Thirty two specific pathogen-free rats (half male and half female, obtained from the Experimental Animal Center of Guangdong Province, China), were randomly divided into 2 groups (16 rats in the experimental group, 16 in the control group). Average weight at the time of the experiment was 250 ± 20 g. Anesthesia was performed with intraperitoneal injection of 10% chloral hydrate 3 mL/kg.

The study and all procedures were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University, China.

Pancreatitis group: rats were fasted for 12 h before the operation. A 10 mm median laparotomy was made and the pancreas was well exposed. The pancreatic capsule was gently lifted up, and 3.8% Na taurocholate 1 mL/kg was injected beneath the pancreatic capsule and distributed by making a bubble of taurocholate, about 2-3 mm in diameter at every injection point. Several minutes later, the pancreatic tissue would become dark purple, swell, and bleed locally. Then the abdominal organs were gently repositioned, and the peritoneal cavity was douched with about 50 mL of normal saline. Finally the abdominal wall was sutured.

In the control group, rats were injected similarly with normal saline 1 mL/kg in place of Na taurocholate.

After surgery, rats were housed in a dry and clean room at a temperature of 20-26°C, and 12 h later standard chow and water were freely available. Mortality was observed and recorded every day.

Serum amylase and plasma endotoxin were detected by routine clinical chemistry methods. Serum amylase was measured at 3 time points, namely 6, 24 and 48 h. On the 4th and 7th days, plasma endotoxins of every live rat were measured.

FITC-Dextran (Sigma), a polysaccharide macromolecule with a fluorescent marker, fluorescein isothiocyanate, cannot be digested and absorbed when in the normal alimentary tract, but can pass through the damaged gut barrier into capillaries of the gut, and finally into the blood of the SMV when intestinal permeability is increased[6-9]. The concentration of FITC-Dextran in the SMV depends on the dose of the drug and the severity of gut barrier damage. In this study, rats were perfused with 1 mL of 0.5% FITC-Dextran through a small tube placed in the stomach via the mouth, and 12 h later SMV blood samples were taken to measure the FITC-Dextran concentration as follows: blood was centrifuged at 1000 r/min, the supernatant was obtained, and absorbance was detected on a spectrofluorometer (Thermo Ltd., USA) at an excitation wave of 490 nm and transmission wave of 520 nm; the concentration of FITC-Dextran was finally calculated according to the standard curve of FITC-Dextran.

One millilitre of blood from the inferior vena cava, 0.1 g mesenteric lymph node (MLN) tissue, 0.3 g pancreas tissue and 1 g liver tissue were taken from each rat under sterile conditions by laparotomy. Every sample had 1 mL saline added followed by homogenization by triturating, then uniform smearing on 4 brain heart solid culture medium (Hopebiotechnology Co. Ltd., Qingdao, China), 2 of which were placed in a 37°C thermostat, the other 2 were placed in an anaerobic jar, tightly closed and put in a 37°C thermostat. Results were observed and recorded 48 h later.

The same quantities of samples as above were taken for real-time PCR. Total bacterial genomic DNA was extracted by the DNeasy Blood & Tissue kit (Cat. 69506, Qiagen, USA) according to the manufacturer’s instructions. Li et al[10] confirmed the appropriateness and effectiveness of this kit for studying gut microbial ecology. The universal PCR primer sets for total bacteria (forward: TCCTACGGGAGGCAGCAGT; reverse: GGACTACCAGGGTATCTAATCCTGTT) used in this study were designed for a region in 16SrRNA and had been well demonstrated by other researchers to be uniformly successful in detecting a wide range of bacteria in samples of dentine[11] and feces[12]. Real-time PCR was performed with the ABI-Prism 7900 Sequence Detection System (Applied Biosystems, USA). The PCR reaction was performed in a total volume of 25 μL, containing SYBR Green Real-time PCR Master Mix (TOYOBO Inc., Japan) 12.5 μL, with 200 nmol/L of each of the forward and reverse primers and 2 ng of DNA for each reaction. The PCR reaction conditions for amplification of DNA were 95°C for 1 min and 40 cycles of 95°C for 20 s and 60°C for 1 min. Data analysis was performed using Sequence Detection Software supplied by Applied Biosystems.

The pancreas was cut, formalin-fixed and embedded in paraffin, and 4 μm sections were cut and stained with hematoxylin and eosin. The pancreatitis pathology score of every rat at both the 4th and 7th days were determined according to the severity of pancreatic damage by a pathologist using a double-blind method, according to the Schmidt Scoring Criteria[13] (Table 1).

