in resistant ‘PI 152225’ and ‘PI 159236’ lines showed systemic TSWV infection (Soler et al. 1999).
Currently, the underlying molecular and biochemical mechanisms leading to SHR are not understood (Hajimorad et al. 2005). Dinesh-Kumar et al. (2000) have postulated that SHR is a consequence of delayed occurrence of biochemical and physiological events that are associated with localized HR. They found, that the HR induced by TMV in a tobacco plant which carried an in vitro-constructed variant of N-resistance gene, occasionally spread to the entire plant, resulting in SHR. The authors suggest that some loss-off-function N alleles such as the TIR (Toll/interleukin-1 receptor homology region) deletion and the point mutation in the NBS (nucleotide-binding site) may cause a systemic hypersensitive response (SHR).
The mechanism of the HR reaction is strongly influenced by such conditions as high temperatures or the development stage of the plants at virus inoculation (Roggero et al. 1996; Moury et al. 1997; Soler et al. 1998; Mandal et al. 2002). The resistance could be also lost by a mutation in the corresponding pathogen Avr gene (Ellis et al. 2000). In our study, ambient conditions, plant development stage at inoculation, and the isolate used were constant, so that there is some chance that this resistance response was genotype-dependent.
One of such factors that can result in virus escape to distant tissues, provoking SHR in resistant genotypes could be heterozygosity rather than homozygosity of the R-genotype plant (Moury et al. 1998; Chen et al. 1994). In N. alata and Nicotiana x sanderae the self-incompatibility and large polymorphism of the entries may be the reason of the incomplete homozygosity and segregation of the resistance trait. Small outcrossing populations such as those maintained in germplasm collections are particularly prone to genetic drift and consequent changes in allele frequencies. Gajos (1981) and Yancheva (1990) report for N. tabacum ‘Polalta’ that heterozygous generations were resistant, but when resistant ‘Polalta’ × ‘Wiślica’ DH breeding lines were backcrossed to ‘Wiślica’ (Laskowska and Berbeć 2010), in the resulting heterozygous hybrid populations the proportion of resistant to susceptible plants differed slightly from the expected ratios in favor of susceptible plants.
The observed ratio of resistant to susceptible haploid plants obtained through androgenesis from the F1 ‘Polalta’ with susceptible ‘Wiślica’ hybrid was skewed, resulting in an excess of susceptible genotypes (Laskowska and Berbeć 2010). The changes in the genetic background of an R gene-carrying plant can influence the HR reaction (Hajimorad et al. 2005; Lanfermeijer et al. 2005), which fits with the results presented here. The resistance in different populations of N. alata ranged from 50 to 100 %. The resistance factor transferred from N. alata into N. tabacum gave a good protection against TSWV when employed in the genetic milieu of ‘Polalta’ (100.0 % of resistant plants) and was poorly expressed and erratic in ‘Wiktoria’ (21.1 % of resistant plants).
‘Polalta’ is recognized as the best source of resistance to TSWV in tobacco. The cultivar is used in tobacco breeding and as the resistance check in testing for resistance (Herrero et al. 2000; Moon and Nicholson 2007; Laskowska and Berbeć 2010). Gajos (1981) formulated a hypothesis of monogenic dominant resistance to TSWV introgressed from N. alata to the N. tabacum ‘Polalta'. This model of inheritance was confirmed by Yancheva (1990) and Moon and Nicholson (2007). Likewise TSWV resistance in breeding lines of tobacco obtained from ‘Polalta’ by Laskowska and Berbeć (2010) depended on one dominant gene. The presence of minor resistance-modifying genes cannot be entirely excluded as a factor affecting the expression of resistance. Kennedy and Nielsen (1993) investigated F1, F2 and backcross generations and assumed ‘Polalta’ to possess digenic resistance. According to Fraser (1990) virus localization is a phenomenon associated with resistance alleles which are phenotypically dominant and are usually controlled by one or a few major genes. The genes controlling resistance to TSWV in tomato (Sw-5) and pepper (Tsw) are inherited as a single dominant character (Stevens et al. 1992; Boiteux and de Avila 1994).
