Cytokines, Serological, and Histopathological Assessment of Recombinant Vaccination Strategies for Combatting Infectious Bursal Disease in Broiler Chickens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. IBDV Vaccines and Vaccination Programs
2.3. IBD Virus and Challenge
2.4. Sampling
2.5. Clinical Signs, Growth Performance, Mortality, and Postmortem Lesions
2.6. Blood Biochemical and Serological Analysis
2.7. Real-Time PCR (qPCR)
2.8. Histopathology
2.9. Statistical Analysis
3. Results
3.1. Clinical Signs, Growth Performance, Mortality Rate, and Postmortem Lesions
3.2. Biochemical Analysis
3.3. IBDV Antibody Titer
3.4. Cytokine Gene Expression
3.5. Histopathology
3.5.1. Bursa
3.5.2. Thymus
3.5.3. Spleen
4. Discussion
5. Conclusions
Limitations of this Study
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Roh, J.-H.; Kang, M.; Wei, B.; Yoon, R.-H.; Seo, H.-S.; Bahng, J.-Y.; Kwon, J.-T.; Cha, S.-Y.; Jang, H.-K. Efficacy of HVT-IBD vector vaccine compared to attenuated live vaccine using in-ovo vaccination against a Korean very virulent IBDV in commercial broiler chickens. Poult. Sci. 2016, 95, 1020–1024. [Google Scholar] [CrossRef] [PubMed]
- Kibenge, F.S.; Dhillon, A.; Russell, R. Biochemistry and immunology of infectious bursal disease virus. J. Gen. Virol. 1988, 69, 1757–1775. [Google Scholar] [CrossRef] [PubMed]
- Lukert, P.; Saif, Y. Infectious bursal disease virus. In Disease of Poultry; Calnek, B.W., Ed.; Iowa State University Press: Ames, IA, USA, 1997. [Google Scholar]
- Berg, T.P.V.D. Acute infectious bursal disease in poultry: A review. Avian Pathol. 2000, 29, 175–194. [Google Scholar] [CrossRef] [PubMed]
- Prandini, F.; Simon, B.; Jung, A.; Pöppel, M.; Lemiere, S.; Rautenschlein, S. Comparison of infectious bursal disease live vaccines and a HVT-IBD vector vaccine and their effects on the immune system of commercial layer pullets. Avian Pathol. 2016, 45, 114–125. [Google Scholar] [CrossRef] [PubMed]
- Van den Berg, T.; Morales, D.; Eterradossi, N.; Rivallan, G.; Toquin, D.; Raue, R.; Zierenberg, K.; Zhang, M.; Zhu, Y.; Wang, C. Assessment of genetic, antigenic and pathotypic criteria for the characterization of IBDV strains. Avian Pathol. 2004, 33, 470–476. [Google Scholar] [CrossRef] [PubMed]
- Kannaki, T.; Priyanka, E.; Abhilash, M.; Haunshi, S. Co-administration of toll-like receptor (TLR)-3 agonist Poly I: C with different infectious bursal disease (IBD) vaccines improves IBD specific immune response in chicken. Vet. Res. Commun. 2021, 45, 285–292. [Google Scholar] [CrossRef] [PubMed]
- Müller, H.; Mundt, E.; Eterradossi, N.; Islam, M.R. Current status of vaccines against infectious bursal disease. Avian Pathol. 2012, 41, 133–139. [Google Scholar] [CrossRef]
- Taghavian, O.; Spiegel, H.; Hauck, R.; Hafez, H.M.; Fischer, R.; Schillberg, S. Protective oral vaccination against infectious bursal disease virus using the major viral antigenic protein VP2 produced in Pichia pastoris. PLoS ONE 2013, 8, e83210. [Google Scholar] [CrossRef]
- Sedeik, M.E.; El-Shall, N.A.; Awad, A.M.; Abd El-Hack, M.E.; Alowaimer, A.N.; Swelum, A.A. Comparative evaluation of HVT-IBD vector, immune complex, and live IBD vaccines against vvIBDV in commercial broiler chickens with high maternally derived antibodies. Animals 2019, 9, 72. [Google Scholar] [CrossRef]
