Particulate Matter Induced Adverse Effects on Eye Development in Zebrafish (Danio rerio) Embryos
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Zebrafish Husbandry and Embryo Collection
2.3. Particulate Matter (PM) Preparation and Treatment
2.4. Mortality, Heartbeat, Hatching, and Malformation Rate Analysis
2.5. Body Length, Yolk Sac Area, and Cardiac Area Analysis
2.6. Eye Morphology Analysis
2.7. Total Reactive Oxygen Species (ROS) Evaluation
2.8. RT-qPCR
2.9. Statistical Analysis
3. Results
3.1. Particulate Matter (PM) Induced Toxicity in Zebrafish Embryos
3.2. Particulate Matter (PM) Induced Eye Development Alteration in Zebrafish Embryos
3.3. Particulate Matter (PM) Increased Oxidative Stress in Zebrafish Embryos
3.4. Particulate Matter (PM) Induced mRNA Expression Alteration in Eyes of Zebrafish Embryos
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- WHO. Review of Evidence on Health Aspects of Air Pollution; World Health Organization: Geneva, Switzerland, 2013. [Google Scholar]
- Hamanaka, R.B.; Mutlu, G.M. Particulate Matter Air Pollution: Effects on the Cardiovascular System. Front. Endocrinol. 2018, 9, 680. [Google Scholar] [CrossRef] [PubMed]
- WHO. Ambient (Outdoor) Air Quality and Health. Available online: https://www.who.int/zh/news-room/fact-sheets/detail/ambient-(outdoor)-air-quality-and-health (accessed on 1 November 2023).
- Torricelli, A.A.M.; Novaes, P.; Matsuda, M.; Braga, A.; Saldiva, P.H.N.; Alves, M.R.; Monteiro, M.L.R. Correlation between Signs and Symptoms of Ocular Surface Dysfunction and Tear Osmolarity with Ambient Levels of Air Pollution in a Large Metropolitan Area. Cornea 2013, 32, e11–e15. [Google Scholar] [CrossRef] [PubMed]
- WHO. Air Quality Guidelines for Particulate Matter, Ozone, Nitrogen Dioxide and Sulphur Dioxide. Global Update 2005; World Health Organization: Geneva, Switzerland, 2006; Volume 38, p. E90038. Available online: https://www.who.int/publications/i/item/WHO-SDE-PHE-OEH-06.02 (accessed on 1 November 2023).
- Li, T.; Yu, Y.; Sun, Z.; Duan, J. A comprehensive understanding of ambient particulate matter and its components on the adverse health effects based from epidemiological and laboratory evidence. Part. Fibre Toxicol. 2022, 19, 67. [Google Scholar] [CrossRef]
- Santibañez, D.A.; Ibarra, S.; Matus, P.; Seguel, R. A five-year study of particulate matter (PM2.5) and cerebrovascular diseases. Environ. Pollut. 2013, 181, 1–6. [Google Scholar]
- Fu, J.; Jiang, D.; Lin, G.; Liu, K.; Wang, Q. An ecological analysis of PM2.5 concentrations and lung cancer mortality rates in China. BMJ Open 2015, 5, e009452. [Google Scholar] [CrossRef]
- Duan, J.; Hu, H.; Zhang, Y.; Feng, L.; Shi, Y.; Miller, M.R.; Sun, Z. Multi-organ toxicity induced by fine particulate matter PM 2.5 in zebrafish (Danio rerio) model. Chemosphere 2017, 180, 24–32. [Google Scholar] [CrossRef]
- Brook, R.D.; Rajagopalan, S.; Pope, C.A., III; Brook, J.R.; Bhatnagar, A.; Diez-Roux, A.V.; Holguin, F.; Hong, Y.; Luepker, R.V.; Mittleman, M.A.; et al. Particulate Matter Air Pollution and Cardiovascular Disease. Circulation 2010, 121, 2331–2378. [Google Scholar] [CrossRef]