The molecular analysis with the use of SCAR markers described by Moon and Nicholson (2007) as tightly linked to TSWV resistance gene, confirmed its presence in all tested plants of both HR and SHR genotypes shown in Table 2. The lack of the HR/SHR responses and the absence of reaction to resistance-linked molecular markers in some ‘Wiktoria’ plants suggest the loss of resistance gene rather than changes to the gene’s molecular structure. In Poland, the resistance conferred by the R gene in ‘Wiktoria’ was overcome by TSWV soon after it was introgressed into that cultivar. In the study of Moon and Nicholson (2007) the plants of ‘Wiktoria’ responded to 17 markers linked to the resistance gene.
This is the first report which provides the reaction of N. forgetiana to the resistance-linked molecular markers described by Moon and Nicholson (2007). The species, closely related to N. alata (Clarkson et al. 2004) was found completely susceptible (SHR) to TSWV. Minor differences in genomic sequences at the amino acid level, related to resistance responses, may exist between these two species.
The hypersensitive reaction (HR) is the only mechanism responsible for resistance to TSWV known in Nicotiana. In natural conditions it seems to be confined to only one species—N. alata section Alatae, if we take into account Nicotiana x sanderae’s origin as artificial hybrid species of N. alata × N. forgetiana. The majority of wild Nicotiana accessions showed systemic symptoms following mechanical inoculation with TSWV.
Most of the Nicotiana species named in early reports as potential sources for TSWV resistance, including N. glauca, N. langsdorfii, N. longiflora, N. trigonophylla (syn. N. obtusifolia), N. noctiflora, N. palmeri, turned out to be susceptible in our study. One of the reasons for this difference can be that those early investigations (Opoka 1969; Jankowski 1980) relied on natural vector-mediated infection rather than artificial inoculations and their data reflected the feeding preferences of the insect vector rather than intrinsic resistance mechanisms of the host plant. In the other early investigations, in which mechanical inoculation was applied, the reason can be impermanence of the virus which rapidly deactivates once inoculum is prepared and the lack of serological and molecular methods. From the species listed above, N. trigonophylla (syn. N. obtusifolia), N. palmeri, N. glauca and N. noctiflora are slow-growing perennials and the slow increase of tissue leaves can result in poor symptom development.
In our study most of the species with the lower symptom intensities (score 1): N. obtusifolia, N. palmeri (Trigonophyllae), N. otophora, N. setchelli (Tomentosae), N. benavidesii (Paniculatae), N. arentsii, N. wigandioides (Undulatae) are slow-growing perennials or woody shrubs, which could affect the symptom development. Only N. petunioides (Noctiflorae) and N. velutina (Suaveolentes) are annual herbs.
The group of collection accessions found as susceptible in this study generally agrees with the lists of susceptible hosts reported by other investigators, of which the most extensive is the one compiled by Parella et al. (2003). Among the entries not evaluated in this study but listed by that investigator are: Nicotiana x calyciflora, N. clevelandii, N. cycliflora, Nicotiana x edwardsonii, N. fragrans, N. bonariensis, N. tomentosa. Other species listed by Parella et al. (2003)—N. angustifolia, N. caudigera, N. macrophylla and N. multivalvis—are synonymous to N. acuminata, N. pauciflora, N. tabacum var. macrophylla purpurea and N. quadrivalvis var. multivalvis of this study. The species N. wuttkei was previously evaluated as susceptible by Laskowska and Berbeć (2003).
This study encompassed 12 entries the reaction of which to TSWV had not been reported in literature: N. africana, N. amplexicaulis, N. cavicola, N. corymbosa, N. eastii (autotetraploid of N. suaveolens), N. gossei, N. kawakamii, N. otophora, N. pauciflora, N. setchelli, N. simulans, N. umbratica and many botanical varieties within N. tabacum, N. rustica and N. quadrivalvis (Table 1). All those entries were found to be susceptible to TSWV.