The 4th day, which was the mid-term course of the illness, was chosen to determine the microstructural changes in the intestinal mucosa. In order to sample from the same intestinal location of all rats, a 2 cm section of the distal ileum (next to the ileocecal valve) was taken and quickly placed in fixative solution, and sent to the Electron Microscopy Center of Sun Yat-sen University for electron microscopy examination.

Daily observation of animal deaths was made for 7 d. The cumulative mortality rate was calculated daily.

Data were displayed as the mean ± SE. Statistical significance was calculated by one-way analysis of variance or the χ² test, using the Sigma Plot Software Package (Systat Software Inc, Point Richmond, Ca, USA).

Pancreatitis group: Several minutes after injection of taurocholate beneath the pancreatic capsule, the pancreas was found to become swollen, dark purple, with partial subcapsular hemorrhage. The rats took more time to wake after surgery than control rats, and were tired on the first day with reduced activity, no appetite, and slow responses. Conditions became worst on the 2nd and 3rd days, when some rats were lethargic, had conjunctival congestion or petechiae, abdominal distention and hyperventilation and some rats died. However after the 4th day, the surviving rats would always recover gradually.

Control group: Rats awoke soon after operation, recovered in 6-8 h with normal characteristics and activity. 24 h later the rats performed as normal, and with no deaths.

Uniformly distributed injections beneath the pancreatic capsule were successfully achieved in all animals and required an average of 15 ± 2 min per animal when the technique was well mastered. The cumulative death rate at 7 d in the pancreatitis group was about 30%, with most occurring on the 3rd and 4th days (about 80% of all), while no deaths occurred in the control group.

There were 2 main points of note during the operation. First, a puncture too deep into the pancreatic parenchyma could injure the pancreatic veins and cause direct bleeding, but simply pressing with aseptic gauze for a moment would stop this. Second, if the syringe needle pierced through the pancreatic capsule, or taurocholate bubbles under the pancreatic capsule burst, the taurocholate could go into the abdominal cavity and cause biliary peritonitis. However, as a whole, the operation itself was simple and safe, causing few complications.

Autopsies were carried out on dead rats. In all cases, much yellow or bloody exudate with a slight smell would come out of the peritoneal cavity when the abdomen was opened. The intestine would expand to 2-3 times of normal with gas and fluid inside and with a thinner wall. The pancreas was swollen and dark colored with some local hemorrhagic spots. Yellow-white saponified spots were always found in the peripancreatic omentum and retroperitoneum. The lower part of the spleen was always dark black. A pancreatic or hepatic abscess could be observed if the rat died after the 4th day or later.

In pancreatitis rats, compared with the control group, serum amylase began increasing 6 h after the operation, and the level reached a peak at 24 h, remaining higher than the control group 48 h later (Figure 1).

Open in New Tab   Full Size Figure   Download Figure

Figure 1 Amylase level in serum. Compared with control animals, serum amylase levels in severe acute pancreatitis (SAP) rats were higher at each time point (6, 24 and 48 h), ^bP < 0.01. At 24 h, the amylase level of the pancreatitis model reached a peak, and was higher than the other 2 time points, ^aP < 0.05.

Microscopic pancreatic damage was pronounced in pancreatitis animals in the first 48 h and showed a progressive disease course; 6 h after pancreatitis induction, typical pathological features were edema and hemorrhage (Figure 2B), while apparent leukocyte infiltration was observed 24 h after operation (Figure 2C), and areas of acinar cell necrosis could be observed 48 h after operation (Figure 2D). The control animals were observed without such abnormalities, and had normal pancreatic gland lobules and cells. (Figure 2A)

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Pancreatic pathology (HE, × 100). A: Normal pancreatic histology; B: Pancreatic damage induced 6 h after pancreatitis induction. Typical pathological features were edema and hemorrhage; C: Apparent leukocyte infiltration was observed 24 h after surgery; D: Pancreatic pathology induced 48 h after surgery, showing a confluent area of acinar cell necrosis.

On both the 4th and 7th days, pancreatitis pathology scores according to the Schmidt criteria were observed to be significantly higher in the pancreatitis group than in the control group in all 4 single aspects, as well as the total score (P < 0.01, Table 2), showing that significant damage had occurred in the pancreas of SAP rats.

The serum endotoxin level was a sign of intestinal permeability and pancreatitis severity. The plasma endotoxin levels in the pancreatitis group were about 5-7 times higher than that in the control group on both the 4th and 7th days (P < 0.01), though the level had decreased almost a half on the 7th day compared to the 4th day (Figure 3).

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Endotoxin level in serum. On the 4th and 7th days, the serum endotoxin level was markedly higher in the pancreatitis group compared to the control group, ^bP < 0.01.

