Identification of QTLs Conferring Resistance to Bacterial Diseases in Rice
Abstract
:1. Introduction
2. Results
2.1. BBS Resistance of Parents and Offspring
2.2. BLS Resistance of Parents and Offspring
2.3. BPB Resistance of Parents and Offspring
2.4. QTL Localization and Analysis
2.5. Expression Analysis of Disease Resistance-Related Genes
3. Discussion
4. Materials and Methods
4.1. Parents and RIL Population
4.2. Linkage Map Construction and QTL Mapping
4.3. Germination and Cultivation of Rice Seeds
4.4. Pathogenicity Tests of Parents and Offspring
4.5. QTL Localization and Analysis
4.6. Quantitative Analysis of Gene Expression
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ontoy, J.C.E.; Bruno, J.S.; Shrestha, B.K.; Barphagha, I.; Ham, J.H. Dissection and characterization of rice disease resistance to bacterial panicle blight via QTL mapping and RNA-seq approaches. Phytopathology 2022, 112, 169. [Google Scholar]
- Bogdanove, A.J.; Koebnik, R.; Lu, H.; Furutani, A.; Angiuoli, S.V.; Patil, P.B.; Van Sluys, M.A.; Ryan, R.P.; Meyer, D.F.; Han, S.W.; et al. Two new complete genome sequences offer insight into host and tissue specificity of plant pathogenic Xanthomonas spp. J. Bacteriol. 2011, 193, 5450–5464. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Afolabi, O.; Amoussa, R.; Bilé, M.; Oludare, A.; Gbogbo, V.; Poulin, L.; Koebnik, R.; Szurek, B.; Silué, D. First Report of Bacterial Leaf Blight of Rice Caused by Xanthomonas oryzae pv. oryzae in Benin. Plant Dis. 2015, 100, 515. [Google Scholar] [CrossRef]
- Ham, J.H.; Melanson, R.A.; Rush, M.C. Burkholderia glumae: Next major pathogen of rice? Mol. Plant Pathol. 2011, 12, 329–339. [Google Scholar] [CrossRef]
- Cui, Z.; Ojaghian, M.R.; Tao, Z.; Kakar, K.U.; Zeng, J.; Zhao, W.; Duan, Y.; Vera Cruz, C.M.; Li, B.; Zhu, B.; et al. Multiplex pcr assay for simultaneous detection of six major bacterial pathogens of rice. J. Appl. Microbiol. 2016, 120, 1357–1367. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diallo, A.; Zougrana, S.; Sawadogo, M.; Kone, D.; Silue, D.; Szurek, B.; Wonni, I.; Hutin, M. First Report of Bacterial Leaf Streak Disease of Rice Caused by Xanthomonas oryzae pv. oryzicola in Ivory Coast. Plant Dis. 2022, 106, 1747. [Google Scholar] [CrossRef]
- Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar] [CrossRef] [Green Version]
- Rao, Y.C.; Jiao, R.; Wang, S.; Wu, X.; Ye, H.; Pan, C.; Li, S.; Xin, D.; Zhou, W.; Dai, G.; et al. SPL36 encodes a receptor-like protein kinase that regulates programmed cell death and defense responses in rice. Rice 2021, 14, 34–47. [Google Scholar]
- Xu, J.M.; Pan, C.Y.; Lin, H.; Ye, H.; Wang, S.; Lu, T.; Chen, Q.; Yang, K.; Lu, M.; Qian, Q.; et al. A rice XANTHINE DEHYDROGENASE gene regulates leaf senescence and response to abiotic stresses. Crop J. 2022, 10, 310–322. [Google Scholar] [CrossRef]
- Bryan, G.T.; Wu, K.-S.; Farrall, L.; Jia, Y.; Hershey, H.P.; McAdams, S.A.; Faulk, K.N.; Donaldson, G.K.; Tarchini, R.; Valent, B. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 2000, 12, 2033–2046. [Google Scholar] [CrossRef]