In conclusion, it can be stated with a fair degree of probability that the N. alata-derived gene which we propose to name RTSW-al and which, apart from N. alata, gives resistance to TSWV in Nicotiana x sanderae, N. tabacum ‘Polalta’ and, to a certain degree, in ‘Wiktoria’ is the only source of resistance to TSWV in the genus Nicotiana. That source of resistance is difficult to employ in tobacco breeding because of genetic distance between the donors of resistance and the cultivated N. tabacum, the expected linkage drag in the hybrids and the unstable expression shown by RTSW-al gene. In the future, it will be important to study the molecular structure of the resistance factor in different genotypes of Nicotiana as well as to look into the biochemical mechanisms underlying the control of HR/SHR reaction.
References
Berbeć A (1987) Cytogenetical study on Nicotiana tabacum L. cv. Nadwiślański Mały (2x and 4x) × Nicotiana alata Link et Otto hybrids. Genetica Pol 28:251–262
Black LL, Hobbs HA, Gatti JM (1991) Tomato spotted wilt virus resistance in Capsicum chinense PI152225 and 159236. Plant Dis 75:863
Boiteux LS (1995) Allelic relationships between genes for resistance to tomato spotted wilt tospovirus in Capsicum chinense. Theor Appl Genet 90:146–149
Boiteux LS, de Avila AC (1994) Inheritance of a resistance specific to tomato spotted wilt tospovirus in Capsicum chinense ‘PI-159236’. Euphytica 75:139–142
Burbidge NT (1960) The Australian species of Nicotiana L. Aust J Bot 8:342–380
Canady MA, Stevens MR, Barineau MS, Scott JW (2001) Tomato spotted wilt virus (TSWV) resistance in tomato derived from Lycopersicon chilense Dun. LA 1938. Euphytica 117:19–25
Chase MW, Knapp S, Cox AV, Clarkson JJ, Butsko Y, Joseph J, Savolainen V, Parokonny AS (2003) Molecular systematics, GISH and the origin of hybrid taxa in Nicotiana (Solanaceae). Ann Bot 92(1):107–127
Chen P, Buss GR, Roane CW, Tolin SA (1994) Inheritance in soybean of resistant and necrotic reaction to soybean mosaic virus strains. Crop Sci 34:414–422
Cho JJ, Mau RFL, Mitchell WC, Gonsalves D, Yudin LS (1987) Host list of plants susceptible to tomato spotted wilt virus (TSWV). Research Extension Series, Hawaii 10 pp
Clark MF, Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34:475–483
Clarkson JJ, Knapp S, Garcia VF, Olmstead RG, Leitch AR, Chase MW (2004) Phylogenetic relationships in Nicotiana (Solanaceae) inferred from multiple plastid DNA regions. Mol Phylogenet Evol 33:75–90
Czubacka A, Doroszewska T (2010) Estimating agronomic traits of transgenic tobacco lines. Euphytica 172:35–47
Dimanov D, Atanassov A (1989) A study of possibility to apply UV light in experiments of somatic hybridization in protoplast cultures of Nicotiana alata and Nicotiana tabacum (line Virginia 89). Genet Sel 22:40–44
Dinesh-Kumar SP, Tham WH, Baker BJ (2000) Structure–function analysis of the tobacco mosaic virus resistance gene N. Proc Natl Acad Sci USA 97:14789–14794
Dorossiev L, Palakarcheva M (1990) Application of in vitro methods in the development of disease resistant tobacco hybrids and lines. Genet Breed 23(4):306–315
Dorossiev L, Palakarcheva M, Stoyanova M (1978) Overcoming the sterility in F1 of interspecific hybrids of genus Nicotiana using the methods of tissue culture. CORESTA Inf Bull Sofia (Special):80–81
Doroszewska T, Depta A (2011) Resistance of wild Nicotiana species to different PVY isolates. Phytopathologia 59:9–24
Doroszewska T, Przybyś M (2007) Charakterystyka odporności gatunków Nicotiana na czarną zgniliznę korzeni Thielaviopsis basicola (Berk. and Broome) Ferr. [Characterization of Nicotiana species resistance to black root rot—Thielaviopsis basicola (Berk. and Broome) Ferr.]. Zeszyty Problemowe Postępów Nauk Rolniczych 517:253–266