FITC-Dextran concentration in the SMV was a sign of intestinal permeability. In this study, FITC-Dextran levels in the SMV of pancreatitis rats were observed to be significantly higher than that of control rats on both the 4th and 7th days (P < 0.01, Figure 4), indicating higher intestinal permeability in the pancreatitis rats.

Open in New Tab   Full Size Figure   Download Figure

Figure 4 FITC-Dextran (FD-40) levels of serum in the superior mesenteric vein (SMV). The serum level of FD-40 in SMV was significantly higher in the pancreatitis group than in the control group on the 4th and 7th days, ^bP < 0.01, though the level had decreased almost a half between days 4 and 7.

Microvilli of iliac mucosa in pancreatitis rats (Figure 5A) were shortened, about half the length of those of the control rats (Figure 5C), and with a loose structure, and some points had disappeared. Tight junctions and intermediate junctions of villous cells in SAP rats were unclear with discontinuities (Figure 5B), while intact and clear junctions between villous cells were seen in control rats (Figure 5D).

Open in New Tab   Full Size Figure   Download Figure

Figure 5 Distal iliac mucosa electron microscopy. A: Changes of microvilli in a SAP rat, showing loose, shortened microvilli, with some points lost (arrows) (Original magnification, × 28.5 K); B: Changes of the intermediate junction in a SAP rat, which was unclear with breakage in some parts (arrows) (× 15.5 K); C (× 28.5 K) and D (× 21.0 K) are representative electron microscopy images of the iliac mucosa in control rats, showing long, tight microvilli (arrow) and intact intermediate junctions (arrows).

The copies of translocated bacteria differed greatly among pancreatitis rats, sometimes by 10³ times, so it was difficult to define the statistics on bacterial numbers by the bacterial culture method. Therefore we chose the infection rate as a variable to compare the bacterial translocation in the 2 groups by the agar plate culture method. Results showed that infection rates of all the 4 types of organ were higher in the pancreatitis group than in the control group (P < 0.01). When comparison was made among the infected rats of the 4 kinds of organs, blood of the inferior vena cava was found to have the lowest rate (P < 0.05, Table 3).

The infection rates detected by real-time PCR were mainly the same as that by bacterial culture. Infection rates by the culture method in MLN and pancreas were a little higher than that by real-time PCR method (MLN 12 to 10, pancreas 15 to 13), which may result from contamination during culture. An advantage of the real-time PCR method was its accuracy of bacterial enumeration. In this study, the results of bacterial number had been transformed by log₁₀ for the purpose of better statistics. It was observed that the pancreas had the highest number of bacteria of the 4 kinds of organs (P < 0.05), which may relate to necrosis and hemorrhage in pancreas tissue as a good medium for bacteria breeding (Table 4).

Severe acute pancreatitis is associated with considerable mortality, as high as 30%-40%. Infection of pancreatic necrosis is regarded to be a main predictor of outcome during severe acute pancreatitis (SAP), and bacterial translocation of intestinal flora is considered to be the cause. Although a multitude of animal models have been used to study the mechanism of bacterial translocation, the exact origin, route, and mechanism of bacterial translocation causing infection of the necrotic pancreas are still unclear.

There are now many kinds of experimental models used to study bacterial translocation in acute pancreatitis (AP). However, an “ideal” animal model of SAP was lacking, and should encompass several features including easy reproducibility, ability to vary the severity of AP in a standardized manner, and similar morphology and pathophysiology to that of the human situation.

A new simple model of SAP in the rat was induced by Na taurocholate, and results showed that significant gut barrier damage and intestinal bacterial translocation occurred in this SAP rat model, with few potential study confounders and with a shorter induction time compared to other commonly used animal models of SAP, suggesting that it may be an appropriate animal model for the study of gut barrier damage and bacterial translocation in SAP.

In future, this simple taurocholate-induced rat model may be used in the study of SAP, especially to determine the exact origin, route, and mechanism of bacterial translocation causing infection of the necrotic pancreas.

Intestinal bacterial translocation: normally, intestinal bacteria cannot go through the gut barrier and into the blood or other organs. In the situation of SAP or other severe disease such as shock or major burns, the gut barrier would be damaged and the intestinal permeability increased, causing the intestinal bacteria to translocate from the gut to blood or even other distant organs and induce sepsis, septicemia or even death.

This is a well performed research trying to induce a new simple rat model of SAP, and results definitely showed it was an appropriate animal model for study of bacterial translocation in SAP, with significant gut barrier damage and intestinal bacterial translocation observed but with few potential confounders.