KATARZYNA PIEKARSKA*¹, KATARZYNA ZACHARCZUK¹, MAGDALENA RZECZKOWSKA¹, TOMASZ WOŁKOWICZ¹, ALEKSANDRA JANUSZKIEWICZ¹, EDYTA PODSIADŁY², URSZULA DEMKOW^2,3 and RAFAŁ GIERCZYŃSKI¹

¹Department of Bacteriology, National Institute of Public Heath – National Institute of Hygiene, Warsaw, Poland
²Department of Laboratory Diagnostics and Clinical Immunology of Developmental Age, Public Pediatric Teaching Hospital, Warsaw, Poland
³Department of Laboratory Diagnostics and Clinical Immunology of Developmental Age, Medical University of Warsaw, Warsaw, Poland

*Corresponding author: K. Piekarska, Department of Bacteriology, National Institute of Public Heath – National Institute of Hygiene, Warsaw, Poland; e-mail: kpiekarska@pzh.gov.pl

Submitted 17 February 2015, revised 28 April 2015, accepted 28 April 2015
DOI: 10.5604/17331331.1185239

Abstract

We report the interspecies transfer of the bla_VIM-4 gene in MBL-producing Enterobacter cloacae and Klebsiella pneumoniae isolates from a newborn patient who had received meropenem therapy. We show evidence that gene bla_VIM-4 was transmitted as a part of the class‑1 integron on a ca. ~90 kb conjugative plasmid. High homology of nucleotide sequence was observed between the integron found in VIM-4 producing E. cloacae and K. pneumoniae strains tested and class‑1 integrons previously reporteded in Pseudomonas aeruginosa from Hungary and Poland. This finding may suggest P. aeruginosa as a potential source of acquired VIM-4 in Enterobacteriaceae.

Key words: Enterobacteriaceae, Enterobacter cloacae, Klebsiella pneumonia, MBL, VIM-4

Carbapenemase-producing bacteria are an increasing international public health threat (Canton et al., 2012). Metallo-β-lactamases (MBLs), which confer resistance to carbapenems have been detected worldwide in Gram-negative non-fermenting bacteria. More recently, MBLs became frequently reported among Enterobacteriaceae, in which these enzymes are encoded by genes located in transferable plasmids (Vatopoulos, 2008). Besides NDM (New Delhi MBL), the VIM-type (Verona integron-encoded MBLs) enzymes are the most important MBLs for epidemiological dissemination and clinical relevance. After the first detection of plasmid acquired VIM-4 in Pseudomonas aeruginosa in Greece in 2001 (Pournaras et al., 2002), VIM enzymes have been soon reported in many countries, including Poland, where VIM-2 and VIM-4 producing Pseudomonas spp. were observed (Fiett et al., 2006; Patzer et al., 2009). To the best of our knowledge, the first case of VIM-1 group producing Klebsiella pneumoniae in Poland was reported in 2010 by Sękowska from a 61 year-old patient admitted at a Teaching Hospital in Bydgoszcz, Poland (Sękowska at al., 2010a, 2010b). Until now, VIM-1, VIM-4 and VIM-35-producing Enterobacteriaceae were detected in our country (Castenheira et al., 2014).

Herein, we report VIM-4-producing Enterobacter cloacae and K. pneumoniae strains isolated in 2010 from newborn patient. We also show evidence arguing for the interspecies transmission of a conjugative plasmid carrying the bla_VIM-4 gene located as a part of class 1 integron.

Table I
Characteristics of VIM-4 producing clinical isolates of E. cloacae and K. pneumoniae together with the respective E. coli electrotransformants.

Strain	Species	Specimen	MBLb	MICa (mg l-1) of:
				CTX	CAZ	FEP	ATM	ETP	IPM	MEM	GEN	AMK	CIP	CST	TGC
ECV	E. cloacae (16.07.2010)	wound	+	>256	48	32	64	0.75	0.5	0.19	64	16	1.5	0.5	4
KPV	K. pneumoniae (21.07.2010)	stool	+	24	6	1.5	0.047	0.75	0.75	0.38	1	16	0.125	0.38	3
ET	E. coli DH5α	NA	–	0.023	0.25	0.016	0.032	0.004	0.125	0.016	0.125	0.25	0.023	0.094	0.38
ET-pEc90	E. coli DH5α	NA	+	12	6	0.38	0.047	0.125	0.75	0.38	0.5	12	0.012	0.125	0.38
ET-pKp90	E. coli DH5α	NA	+	16	4	0.38	0.032	0.19	0.75	0.125	0.25	6	0.016	0.125	0.38

^a Abbreviations: AMK, amikacin; ATM, aztreonam; CAZ, ceftazidime; CIP, ciprofloxacin; CST, colistin; CTX, cefotaxime; FEP, cefepime; ETP, ertapenem; GEN, gentamicin; IPM, imipenem; MEM, meropenem; TGC – tigecycline. NA – not applicable. ^b MBLs were detected as described previously (Franklin et al., 2006; Tato et al., 2010).