- Fukuoka, S.; Saka, N.; Koga, H.; Ono, K.; Shimizu, T.; Ebana, K.; Hayashi, N.; Takahashi, A.; Hirochika, H.; Okuno, K.; et al. Loss of function of a proline-containing protein confers durable disease resistance in rice. Science 2009, 325, 998–1001. [Google Scholar] [CrossRef] [PubMed]
- Mizobuchi, R.; Sato, H.; Fukuoka, S.; Tsushima, S.; Imbe, T.; Yano, M. Identification of qRBS1, a QTL involved in resistance to bacterial seedling rot in rice. Theor. Appl. Genet. 2013, 126, 2417–2425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mizobuchi, R.; Sato, H.; Fukuoka, S.; Tanabata, T.; Tsushima, S.; Imbe, T.; Yano, M. Mapping a quantitative trait locus for resistance to bacterial grain rot in rice. Rice 2013, 6, 13. [Google Scholar] [CrossRef] [Green Version]
- Mizobuchi, R.; Sato, H.; Fukuoka, S.; Tsushima, S.; Yano, M. Fine mapping of RBG2, a quantitative trait locus for resistance to Burkholderia glumae, on rice chromosome 1. Mol. Breed. 2015, 35, 15. [Google Scholar] [CrossRef] [Green Version]
- Pinson, S.R.M.; Shahjahan, A.K.M.; Rush, M.C.; Growth, D.E. Bacterial panicle blight resistance QTLs in rice and their association with other disease resistance loci and heading date. Crop Sci. 2010, 50, 1287–1297. [Google Scholar] [CrossRef]
- Tang, D.; Wu, W.; Li, W.; Lu, H.; Worland, A.J. Mapping of QTLs conferring resistance to bacterial leaf streak in rice. Theor. Appl. Genet. 2000, 101, 286–291. [Google Scholar] [CrossRef]
- Chen, S. Mapping Resistance QTLs to Rice Bacterial Leaf Streak (Xanthomonas Campestris pv. oryzicola dye) by SSR; Fujian Agriculture and Forestry University: Fuzhou, China, 2002. [Google Scholar]
- Chen, Z.W.; Wu, W.R.; Jing, Y.J.; Zhou, Y.C. The validation of quantitative trait locus underlying the resistance to rice bacterial leaf streak using near-isogenic line. J. Fujian Agric. For. Univ. (Nat. Sci. Edit.) 2005, 34, 273–277. [Google Scholar]
- Zheng, J.S.; Li, Y.Z.; Fang, X.J. Detection of QTL conferring resistance to bacterial leaf streak in rice chromosome 2 (O. sativa L. spp. indica). Sci. Agric. Sin. 2005, 38, 1923–1925. [Google Scholar]
- Li, F.T. Fine Mapping of QTL qBLSR5A, a QTL for Resistance to Bacterial Leaf Streak, Using Chromosome Segment Substitution Lines in Rice; Fujian Agriculture and Forestry University: Fuzhou, China, 2010. [Google Scholar]
- Chen, Z.W.; Jing, Y.J.; Li, X.H.; Zhou, Y.C.; Diao, Z.J.; Li, S.P.; Wu, W.R. Verification and more precise mapping of a QTL qBlsr5a underlying resistance to bacterial leaf streak in rice. Fujian Agric. For. Univ. (Nat. Sci. Edit.) 2006, 35, 619–622. [Google Scholar]
- Han, Q.D.; Chen, Z.W.; Deng, Y.; Lan, T.; Guan, H.Z.; Duan, Y.L.; Zhou, Y.C.; Lin, M.C.; Wu, W.R. Fine Mapping of qBlsr5a, a QTL for Resistance to Bacterial Leaf Streak and Expression Analysis of Candidate Genes in Rice; Fujian Agriculture and Forestry University: Fuzhou, China, 2008. [Google Scholar]
- Cao, J.L.; Chen, Z.W.; Lin, D.G.; Wu, W.; Xie, X. Verification of QTL qBlsr3d conferring resistance to bacterial leaf streak in rice by constructing SSSL. Mol. Plant Breed. 2014, 12, 416–420. [Google Scholar]