- Bublot, M.; Pritchard, N.; Le Gros, F.-X.; Goutebroze, S. Use of a vectored vaccine against infectious bursal disease of chickens in the face of high-titred maternally derived antibody. J. Comp. Pathol. 2007, 137, S81–S84. [Google Scholar] [CrossRef]
- Darteil, R.; Bublot, M.; Laplace, E.; Bouquet, J.-F.; Audonnet, J.-C.; Rivière, M. Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce protection against an IBDV virulent challenge in chickens. Virology 1995, 211, 481–490. [Google Scholar] [CrossRef] [PubMed]
- Ignjatovic, J.; Gould, G.; Trinidad, L.; Sapats, S. Chicken recombinant antibodies against infectious bursal disease virus are able to form antibody–virus immune complex. Avian Pathol. 2006, 35, 293–301. [Google Scholar] [CrossRef] [PubMed]
- Dey, S.; Pathak, D.C.; Ramamurthy, N.; Maity, H.K.; Chellappa, M.M. Infectious bursal disease virus in chickens: Prevalence, impact, and management strategies. Vet. Med. Res. Rep. 2019, 10, 85–97. [Google Scholar] [CrossRef]
- Degen, W.G.; van Daal, N.; Rothwell, L.; Kaiser, P.; Schijns, V.E. Th1/Th2 polarization by viral and helminth infection in birds. Vet. Microbiol. 2005, 105, 163–167. [Google Scholar] [CrossRef]
- Rautenschlein, S.; Yeh, H.-Y.; Sharma, J. The role of T cells in protection by an inactivated infectious bursal disease virus vaccine. Vet. Immunol. Immunopathol. 2002, 89, 159–167. [Google Scholar] [CrossRef] [PubMed]
- Boo, S.Y.; Tan, S.W.; Alitheen, N.B.; Ho, C.L.; Omar, A.R.; Yeap, S.K. Transcriptome analysis of chicken intraepithelial lymphocyte natural killer cells infected with very virulent infectious bursal disease virus. Sci. Rep. 2020, 10, 18348. [Google Scholar] [CrossRef] [PubMed]
- Eldaghayes, I.; Rothwell, L.; Williams, A.; Withers, D.; Balu, S.; Davison, F.; Kaiser, P. Infectious bursal disease virus: Strains that differ in virulence differentially modulate the innate immune response to infection in the chicken bursa. Viral Immunol. 2006, 19, 83–91. [Google Scholar] [CrossRef]
- Huang, X.; Liu, W.; Zhang, J.; Liu, Z.; Wang, M.; Wang, L.; Zhou, H.; Jiang, Y.; Cui, W.; Qiao, X. Very virulent infectious bursal disease virus-induced immune injury is involved in inflammation, apoptosis, and inflammatory cytokines imbalance in the bursa of fabricius. Dev. Comp. Immunol. 2021, 114, 103839. [Google Scholar] [CrossRef]
- Xu, Z.-Y.; Yu, Y.; Liu, Y.; Ou, C.-B.; Zhang, Y.-H.; Liu, T.-Y.; Wang, Q.-X.; Ma, J.-Y. Differential expression of pro-inflammatory and anti-inflammatory genes of layer chicken bursa after experimental infection with infectious bursal disease virus. Poult. Sci. 2019, 98, 5307–5314. [Google Scholar] [CrossRef]
- Abou El-Fetouh, M.S.; Hafez, M.H.; El-Attar, E.-S.R.; El-Agamy, M.E.; Ali, A. Comparative bursal cytokine gene expression and apoptosis in vaccinated chickens following virulent infectious bursal disease virus challenge. Virology 2021, 558, 126–133. [Google Scholar] [CrossRef]
- Ali, B.H. Comparative immunologic and physiologic study of Broiler vaccinated with five different Gumboro vaccines: Balqees H. Ali, Emad J. Khammas. Iraqi J. Vet. Med. 2010, 34, 162–169. [Google Scholar] [CrossRef]