Doroszewska T, Depta A, Czubacka A (2009) Album of Nicotiana species. Institute of Soil Science and Plant Cultivation National Reseach Institute, Pulawy
Edwardson JR, Christie RG (1997) Viruses infecting peppers and other Solaceaeous crops vol 1. Monograph 18–1. University of Florida Agricultural Experiment Station, Florida
Ellis J, Dodds P, Pryor T (2000) Structure, funktion and evolution of plant disease resistance genes. Curr Opin Plant Biol 3:278–284
Flick CE, Evans DA (1983) Isolation, culture and plant regeneration from protoplasts isolated from flower petals of ornamental Nicotiana species. Z Pflanzenphysiol 109(5):379–383
Flor HH (1971) Current status of the gene-for-gene concept. Annu Rev Phytopathol 9:275–296
Francki RIB, Fauquet CM, Knudson DD, Brown F (1991) Fifth report of the International Committee on Taxonomy of Viruses. Archives of Virology Suppl 2:1–450
Fraser RSS (1990) The genetics of resistance to plant viruses. Annu Rev Phytopathol 28:179–200
Gajos Z (1978) Podatność dwudziestu dzikich gatunków Nicotiana na zakażenie przez wirus brązowej plamistości pomidora (Lycopersicum virus 3 Smith.) w zależności od wieku roślin inokulowanych [susceptibility of twenty uncultivated species of Nicotiana to infection by tomato spotted wilt (Lycopersicum virus 3) depending on the age of inoculated plant]. Biul CLPT 1–2:25–37
Gajos Z (1981) Inheritance of resistance to Tomato spotted wilt virus in interspecies hybrids of Nicotiana tabacum L. × Nicotiana alata Link. Zeszyty Problemowe Postępów Nauk Rolniczych 244:117–126
Gajos Z (1988) Polalta—odmiana tytoniu odporna na wirus brązowej plamistości pomidora (TSWV) i czarną zgniliznę korzeni (Thielaviopsis basicola Ferr.). [Polalta—a tobacco variety resistant to Tomato spotted wilt virus (TSWV) and black root rot (Thielaviopsis basicola Ferr.)]. Biul CLPT 1–4:7–25
Gajos Z (1993) Virginia ZG-4 (Wiktoria)—nowa odmiana tytoniu odporna na wirus brązowej plamistości pomidora (TSWV) i czarna zgniliznę korzeni (Thielaviopsis basicola). [Virginia ZG-4 (Wiktoria)—a new tobacco variety resistant to tomato spotted wilt virus (TSWV) and black root rot (Thielaviopsis basicola Ferr.)]. Biul CLPT 1–4:5–19
Gognalos P, Gebre-Selassie K, Marchoux G (1999) La gamme d’hôtes du TSWV continue à s’étendre. De nouvelles Solanacées sont touchées. Phytoma 512:47–50
Goodman RN, Novacky AJ (1994) The hypersensitive reaction in plants to pathogen. A resistance phenomenon. American Phytopathological Society Press, St. Paul
Goodspeed TH (1954) The genus Nicotiana. Chronica Botanica, Waltham
Hajimorad MR, Eggenberger AL, Hill JH (2005) Loss and gain of elicitor function of soybean mosaic virus G7 provoking Rsv1-mediated lethal systemic hypersensitive response maps to P3. J Virol 79:1215–1222
Hammond-Kosack KE, Jones JDG (1996) Resistance gene-dependent plant defense responses. Plant Cell 8:1773–1791
Herrero S, Culbreath A, Csinos A, Pappu H, Rufty RC, Daub ME (2000) Nucleocapsid gene-mediated transgenic resistance provides protection against tomato spotted wilt virus epidemics in the field. Phytopathology 90:139–147
Ivancheva-Gabrovska T, Manolov A (1982) Investigations of the resistance of interspecific hybrids Nicotiana tabacum × N.alata and N.tabacum x N.sanderae to tomato spotted wilt virus. Reports of second national symposium of plant immunity, Plovdiv 2:65–78
Ivancheva-Gabrovska T (1978) Sources of resistance to tomato spotted wilt virus and Thrips tabaci Lind. Special CORESTA Bull, Symposium Sofia, p 96