A one month-old male-newborn, that had been hospitalised in an tertiary maternity hospital was admitted to Intensive Care Unit (ICU) of a secondary children hospital in Warsaw, Poland on March 18, 2010 due to prematurity with extremely low birth weight and necrotising enterocolitis. During his stay in the ICU (till July 15, 2010), the newborn-patient received a broad-range antimicrobial-regimen, including meropenem. On 16 and 21 July, 2010, when the patient was at a surgery ward, E. cloacae and K. pneumoniae isolates with reduced susceptibility to ertapenem were collected. The both isolates were found to produce MBL-type carbapenemase (Table I) as shown by use of the phenotypic tests described previously by Franklin et al. (2006) and Tato et al. (2010). Detection of the bla_VIM gene and characterization of its environment were performed using conventional PCR mapping and DNA-sequencing with the primers listed in Table II.

Table II
Primers used for PCR mapping and sequencing of bla_VIM genes and their environment

Primer	Sequence 5´ – 3´	Reference
VIM-F	ATCATGGCTATTGCGAGTCC	In this study
VIM-R	ACGACTGAGCGATTTGTGTG
5´ -CS	GGCATCCAAGCACAAGC	Zhao et al. (2001)
3´ -CS	AAGCAGACTTGACTGAT
VIMA	CAACTCATCACCATCACGGACAAT	In this study
VIMB	GGGGAGCCGAGTGGTGAGTATC	In this study

The bla_VIM gene was located on ca. ~90kb plasmids named: pEc90 and pKp90, as shown by DNA/DNA Southern-blot with VIM-probe. The Southern-blot was conducted as previously described (Wardak et al., 2007). Both plasmids were separately transferred to Escherichia coli DH5α by electro-transformation (Zacharczuk et al., 2011), and MICs of the both transformants were determined (Table II). Restriction endonuclease PstI profiles of the pEc90 and pKp90 from the transformants were indistinguishable. DNA sequencing of the bla_VIM genes from pEc90 and pKp90 revealed VIM-4 variant. The ability for conjugational transfer of the both plasmids was exhibited, using a conventional liquid-medium mating-test with rifampicin-resistant E. coli CSH26 recipient strain. PCR mapping and DNA-sequencing (Zhao et al., 2001) shown the bla_VIM-4 gene was located as a part of the class 1 integron in pEc90 and pKp90. The class-1 integron found in the both plasmids carried two resistance gene‑cassettes, where in the first position was the aac(6´)-Ib gene (also named aacA4) followed by bla_VIM-4. Subsequent DNA-sequence analysis using blast-n (NCBI) revealed that the class-1 integron reported herein has 100% homology to integron found in P. aeruginosa (access. no. GU181265) from Hungary. Moreover, the class-1 integron reported herein in carbapenemase non-susceptible isolates of E. cloacae and K. pneumoniae, was probably closely related to the integron from P. aeruginosa (access. no. AJ585042) from Poland. The only difference were two point-mutations (T1670G and C1671T).

In conclusion, the evidence collected in our laboratory may strongly argue for the lateral transfer of the bla_VIM-4 gene between E. cloacae and K. pneumoniae isolates form the same patient. Similar findings were reported in 2002, by Luzzaro and colleagues (Luzzaro et al., 2004), who recovered VIM-4 producing strains of E. cloacae and K. pneumoniae from a 72-year-old patient that had received 4-weeks of imipenem therapy. Moreover, the nucleotide sequence of the class 1 integron that carries the bla_VIM-4 gene in the both Enterobacteriaceae strains described in this paper may suggest P. aeruginosa as a potential source of VIM-4.

Acknowledgements
This research was supported by internal-grant from NIZP-PZH (no. 3/EM/2015).