- Li, R.; Kou, X.; Xie, L.; Cheng, F.; Geng, H. Effects of ambient PM2.5 on pathological injury, inflammation, oxidative stress, metabolic enzyme activity, and expression of c-fos and c-jun in lungs of rats. Environ. Sci. Pollut. Res. 2015, 22, 20167–20176. [Google Scholar] [CrossRef]
- Bekki, K.; Ito, T.; Yoshida, Y.; He, C.; Arashidani, K.; He, M.; Sun, G.; Zeng, Y.; Sone, H.; Kunugita, N.; et al. PM 2.5 collected in China causes inflammatory and oxidative stress responses in macrophages through the multiple pathways. Environ. Toxicol. Pharmacol. 2016, 45, 362–369. [Google Scholar] [CrossRef]
- Saxena, R.; Srivastava, S.; Trivedi, D.; Anand, E.; Joshi, S.; Gupta, S.K. Impact of environmental pollution on the eye. Acta Ophthalmol. Scand. 2003, 81, 491–494. [Google Scholar] [CrossRef]
- Lin, H.; Guo, Y.; Ruan, Z.; Yang, Y.; Chen, Y.; Zheng, Y.; Cummings-Vaughn, L.A.; Rigdon, S.E.; Vaughn, M.G.; Sun, S.; et al. Ambient PM2.5 and O3 and their combined effects on prevalence of presbyopia among the elderly: A cross-sectional study in six low- and middle-income countries. Sci. Total Environ. 2019, 655, 168–173. [Google Scholar] [CrossRef] [PubMed]
- Moen, B.E.; Norbäck, D.; Wieslander, G.; Bakke, J.; Magerøy, N.; Granslo, J.; Irgens, Å.; Bråtveit, M.; Hollund, B.; Aasen, T. Can air pollution affect tear film stability? A cross-sectional study in the aftermath of an explosion accident. BMC Public Health 2011, 11, 235. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.K.; Gupta, V.; Joshi, S.; Tandon, R. Subclinically Dry Eyes in Urban Delhi: An Impact of Air Pollution? Ophthalmologica 2002, 216, 368–371. [Google Scholar] [CrossRef]
- Mimura, T.; Ichinose, T.; Yamagami, S.; Fujishima, H.; Kamei, Y.; Goto, M.; Takada, S.; Matsubara, M. Airborne particulate matter (PM2.5) and the prevalence of allergic conjunctivitis in Japan. Sci. Total Environ. 2014, 487, 493–499. [Google Scholar] [CrossRef] [PubMed]
- Hong, J.; Zhong, T.; Li, H.; Xu, J.; Ye, X.; Mu, Z.; Lu, Y.; Mashaghi, A.; Zhou, Y.; Tan, M.; et al. Ambient air pollution, weather changes and outpatient visits for allergic conjunctivitis: A retrospective registry study. Sci. Rep. 2016, 6, 23858. [Google Scholar] [CrossRef]
- Raldúa, D.; Piña, B. In vivo zebrafish assays for analyzing drug toxicity. Expert Opin. Drug Metab. Toxicol. 2014, 10, 685–697. [Google Scholar] [CrossRef]
- Hill, A.; Mesens, N.; Steemans, M.; Xu, J.J.; Aleo, M.D. Comparisons between in vitro whole cell imaging and in vivo zebrafish-based approaches for identifying potential human hepatotoxicants earlier in pharmaceutical development. Drug Metab. Rev. 2012, 44, 127–140. [Google Scholar] [CrossRef]
- Kim, J.Y.; Lee, E.Y.; Choi, I.; Kim, J.; Cho, K.H. Effects of the Particulate Matter2.5 (PM2.5) on Lipoprotein Metabolism, Uptake and Degradation, and Embryo Toxicity. Mol. Cells 2015, 38, 1096–1104. [Google Scholar] [CrossRef] [PubMed]
- Bibliowicz, J.; Tittle, R.K.; Gross, J.M. Toward a better understanding of human eye disease insights from the zebrafish, Danio rerio. Prog. Mol. Biol. Transl. Sci. 2011, 100, 287–330. [Google Scholar]
- Westerfield, M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish. 2000. Available online: http://zfin.org/zf_info/zfbook/zfbk.html (accessed on 1 November 2023).