- Ameen, S.M.; Adel, A.; Selim, A.; Magouz, A.; AboElKhair, M.; Bazid, A.H. A multiplex real-time reverse transcription polymerase chain reaction assay for differentiation of classical and variant II strains of avian infectious bronchitis virus. Arch. Virol. 2022, 167, 2729–2741. [Google Scholar] [CrossRef] [PubMed]
- Aricibasi, M.; Jung, A.; Heller, E.D.; Rautenschlein, S. Differences in genetic background influence the induction of innate and acquired immune responses in chickens depending on the virulence of the infecting infectious bursal disease virus (IBDV) strain. Vet. Immunol. Immunopathol. 2010, 135, 79–92. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hao, X.; Li, S.; Li, J.; Yang, Y.; Qin, A.; Shang, S. An Anti-Tumor Vaccine Against Marek’s Disease Virus Induces Differential Activation and Memory Response of γδ T Cells and CD8 T Cells in Chickens. Front. Immunol. 2021, 12, 645426. [Google Scholar] [CrossRef]
- Liu, H.; Zhang, M.; Han, H.; Yuan, J.; Li, Z. Comparison of the expression of cytokine genes in the bursal tissues of the chickens following challenge with infectious bursal disease viruses of varying virulence. Virol. J. 2010, 7, 364. [Google Scholar] [CrossRef]
- Adu-Asiamah, P.; Zhang, Y.; Amoah, K.; Leng, Q.Y.; Zheng, J.H.; Yang, H.; Zhang, W.L.; Zhang, L. Evaluation of physiological and molecular responses to acute heat stress in two chicken breeds. Animal 2021, 15, 100106. [Google Scholar] [CrossRef]
- Bancroft, J.D.; Layton, C. The hematoxylins and eosin. Bancroft’s Theory Pract. Histol. Tech. 2012, 7, 173–186. [Google Scholar]
- Teshome, M.; Fentahunand, T.; Admassu, B. Infectious bursal disease (Gumboro disease) in Chickens. Br. J. Poult. Sci. 2015, 4, 22–28. [Google Scholar]
- Rashid, M.; Luo, H.; Akhter, J.; Islam, M.; Islam, M.; Rahman, M.; Cao, Y.; Xue, C. Protection effect of Vaxxitek HVT+ IBD vaccine against infectious bursal disease in broiler chickens. Progress. Agric. 2013, 24, 69–78. [Google Scholar] [CrossRef]
- Zhuo, Z.; Chen, M.; Zhou, Z.; Chen, M. Discussion on the causes for the outbreaks of IBD in immunized chicken flocks. Chin. J. Vet. Med. 1998, 24, 14. [Google Scholar]
- Le Gros, F.; Dancer, A.; Giacomini, C.; Pizzoni, L.; Bublot, M.; Graziani, M.; Prandini, F. Field efficacy trial of a novel HVT-IBD vector vaccine for 1-day-old broilers. Vaccine 2009, 27, 592–596. [Google Scholar] [CrossRef] [PubMed]
- Alam, J.; Rahman, M.; Sil, B.; Khan, M. Giasuddin, and MSK Sarker. Effect of maternally derived antibody on vaccination against infectious bursal disease (Gumboro) with live vaccine in broiler. Int. J. Poult. Sci. 2002, 1, 98–102. [Google Scholar]
- Knoblich, H.; Sommer, S.; Jackwood, D. Antibody titers to infectious bursal disease virus in broiler chicks after vaccination at one day of age with infectious bursal disease virus and Marek’s disease virus. Avian Dis. 2000, 44, 874–884. [Google Scholar] [CrossRef] [PubMed]
- Goddard, R.; Wyeth, P.; Varney, W. Vaccination of commercial layer chicks against infectious bursal disease with maternally derived antibodies. Vet. Rec. 1994, 135, 273–274. [Google Scholar] [CrossRef] [PubMed]
- Zorman Rojs, O.; Krapež, U.; Slavec, B.; Juršič-Cizerl, R.; Poljanec, T. Field efficacy of different vaccines against infectious bursal disease in broiler flocks. Acta Vet. Hung. 2011, 59, 385–398. [Google Scholar] [CrossRef] [PubMed]