Literature

Cantón R., M. Akóva, Y. Carmeli, C.G. Giske, Y. Glupczynski, M. Gniadkowski, D.M. Livermore, V. Miriagou, T. Naas, G.M. Rossolini and others. 2012. Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clin. Microbiol. Infect. 18:413-431.

Castenheira M., S.E. Costello, L.N. Woosley, L.M. Despande, T.A. Davies and R.N. Jones. 2014. Evaluation of clonality and carbapenem resistance mechanisms among Acinetobacter baumannii–Acinetobacter calcoaceticus complex and Enterobacteriaceae isolates collected in European and Mediterranean countries and detection of two novel β-lactamases, GES-22 and VIM-35. Antimicrob. Agents Chemiother. 58:7358-7366.

Fiett J., A. Baraniak, A. Mrówka, M. Fleischer, Z. Drulis-Kawa, Ł. Naumiuk, A. Samet, W. Hryniewicz and M. Gnadkowski. 2006. Molecular Epidemiology of aquired-metallo-β-lactamase-producing bacteria in Poland. Antimicrob. Agents Chemiother. 50:880-886.

Franklin C., L. Liolios and A.Y. Peleg. 2006. Phenotypic detection of carbapenem-susceptible metallo-β-lactamase-producing gram-negative bacilli in clinical laboratory. J. Clin. Microbiol. 44:3139-3144.

Luzzaro F., J.-D. Docquier, C. Colinon, A. Endimiani, G. Lombardi, G. Amicosante, G.M. Rossolini and A. Toniolo. 2004. Emergence in Klebsiella pneumoniae and Enterobacter cloacae clinical isolates of the VIM-4 metallo-β-lactamase encoded by a conjugative plasmid. Antimicrob. Agents Chemother. 48:648-650.

Patzer J.A., T.R. Walsh, J. Weeks, D. Dzierżanowski and M.A. Teleman. 2009. Emergence and persistence of integron structures harbouring VIM genes In the Children´s Memorial Heath Institute, Warsaw, Poland, 1998-2006. J. Antimicrob. Chemother. 63:269-273.

Pournaras S., A. Tsakris, M. Maniati, L.S. Tzouvelekis and A.N. Maniatis. 2002. Novel variant bla_VIM-4 of the metallo-beta-lactamase gene bla_VIM-1 in a clinical strain of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 46:4026-4028.

Sękowska A., E. Gospodarek, E. Kruszyńska, W. Hryniewicz, M. Gniadkowski, W. Duljasz, K. Kusza and K. Wawrzyniak. 2010a. First isolation of metallo-β-lactamase producing Klebsiella pneumoniae strain in Poland. Anestezjol. Intens. Ter. 42:27-30.

Sękowska A., W. Hryniewicz, M. Gniadkowski, A. Deptuła, K. Kusza and E. Gospodarek. 2010b. Antimicrobial susceptibility of metallo-beta-lactamase positive and negative Klebsiella pneumoniae strains isolated from Intensive Care Unit patients. Pol. J. Microbiol. 59:67-69.

Tato M., M. Morosini, L. García, S. Albertí, M.T. Coque and R. Cantón. 2010. Carbapenem heteroresistance in VIM-1 producing Klebsiella pneumoniae isolates belonging to the same clone: consequences for routine susceptibility testing. J. Clin. Microbiol. 48:4089-4093.

Vatopoulos A. 2008. High rates of metallo-beta-lactamase-producing Klebsiella pneumoniae in Greece – a review of the current evidence. Euro Surveill. http://www.eurosurvellance.org/ViewArticle.aspx?Articled=8023, 2015.02.17.

Wardak S., J. Szych, A.A. Zasada and R. Gierczynski. 2007. Antimicrobial resistance of Campylobacter coli clinical isolates from Poland. Antimicrob. Agents Chemiother. 51:1123-1125.

Zacharczuk K., K. Piekarska, J. Szych, E. Zawidzka, A. Sulikowska, S. Wardak, M. Jagielski and R. Gierczyński. 2011. Emergence of Klebsiella pneumoniae coproducing KPC-2 and 16S rRNA methylase ArmA in Poland. Antimicrob. Agents Chemiother. 55:443-446.

Zhao S., D.G. White, B. Ge, S. Ayers, S. Friedman, L. English, D. Wagner, S. Gaines and J. Meng. 2001. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin-producing Escherichia coli isolates. Appl. Environ. Microbiol. 67:1558-1564.