- Huang, L.; Wang, C.; Zhang, Y.; Wu, M.; Zuo, Z. Phenanthrene causes ocular developmental toxicity in zebrafish embryos and the possible mechanisms involved. J. Hazard. Mater. 2013, 261, 172–180. [Google Scholar] [CrossRef]
- Kim, K.T.; Zaikova, T.; Hutchison, J.E.; Tanguay, R.L. Gold nanoparticles disrupt zebrafish eye development and pigmentation. Toxicol. Sci. 2013, 133, 275–288. [Google Scholar] [CrossRef] [PubMed]
- McCurley, A.T.; Callard, G.V. Characterization of housekeeping genes in zebrafish: Male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol. Biol. 2008, 9, 102. [Google Scholar] [CrossRef]
- Tang, R.; Dodd, A.; Lai, D.; McNabb, W.C.; Love, D.R. Validation of zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochim. Biophys. Sin. 2007, 39, 384–390. [Google Scholar]
- Jonasova, K.; Kozmik, Z. Eye evolution: Lens and cornea as an upgrade of animal visual system. Semin. Cell Dev. Biol. 2008, 19, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, D.-E. Animal Eyes; Oxford University Press: New York, NY, USA, 2002. [Google Scholar]
- Walls, G.L. The Vertebrate Eye and Its Adaptive Radiation; Cranbrook Institute of Science; Cranbrook Press: Toowoomba, QLD, Australia, 1942. [Google Scholar]
- Ain, N.U.; Qamar, S.U.R. Particulate Matter-Induced Cardiovascular Dysfunction: A Mechanistic Insight. Cardiovasc. Toxicol. 2021, 21, 505–516. [Google Scholar] [CrossRef] [PubMed]
- Bhatnagar, A. Cardiovascular Effects of Particulate Air Pollution. Annu. Rev. Med. 2022, 73, 393–406. [Google Scholar] [CrossRef]
- Wang, C.; Zhu, G.; Zhang, L.; Chen, K. Particulate matter pollution and hospital outpatient visits for endocrine, digestive, urological, and dermatological diseases in Nanjing, China. Environ. Pollut. 2020, 261, 114205. [Google Scholar] [CrossRef]
- Ziou, M.; Tham, R.; Wheeler, A.J.; Zosky, G.R.; Stephens, N.; Johnston, F.H. Outdoor particulate matter exposure and upper respiratory tract infections in children and adolescents: A systematic review and meta-analysis. Environ. Res. 2022, 210, 112969. [Google Scholar] [CrossRef]
- Flood-Garibay, J.A.; Méndez-Rojas, M.; Pérez-Cortés, E.J. Respiratory immune system and consequences due to particulate matter in air pollution. Rev. Méd. Inst. Mex. Seguro Soc. 2019, 57, 170–180. [Google Scholar]
- Zou, Y.; Jin, C.; Su, Y.; Li, J.; Zhu, B. Water soluble and insoluble components of urban PM2.5 and their cytotoxic effects on epithelial cells (A549) in vitro. Environ. Pollut. 2016, 212, 627–635. [Google Scholar] [CrossRef]
- Son, J.-Y.; Lee, H.J.; Koutrakis, P.; Bell, M.L. Pregnancy and lifetime exposure to fine particulate matter and infant mortality in Massachusetts, 2001–2007. Am. J. Epidemiol. 2017, 186, 1268–1276. [Google Scholar] [CrossRef]
- Strähle, U.; Scholz, S.; Geisler, R.; Greiner, P.; Hollert, H.; Rastegar, S.; Schumacher, A.; Selderslaghs, I.; Weiss, C.; Witters, H.; et al. Zebrafish embryos as an alternative to animal experiments—A commentary on the definition of the onset of protected life stages in animal welfare regulations. Reprod. Toxicol. 2012, 33, 128–132. [Google Scholar] [CrossRef]
- Vincent, F.; Loria, P.; Pregel, M.; Stanton, R.; Kitching, L.; Nocka, K.; Doyonnas, R.; Steppan, C.; Gilbert, A.; Schroeter, T.; et al. Developing predictive assays: The phenotypic screening “rule of 3”. Sci. Transl. Med. 2015, 7, 293ps15. [Google Scholar] [CrossRef]
- Zhang, H.; Yao, Y.; Chen, Y.; Yue, C.; Chen, J.; Tong, J.; Jiang, Y.; Chen, T. Crosstalk between AhR and wnt/β-catenin signal pathways in the cardiac developmental toxicity of PM2.5 in zebrafish embryos. Toxicology 2016, 355, 31–38. [Google Scholar] [CrossRef]