- Chansiripornchai, N.; Sasipreeyajan, J. Comparison of the efficacy of the immune complex and conventionally live vaccine in broilers against infectious bursal disease infection. Thai J. Vet. Med. 2009, 39, 115–120. [Google Scholar] [CrossRef]
- Chang, H.-C.; Lin, T.-L.; Wu, C.-C. DNA vaccination with plasmids containing various fragments of large segment genome of infectious bursal disease virus. Vaccine 2003, 21, 507–513. [Google Scholar] [CrossRef]
- Chang, H.C.; Lin, T.L.; Wu, C.C. DNA-mediated vaccination against infectious bursal disease in chickens. Vaccine 2001, 20, 328–335. [Google Scholar] [CrossRef]
- Lemiere, S.; Gauthier, J.-C.; Kodjo, A.; Vinit, L.; Delvecchio, A.; Prandini, F. Evaluation of the Protection against Infectious Bursal Disease (IBD) Challenge in Progeny Born to Parents Having Received a Vaccination Program Using a Herpesvirus of Turkey-Infectious Bursal Disease (HVT-IBD) Vector Vaccine. World J. Vaccines 2013, 3, 31505. [Google Scholar] [CrossRef]
- Bose, R.K.; Hossain, K.M.; Sil, B.K.; Taimur, M.; Pugliese, C.; Franci, O. Comparative sero evaluation of live and killed Gumboro vaccine in broilers. Ital. J. Anim. Sci. 2003, 2, 157–162. [Google Scholar] [CrossRef]
- Schijns, V.E.; van de Zande, S.; Lupiani, B.; Reddy, S.M. Practical aspects of poultry vaccination. In Avian Immunology; Elsevier: Amsterdam, The Netherlands, 2014; pp. 345–362. [Google Scholar]
- Wyeth, P.; Chettle, N. Use of infectious bursal disease vaccines in chicks with maternally derived antibodies. Vet. Rec. 1990, 126, 577–578. [Google Scholar] [PubMed]
- Zahid, B.; Aslam, A.; Qazi, J.; Ahmad, N.; Ara, C.; Akhtar, R.; Bacha, U. Pathogenicity and immunosuppressive effect of different vaccines of Infectious Bursal Disease virus. JAPS J. Anim. Plant Sci. 2017, 27, 1183–1189. [Google Scholar]
- Tsukamoto, K.; Saito, S.; Saeki, S.; Sato, T.; Tanimura, N.; Isobe, T.; Mase, M.; Imada, T.; Yuasa, N.; Yamaguchi, S. Complete, long-lasting protection against lethal infectious bursal disease virus challenge by a single vaccination with an avian herpesvirus vector expressing VP2 antigens. J. Virol. 2002, 76, 5637–5645. [Google Scholar] [CrossRef] [PubMed]
- Tsukamoto, K.; Kojima, C.; Komori, Y.; Tanimura, N.; Mase, M.; Yamaguchi, S. Protection of chickens against very virulent infectious bursal disease virus (IBDV) and Marek’s disease virus (MDV) with a recombinant MDV expressing IBDV VP2. Virology 1999, 257, 352–362. [Google Scholar] [CrossRef] [PubMed]
- Tsukamoto, K.; Sato, T.; Saito, S.; Tanimura, N.; Hamazaki, N.; Mase, M.; Yamaguchi, S. Dual-viral vector approach induced strong and long-lasting protective immunity against very virulent infectious bursal disease virus. Virology 2000, 269, 257–267. [Google Scholar] [CrossRef] [PubMed]
- Rautenschlein, S.; Yeh, H.; Sharma, J. Comparative immunopathogenesis of mild, intermediate, and virulent strains of classic infectious bursal disease virus. Avian Dis. 2003, 47, 66–78. [Google Scholar] [CrossRef]
- Jin, X.; Ogg, G.; Bonhoeffer, S.; Safrit, J.; Vesanen, M.; Bauer, D.; Chen, D.; Cao, Y.; Demoitie, M.-A.; Zhang, L. An antigenic threshold for maintaining human immunodeficiency virus type 1-specific cytotoxic T lymphocytes. Mol. Med. 2000, 6, 803–809. [Google Scholar] [CrossRef]