- Ma, L.; Fang, Y.; Xiao, S.Q.; Zhou, C.; Jin, Z.L.; Ye, W.L.; Rao, Y.C. QTL exploration of bacterial leaf streak and their gene-expression in rice. Chin. Bull. Bot. 2018, 53, 468–476. [Google Scholar]
- Wang, Y.X.; Shang, L.G.; Yu, H.; Zeng, L.; Hu, J.; Ni, S.; Rao, Y.; Li, S.; Chu, J.; Meng, X. A strigolactone biosynthesis gene contributed to the green revolution in rice. Mol. Plant 2020, 13, 923–932. [Google Scholar] [CrossRef] [PubMed]
- Zarbafi, S.S.; Ham, J.H. An overview of rice QTLs associated with disease resistance to three major rice diseases: Blast, Sheath blight, and Bacterial panicle blight. Agronomy 2019, 9, 177. [Google Scholar] [CrossRef] [Green Version]
- Guo, L.J.; Mao, Q.; Wang, W.; Li, M.; Peng, X.Y.; Chen, L. Transformation of a NBS-LRR protein gene and its overexpression in rice. J. Xiamen Univ. (Nat. Sci. Edit.) 2010, 49, 552–557. [Google Scholar]
- Zhao, T.T. Functional Identification of OsPDRH9N Protein with NB-ARC Domain and Its Expression in Stress Response; Xiamen University: Xiamen, China, 2012. [Google Scholar]
- Hittalmani, S.; Parco, A.; Mew, T.V.; Zeigler, R.S.; Huang, N. Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice. Theor. Appl. Genet. 2000, 100, 1121–1128. [Google Scholar] [CrossRef]
- Zhu, B.; Lou, M.M.; Huai, Y.; Xie, G.L.; Luo, J.Y.; Xu, L.H. Isolation and identification of Burkholderia glumae from symptomless rice seeds. Rice Sci. 2008, 15, 145–149. [Google Scholar] [CrossRef]
- Cui, Z.Q.; Zhu, B.; Xie, G.L.; Li, B.; Huang, S.W. Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Sci. 2016, 23, 111–118. [Google Scholar]
- Lin, Y.N.; Mi, D.; Hou, Y.Y.; Lin, M.J.; Xie, Q.B.; Niu, X.L.; Chen, Y.H.; He, C.Z.; Tao, J.; Li, C.X. Systematic analysis of the roles of c-di-GMP signaling in Xanthomonas oryzae pv. oryzae virulence. FEMS Microbiol. Lett. 2022, 369, fnac068. [Google Scholar] [CrossRef]
- Li, B.; Wang, X.X.; Chen, J.; Liu, H.; Ali, K.A.; Wang, Y.L.; Qiu, W.; Sun, G.C. IcmF and DotU are required for the virulence of Acidovorax oryzae strain RS-1. Arch. Microbiol. 2018, 200, 897–910. [Google Scholar] [CrossRef]
- Wang, S.; Ye, H.F.; Li, S.F.; Jiang, J.J.; Zhang, Y.; Pan, C.Y.; Zhou, W.Y.; Chen, W.X.; Wang, K.X.; Dai, G.X.; et al. QTL mapping and analysis of candidate genes in flag leaf morphology in rice. Sci. Sin. Vitae 2021, 51, 567–578. [Google Scholar] [CrossRef]
- Wen, Y. Genetic Analysis and Fine Mapping of Two Leaf Shape Genes in Rice (Oryza sativa L.); Zhejiang Normal University: Jinhua, China, 2019. [Google Scholar]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, W.; Feng, Q.; Yu, H.; Huang, X.; Zhao, Q.; Xing, Y.; Yu, S.; Han, B.; Zhang, Q. Parent-independent genotyping for constructing an ultrahigh-density linkage map based on population sequencing. Proc. Natl. Acad. Sci. USA 2010, 107, 10578–10583. [Google Scholar] [CrossRef] [PubMed]
- Arends, D.; Prins, P.; Jansen, R.C.; Broman, K.W. R/qtl: High-throughput multiple QTL mapping. Bioinformatics 2010, 26, 2990–2992. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, H.H.; Lelis, T.P.; Ontoy, J.; Bruno, J.; Seo, Y.S. Four Burkholderia glumae Strains Isolated from Rice Fields in the United States. Mol. Plant Microbe Interact. 2021, 34, 1324–1327. [Google Scholar] [CrossRef]