Jankowski F (1980) Źródła odporności na TSWV (Lycopersicum virus 3) u dzikich gatunków rodzaju Nicotiana. [Sources of resistance to TSWV (Lycopersicum virus 3) among uncultivated species of Nicotiana genus]. Biul CLPT 1–2:3–8
Jones DR (2005) Plant viruses transmitted by thrips. Eur J Plant Pathol 113:119–157
Kennedy BS, Nielsen MT (1993) Characterization of tomato spotted wilt virus (TSWV) resistance in the tobacco cultivar ‘Polalta’. (Abstr). Phytopathology 83(12):1420
Knapp S, Chase MW, Clarkson JJ (2004) Nomenclatural changes and a new sectional classification in Nicotiana (Solanaceae). Taxon 53(1):73–82
Kostoff D (1943) Cytogenetics of the genus Nicotiana. State Printing House, Sofia
Kovalenko AG, Rud EA, Strelyaeva NI, Oleshchenko LT (1987) Responses of tobacco varieties, wild species and interspecies hybrids on artificial infection with tomato spotted wilt virus. Mikrobiologicheskii Zhurnal (Kiev) 49:85–89
Kovalenko AG, Shcherbatenko IS, Oleshchenko LT, Rud EA, Strelaeva NI (1989) The production of fertile somaclones of interspecific tobacco hybrids with high resistance to tomato spotted wilt virus. Cytol Genet 24:59–65
Lanfermeijer FC, Warmink J, Hille J (2005) The products of the broken Tm-2 and the durable Tm-2 2 resistance genes from tomato differ in four amino acids. J Exp Bot 56:2925–2933
Laskowska D, Berbeć A (2003) Preliminary study of the newly discovered tobacco species Nicotiana wuttkei Clarkson et Symon. Genet Resources Crop Evol 50(8):835–839
Laskowska D, Berbeć A (2005) Cytology and fertility of viable hybrids of Nicotiana tabacum L. cv. TB-566 with N. alata Link et Otto. J Appl Genet 46(1):11–18
Laskowska D, Berbeć A (2010) TSWV resistance in DH lines of tobacco (Nicotiana tabacum L.) obtained from a hybrid between ‘Polalta’ and ‘Wiślica’. Plant Breed 129:731–733
Mandal B, Pappu HR, Culbreath AK, Holbrook CC, Todd JW (2002) Differential response of selected peanut (Arachis hypogaea) genotypes to mechanical inoculation by Tomato spotted wilt virus. Plant Dis 86:939–944
Moon H, Nicholson JS (2007) AFLP and SCAR markers linked to Tomato Spotted Wilt Virus resistance in tobacco. Crop Sci 47:1887–1894
Moury B, Palloix A, Gebre Selassie K, Marchoux G (1997) Hypersensitive resistance to tomato spotted wilt virus in three Capsicum chinense accessions is controlled by a single gene and is overcome by virulent strains. Euphytica 94:45–52
Moury B, Gebre Selassie K, Marchoux G, Daubèze A-M, Palloix A (1998) High temperature effects on hypersensitive resistance to tomato spotted wilt tospovirus (TSWV) in pepper (Capsicum chinense Jacq.). Eur J Plant Pathol 5:489–498
Mumford RA, Barker I, Wood KR (1996) The biology of the tospoviruses. Ann Appl Biol 128:159–183
Nagao T (1982) Somatic hybridization by fusion of protoplasts. Jpn J Crop Sci 51:35–42
Opoka B (1969) Odporność dzikich gatunków Nicotiana na Lycopersicum virus 3 (Brittlebank) Smith. (komunikat). Hodowla Roślin Aklimatyzacja i Nasiennictwo 13(1):83–87
Palakarcheva M, Yancheva A (1985) Inheritance of resistance to tomato spotted wilt virus (Lycopersicon virus 3 Smith) in tobacco following interspecific hybridization of Nicotiana tabacum and N. sanderae. Genet Sel 18:303–311
Palakarcheva M, Yancheva A (1989) Genetic sources of resistance to the tomato bronziness pathogen on tobacco in wild species of the genus Nicotiana (in Bulgarian). Genet Breed 22:473–479
Parella G, Gognalons P, Gebre–Selassie K, Vovlas C, Marchoux G (2003) An update of the host range of tomato spotted wilt virus. J Plant Pathol 85(4,Special issue):227–264