- Rauf, A.; Khatri, M.; Murgia, M.V.; Saif, Y.M. Expression of perforin–granzyme pathway genes in the bursa of infectious bursal disease virus-infected chickens. Dev. Comp. Immunol. 2011, 35, 620–627. [Google Scholar] [CrossRef]
- Tanimura, N.; Sharma, J. Appearance of T cells in the bursa of Fabricius and cecal tonsils during the acute phase of infectious bursal disease virus infection in chickens. Avian Dis. 1997, 41, 638–645. [Google Scholar] [CrossRef]
- Kaiser, P.; Rothwell, L.; Galyov, E.E.; Barrow, P.A.; Burnside, J.; Wigley, P. Differential cytokine expression in avian cells in response to invasion by Salmonella typhimurium, Salmonella enteritidis and Salmonella gallinarum. Microbiology 2000, 146, 3217–3226. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.-J.; Karaca, K.; Pertile, T.; Erickson, S.; Sharma, J. Enhanced expression of cytokine genes in spleen macrophages during acute infection with infectious bursal disease virus in chickens. Vet. Immunol. Immunopathol. 1998, 61, 331–341. [Google Scholar] [CrossRef] [PubMed]
- Boyman, O.; Sprent, J. The role of interleukin-2 during homeostasis and activation of the immune system. Nat. Rev. Immunol. 2012, 12, 180–190. [Google Scholar] [CrossRef]
- Jang, D.-i.; Lee, A.-H.; Shin, H.-Y.; Song, H.-R.; Park, J.-H.; Kang, T.-B.; Lee, S.-R.; Yang, S.-H. The role of tumor necrosis factor alpha (TNF-α) in autoimmune disease and current TNF-α inhibitors in therapeutics. Int. J. Mol. Sci. 2021, 22, 2719. [Google Scholar] [CrossRef] [PubMed]
- Hersperger, A.R.; Pereyra, F.; Nason, M.; Demers, K.; Sheth, P.; Shin, L.Y.; Kovacs, C.M.; Rodriguez, B.; Sieg, S.F.; Teixeira-Johnson, L. Perforin expression directly ex vivo by HIV-specific CD8+ T-cells is a correlate of HIV elite control. PLoS Pathog. 2010, 6, e1000917. [Google Scholar] [CrossRef] [PubMed]
- Kuerten, S.; Nowacki, T.M.; Kleen, T.O.; Asaad, R.J.; Lehmann, P.V.; Tary-Lehmann, M. Dissociated production of perforin, granzyme B, and IFN-γ by HIV-specific CD8+ cells in HIV infection. AIDS Res. Hum. Retroviruses 2008, 24, 62–71. [Google Scholar] [CrossRef] [PubMed]
- Campbell, T.; Coles, E. Avian clinical pathology. Vet. Clin. Pathol. 1986, 4, 279–300. [Google Scholar]
- Sultan, H.; Hussein, H.A.; Abd El-Razik, A.G.; El-Balall, S.; Talaat, S.M.; Shehata, A.A. Efficacy of HVT-IBDV vector vaccine against recent Egyptian vvIBDV in commercial broiler chickens. Int. J. Poult. Sci. 2012, 11, 710. [Google Scholar] [CrossRef]
- Kumar, K.; Singh, K.; Prasad, C. Immune responses to intermediate strain IBD vaccine at different levels of maternal antibody in broiler chickens. Trop. Anim. Health Prod. 2000, 32, 357. [Google Scholar] [CrossRef]
Gene | Primer Sequence | Annealing Tm | Accession NO/Reference |
---|---|---|---|
IFN-γ | F: TGCCTGCAGAAGAAGCCTCG R: GACGGGCTCAAAAACCTCCT | 60 | FJ977575.1 [26] |
TNF-α | F: TTCTGGGACCACTGTATGCTCTT R:TACCGACAAAGTGAGAATCAATCAG | 60 | MF000729.1 [26] |
Granzyme A | F: CAGACCAGCACCAGTCATCA R: TCCCGTTCTCATCCATCTTCTC | 60 | NM_204457.1 [26] |
Perforin | F: CTCCCGATGAACGACTTGAG R: CTGAGACTGGCTCCTTTTCC | 60 | KC551799.1 [26] |
Il 2 | F: CGCTCAGAACGACGTCAA R: GTCGTCCACACCAACGAG | 60 | AF000631.1 [27] |