- Kruk, J.; Kubasik-Kladna, K.; Aboul-Enein, H.Y. The role oxidative stress in the pathogenesis of eye diseases: Current status and a dual role of physical activity. Mini Rev. Med. Chem. 2016, 16, 241–257. [Google Scholar] [CrossRef] [PubMed]
- Meng, Y.; Zhong, K.; Xiao, J.; Huang, Y.; Wei, Y.; Tang, L.; Chen, S.; Wu, J.; Ma, J.; Cao, Z.; et al. Exposure to pyrimethanil induces developmental toxicity and cardiotoxicity in zebrafish. Chemosphere 2020, 255, 126889. [Google Scholar] [CrossRef] [PubMed]
- Kleinjan, D.A.; Bancewicz, R.M.; Gautier, P.; Dahm, R.; Schonthaler, H.B.; Damante, G.; Seawright, A.; Hever, A.M.; Yeyati, P.L.; van Heyningen, V.; et al. Subfunctionalization of duplicated zebrafish pax6 genes by cis-regulatory divergence. PLoS Genet. 2008, 4, e29. [Google Scholar] [CrossRef] [PubMed]
- Vopalensky, P.; Kozmik, Z. Eye evolution: Common use and independent recruitment of genetic components. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 2819–2832. [Google Scholar] [CrossRef]
- Bilotta, J.; Saszik, S.; Sutherland, S.E. Rod contributions to the electroretinogram of the dark-adapted developing zebrafish. Dev. Dyn. 2001, 222, 564–570. [Google Scholar] [CrossRef]
- Huang, L.; Zuo, Z.; Zhang, Y.; Wu, M.; Lin, J.J.; Wang, C. Use of toxicogenomics to predict the potential toxic effect of Benzo(a)pyrene on zebrafish embryos: Ocular developmental toxicity. Chemosphere 2014, 108, 55–61. [Google Scholar] [CrossRef]
- Shi, Q.; Wang, Z.; Chen, L.; Fu, J.; Han, J.; Hu, B.; Zhou, B. Optical toxicity of triphenyl phosphate in zebrafish larvae. Aquat. Toxicol. 2019, 210, 139–147. [Google Scholar] [CrossRef] [PubMed]
- Klopp, N.; Favor, J.; Löster, J.; Lutz, R.B.; Neuhäuser-Klaus, A.; Prescott, A.; Pretsch, W.; A Quinlan, R.; Sandilands, A.; Vrensen, G.F.; et al. Three murine cataract mutants (Cat2) are defective in different γ-crystallin genes. Genomics 1998, 52, 152–158. [Google Scholar] [CrossRef] [PubMed]
Gene | Nucleotide Sequence | Gene ID | |
---|---|---|---|
actb1 | Forward | 5′ CTATGAGCTGCCTGACGGTC 3′ | NM_131031.2 |
Reverse | 5′ ATGTCCACGTCGCACTTCAT 3′ | ||
atoh8 | Forward | 5′ TACGGCCGTAGACATGAGGA 3′ | NM_001079991.2 |
Reverse | 5′ CAACACAACCCGCTCCAAAG 3′ | ||
cryaa | Forward | 5′ CTTCCGCAACATCCTGGACT 3′ | NM_152950.2 |
Reverse | 5′ TTTCTCCATGCTTGCCCTGG 3′ | ||
crybb1 | Forward | 5′ CGATGCCAAGGAGAAGGGAG 3′ | NM_173231.2 |
Reverse | 5′ CGCTCACAAACGTTCATGCA 3′ | ||
vsx1 | Forward | 5′ TTTTCTCCCGAGCCACATCC 3′ | NM_131333.1 |
Reverse | 5′ GGTGAAAACTGTCCTGTGCC 3′ | ||
pax6a | Forward | 5′ ACCTTCCTATGCAACCCAGC 3′ | NM_131304.1 |
Reverse | 5′ GGCACTTGAACGGGTACAGA 3′ | ||
pax6b | Forward | 5′ GAACCAGAGACGACAAGCCA 3′ | NM_131641.1 |
Reverse | 5′ TTGGCCATAGTGAAGCTGGG 3′ | ||
rho | Forward | 5′ GCCTTCCTCATCTGCTGGTT 3′ | NM_131084.1 |
Reverse | 5′ AGGGTGGTGATCATGCAGTG 3′ | ||
sod2 | Forward | 5′ CGTGTGCTAACCAAGACCCT 3′ | NM_199976.1 |
Reverse | 5′ GGAAACGCTCGCTGACATTC 3′ | ||
cat | Forward | 5′ GTGCATGCATGACAACCAGG 3′ | NM_130912.2 |
Reverse | 5′ CGCTCTCTCTCGGCTTCATT 3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Priyadarshana, D.G.C.E.; Cheon, J.; Lee, Y.; Cha, S.-H. Particulate Matter Induced Adverse Effects on Eye Development in Zebrafish (Danio rerio) Embryos. Toxics 2024, 12, 59. https://doi.org/10.3390/toxics12010059
Priyadarshana DGCE, Cheon J, Lee Y, Cha S-H. Particulate Matter Induced Adverse Effects on Eye Development in Zebrafish (Danio rerio) Embryos. Toxics. 2024; 12(1):59. https://doi.org/10.3390/toxics12010059
Chicago/Turabian StylePriyadarshana, Dalawalla G. Charith E., Jayeon Cheon, Yoonsung Lee, and Seon-Heui Cha. 2024. "Particulate Matter Induced Adverse Effects on Eye Development in Zebrafish (Danio rerio) Embryos" Toxics 12, no. 1: 59. https://doi.org/10.3390/toxics12010059