Patrascu M, Paunescu AD (1997) Transfer of the resistance to TSWV from Nicotiana alata to other tobacco cultivars using in vitro culture techniques. CORESTA Inf Bull 53
Pop IV (1979) Reaction of some Nicotiana sp. and tobacco varieties to artificial inoculation with tomato spotted wilt virus. Zeszyty Problemowe Postępów Nauk Rolniczych 226:17–26
Roggero P, Lisa V, Nervo G, Pennazio S (1996) Continuous high temperature can break the hypersensitivity of Capsicum chinense ‘PI 152225’ to tomato spotted wilt tospovirus (TSWV). Phytopathologia Mediterranea 35:117–120
Roggero P, Melani V, Ciuffo M, Tavella L, Tedeschi R, Stravato VM (1999) Two field isolates of tomato spotted wilt tospovirus overcome the hypersensitive response of the pepper (Capsicum annuum) hybrid with resistance introgressed from C. chinense PI152225. Plant Dis, Disease. Notes 83:965
Rosello S, Diez MJ, Nuez F (1998) Genetics of tomato spotted wilt virus resistance coming from Lycopersicon peruvianum. Eur J Plant Pathol 104:499–509
Rosello S, Ricarte B, Diez MJ, Nuez F (2001) Resistance to Tomato spotted wilt virus introgressed from Lycopersicon peruvianum in line UPV 1 may be allelic to Sw-5 and can be used to enhance the resistance of hybrid cultivars. Euphytica 119:357–367
Ruter JM, Gitaitis RD (1993) First report of tomato spotted wilt virus on bedding plants in Georgia. Plant Dis 77:101
Scott SW (2012) Host-list of tomato spotted wilt virus and impatient necrotic spot virus. Horticulture Clemson University http://www.clemson.edu/hort/sctop/bsec/hosts/hostlist.phb. Accessed 24 July 2012
Shcherbatenko IS, Oleshchenko LT (2006) Somaclonal variation as a source of tomato spotted wilt virus—resistance in plants. In: Cooper I et al (eds) Virus diseases and crop biosecurity. Springer, Dordrecht, pp 133–144
Skucińska G, Miszka W, Kruczkowska H (1977) Studies on the use of interspecific hybrids in tobacco breeding. I. Obtaining of fertile hybrids by propagation in vitro. Acta Biologica Cracoviensia Ser Botanica 20:81–88
Soler S, Díez MJ, Nuez F (1998) Effect of temperature regime and growth stage interaction on pattern of virus presence in tomato spotted wilt virus resistant accessions of Capsicum chinense. Plant Dis 82:1199–1204
Soler S, Diez MJ, Rosello S, Nuez F (1999) Movement and distribution of tomato spotted wilt virus in resistant and susceptible accessions of Capsicum spp. Can J Plant Pathol 21:317–325
Stevens MR, Scott SJ, Gergerich RC (1992) Inheritance of a gene for resistance to tomato spotted wilt virus (TSWV) from Lycopersicon peruvianum Mill. Euphytica 59:9–17
Stoyanova MP (1979) Resultats de L’Hybridation Entre les Especes Nicotiana tabacum L. et Nicotiana alata Link. Comptes rendus de l’Academie bulgare des Sciences 32(5):683–686
Tsakiridis JP, Gooding GV (1972) Tomato spotted wilt virus in Greece. Phytopatologia Mediterranea 11(1):42–47
Wijkamp I, Van Lent J, Kormelink R, Goldbach R, Peters D (1993) Multiplication of tomato spotted wilt virus in its insect vector, Frankliniella occidentalis. J Gen Virol 74:341–349
Yancheva A (1990) A possibility for transferring combined resistance to tomato spotted wilt virus and Thielaviopsis basicola to intercultivar tobacco hybrids (in Bulgarian). Genet Breed 23(3):194–199
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
About this article
Cite this article
Laskowska, D., Doroszewska, T., Depta, A. et al. A survey of Nicotiana germplasm for resistance to Tomato spotted wilt virus (TSWV). Euphytica 193, 207–219 (2013). https://doi.org/10.1007/s10681-013-0921-3
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s10681-013-0921-3