Abstract
A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.
Similar content being viewed by others
References
Bogenberger JM, Neumaier PS, Fittler F (1985) The muntjac satellite 1A sequence is composed of 31-base-pair internal repeats that are highly homologous to the 31-base-pair subrepeats of the bovine satellite 1.715. Eur J Biochem 148:55–59
Brinkley BR, Valdivia MM, Tousson A, Brenner SL (1984) Compound kinetochores of the Indian muntjac: evolution by linear fusion of unit kinetochores. Chromosoma 91:1–11
Carrano AV, Wolff S (1975) Distribution of sister chromatid exchanges in the euchromatin and heterochromatin of the Indian muntjac. Chromosoma 53:361–369
Comings DE (1971) Heterochromatin of the Indian muntjac. Exp Cell Res 67:441–460
Gosden JR, Lawrie SS, Cooke HJ (1981) A cloned repeated DNA sequence in human chromosome heteromorphisms. Cytogenet Cell Genet 29:32–39
Green RJ, Bahr GF (1975) Comparison of G-, Q-, and EM-banding patterns exhibited by the chromosome complement of the Indian muntjac, Muntiacus muntjac, with reference to nuclear DNA content and chromatin ultrastructure. Chromosoma 50:53–67
Lima-De-Faria A, Isaksson M, Olsson E (1980) Action of restriction endonucleases on the DNA and chromosomes of Muntiacus muntjac. Hereditas 92:267–273
Liming S, Yingying Y, Xingsheng D (1980) Comparative cytogenetic studies on the red muntjac, Chinese muntjac, and their f1 hybrids. Cytogenet Cell Genet 26:22–27
Liming S, Pathak S (1981) Gametogenesis in a male Indian muntjac x Chinese muntjac hybrid. Cytogenet Cell Genet 30:152–156
Messing J, Crea R, Seeburg PH (1981) A system for shotgun DNA sequencing. Nucleic Acids Res 9:309–321
Miklos GLG, John B (1979) Heterochromatin and satellite DNA in man: properties and prospects. Am J Hum Genet 31:264–280
Plucienniczak A, Skowronski J, Jaworski J (1982) Nucleotide sequence of bovine 1.715 satellite DNA and its relation to other bovine satellite sequences. J Mol Biol 158:293–304
Rigby PWJ, Dieckmann M, Rhodes C, Berg P (1977) Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase 1. J Mol Biol 113:237–251
Schmidtke J, Brennecke H, Schmid H, Neitzel H, Sperling K (1981) Evolution of muntjac DNA. Chromosoma 84:187–193
Singer MF (1982) Highly repeated sequences in mammalian genomes. Int Rev Cytol 76:67–112
Wurster DH, Benirschke K (1970) Indian muntjac, Muntiacus muntjac: a deer with a low diploid chromosome number. Science 168:1364–1366
Wurster DH, Atkin NB (1972) Muntjac chromosomes: a new karyotype for Muntiacus muntjac. Experientia 28:972–973
Author information
Authors and Affiliations
Rights and permissions
About this article
Cite this article
Yu, LC., Lowensteiner, D., Wong, E.F.K. et al. Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac. Chromosoma 93, 521–528 (1986). https://doi.org/10.1007/BF00386794
Received:
Issue Date:
DOI: https://doi.org/10.1007/BF00386794