IL10 | F: CACCCGCACCAAAAGATGAAG R: CGCCTCCTGGAAAACACACAAC | 62 | NM_001004414.2 [28] |
IL1B | F: CCTGATACTTCCTGGAGATTTGTGC R: TTTTTGTCCGTGAATGGGCTC | 62 | NM_204524.1 [28] |
GAPDH | F: TGCCATCACAGCCACACAGAAG R: ACTTTCCCCACAGCCTTAGCAG | 60 | AF047874.1 [27] |
CN | CP | Vac1 | Vac2 | Vac3 | |
---|---|---|---|---|---|
IBW | 41.00 ± 1.00 | 41.33 ± 0.88 | 41.00 ± 1.00 | 40.33 ± 0.88 | 40.67 ± 0.33 |
FBW | 1910 ± 55.68 b | 1610 ± 32.15 c | 2170 ± 36.06 a | 2280 ± 52.92 a | 1900 ± 20.82 b |
BWG | 1869.00 ± 55.33 b | 1568.67 ± 31.48 c | 2129.00 ± 37.03 a | 2239.67 ± 52.79 a | 1859.33 ± 21.14 b |
FI | 2878.00 ± 91.77 c | 3839.00 ± 114.53 a | 3525.33 ± 89.29 ab | 3686.33 ± 93.45 ab | 3473.67 ± 107.11 b |
FCR | 1.54 ± 0.012 c | 2.45 ± 0.029 a | 1.66 ± 0.044 c | 1.65 ± 0.032 c | 1.87 ± 0.078 b |
Parameter | Time | CN | CP | Vac1 | Vac2 | Vac3 |
---|---|---|---|---|---|---|
AST | Pre-challenge | 15.6 ± 1.15 b | 16.6 ± 1.15 Bab | 19.66 ± 3.05 ab | 19.33 ± 0.57 ab | 21.66 ± 9.07 a |
Post-challenge | 16 ± 2 b | 25 ± 2.5 Aa | 20 ± 1.5 ab | 22.6 ± 3.5 ab | 26 ± 4.35 a | |
ALT | Pre-challenge | 21.66 ± 5.68 abc | 22 ± 1 Bab | 20.33 ± 2.5 abc | 17 ± 6.24 c | 23.33 ± 5.85 a |
Post-challenge | 21 ± 3.46 abc | 28.66 ± 3.41 Aa | 21.33 ± 3.21 abc | 19 ± 1 c | 27.66 ± 2.5 a | |
Total Protein | Pre-challenge | 3.85 ± 0.92 | 3.9 ± 0.01 | 3.3 ± 0.85 | 3.6 ± 0.01 | 4.2 ± 0.56 |
Post-challenge | 3.5 ± 0.01 | 4.4 ± 3.12 | 3.7 ± 0.01 | 3.1 ± 0.56 | 4.1 ± 0.01 | |
Albumin | Pre-challenge | 1.09 ± 0.13 | 1.35 ± 0.2 | 1.17 ± 0.07 | 1.36 ± 0.18 | 1.22 ± 0.27 |
Post-challenge | 1.14 ± 0.12 | 1.25 ± 0.25 | 1.2 ± 0.08 | 1.19 ± 0.28 | 1.5 ± 0.19 | |
Globulin | Pre-challenge | 2.47 ± 0.75 | 3.01 ± 0.45 | 2.09 ± 0.61 | 2.47 ± 0.48 | 2.5 ± 0.62 |
Post-challenge | 2.42 ± 0.51 | 2.97 ± 1.28 | 2.29 ± 0.18 | 2.14 ± 0.3 | 2.6 ± 0.44 | |
Creatinine | Pre-challenge | 0.51 ± 0.1 | 0.55 ± 0.08 | 0.48 ± 0.11 | 0.5 ± 0.11 | 0.55 ± 0.03 |
Post-challenge | 0.53 ± 0.1 | 0.52 ± 0.03 | 0.52 ± 0.14 | 0.6 ± 0.1 | 0.64 ± 0.08 | |
Uric Acid | Pre-challenge | 7.96 ± 1.68 b | 7.46 ± 1.76 Bb | 10.16 ± 2.26 a | 9.5 ± 0.6 a | 8.43 ± 0.7 Bb |
Post-challenge | 8.2 ± 1.15 b | 11.63 ± 2.9 Aa | 10.43 ± 1.96 a | 10.4 ± 0.95 a | 11.26 ± 1.1 Aa |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gewaily, M.S.; El-Khyat, F.; Tahoon, A.E.; Al-Rasheed, M.; Abdo, S.E.; Gado, A.; Elmasry, M.; Ismail, M.M. Cytokines, Serological, and Histopathological Assessment of Recombinant Vaccination Strategies for Combatting Infectious Bursal Disease in Broiler Chickens. Vaccines 2024, 12, 27. https://doi.org/10.3390/vaccines12010027
Gewaily MS, El-Khyat F, Tahoon AE, Al-Rasheed M, Abdo SE, Gado A, Elmasry M, Ismail MM. Cytokines, Serological, and Histopathological Assessment of Recombinant Vaccination Strategies for Combatting Infectious Bursal Disease in Broiler Chickens. Vaccines. 2024; 12(1):27. https://doi.org/10.3390/vaccines12010027
Chicago/Turabian StyleGewaily, Mahmoud S., Fares El-Khyat, Abd Elnaby Tahoon, Mohammed Al-Rasheed, Safaa E. Abdo, Ahmed Gado, Mohamed Elmasry, and Mahmoud M. Ismail. 2024. "Cytokines, Serological, and Histopathological Assessment of Recombinant Vaccination Strategies for Combatting Infectious Bursal Disease in Broiler Chickens" Vaccines 12, no. 1: 27. https://doi.org/10.3390/vaccines12010027