- Qian, G.; Liu, C.; Wu, G.; Yin, F.; Zhao, Y.; Zhou, Y.; Zhang, Y.; Song, Z.; Fan, J.; Hu, B.; et al. AsnB, regulated by diffusible signal factor and global regulator Clp, is involved in aspartate metabolism, resistance to oxidative stress and virulence in Xanthomonas oryzae pv. oryzicola. Mol. Plant Pathol. 2013, 14, 145–157. [Google Scholar] [CrossRef]
- Fang, Y.; Wang, H.; Liu, X.; Xin, D.; Rao, Y.; Zhu, B. Transcriptome analysis of Xanthomonas oryzae pv. oryzicola exposed to H2O2 reveals horizontal gene transfer contributes to its oxidative stress response. PLoS ONE 2019, 14, e0218844. [Google Scholar] [CrossRef]
- Li, B.; Liu, B.; Yu, R.; Tao, Z.; Wang, Y.; Xie, G.; Li, H.; Sun, G. Bacterial brown stripe of rice in soil-less culture system caused by Acidovorax avenae subsp. avenae in China. J. Gen. Plant Pathol. 2011, 77, 64–67. [Google Scholar] [CrossRef]
- Ren, Y.; Rao, Y.C.; Huang, L.C.; Leng, Y.J.; Hu, J.; Lu, M.; Zhang, G.H.; Zhu, L.; Gao, Z.; Dong, G.J.; et al. Fine mapping identifies new QTL for brown rice rate in rice (Oryza sativa L.). Rice 2016, 9, 4. [Google Scholar] [CrossRef] [Green Version]
QTL Name | Chromosome | Physical Distance | Genetic Interval | LOD Score | QTL Name | Chromosome | Physical Distance | Genetic Interval | LOD Score |
---|---|---|---|---|---|---|---|---|---|
qBPB-1 | 1 | 42,450,343–42,636,696 | 181.97–182.77 | 2.02 | qBLS-12.2 | 12 | 11,975,136–13,018,138 | 51.33–55.81 | 2.59 |
qBPB-3 | 3 | 23,749,047–23,915,724 | 101.81–102.52 | 2.91 | qBLS-12.3 | 12 | 21,305,692–25,499,574 | 91.33–109.31 | 4.65 |
qBPB-4 | 4 | 3,556,084–4,739,169 | 15.24–20.32 | 2.69 | qBBS-1.1 | 1 | 1,144,806–1,279,149 | 4.91–5.48 | 2.70 |
qBPB-5 | 5 | 17,071,562–18,494,867 | 73.18–79.28 | 2.73 | qBBS-1.2 | 1 | 25,257,953–25,619,150 | 108.27–109.82 | 2.47 |
qBPB-7.1 | 7 | 17,343,649–17,971,153 | 74.35–77.04 | 2.97 | qBBS-1.3 | 1 | 36,814,552–40,697,439 | 157.81–174.46 | 4.33 |
qBPB-7.2 | 7 | 26,679,743–28,828,922 | 114.37–123.58 | 3.44 | qBBS-2.1 | 2 | 8,837,300–9,896,262 | 37.88–42.42 | 3.67 |
qBPB-8 | 8 | 7,782,000–15,039,076 | 91.69–92.96 | 2.16 | qBBS-2.2 | 2 | 15,749,688–21,552,527 | 67.51–92.38 | 2.78 |
qBPB-9 | 9 | 11,221,823–11,673,523 | 33.36–64.47 | 2.88 | qBBS-2.3 | 3 | 30,854,578–31,600,900 | 132.26–135.46 | 2.78 |
qBPB-10 | 10 | 21,388,530–21,685,143 | 48.10–50.04 | 2.08 | qBBS-5.1 | 5 | 7,739,685–7,809,379 | 33.17–33.47 | 2.83 |
qBLS-1 | 1 | 38,012,068–40,318,380 | 145.04–150.46 | 2.61 | qBBS-5.2 | 5 | 9,887,145–10,057,827 | 42.38–43.11 | 2.88 |
qBLS-3.1 | 3 | 481,634–6,654,517 | 2.06–28.53 | 4.24 | qBBS-5.3 | 5 | 14,743,764–15,400,737 | 63.20–66.02 | 2.28 |
qBLS-3.2 | 3 | 24,844,011–25,165,251 | 106.50–107.50 | 2.77 | qBBS-6.1 | 6 | 4,835,127–6,452,921 | 20.73–27.66 | 2.84 |
qBLS-4 | 4 | 19,355,336–22,843,728 | 82.97–97.92 | 4.67 | qBBS-6.2 | 6 | 28,764,720–28,969,988 | 123.30–124.18 | 2.21 |
qBLS-5 | 5 | 7,138,974–7,289,610 | 30.60–31.25 | 2.79 | qBBS-7 | 7 | 10,110,871–13,852,811 | 43.34–59.38 | 2.48 |
qBLS-6 | 6 | 8,390,140–10,074,318 | 35.97–43.19 | 3.67 | qBBS-8 | 8 | 37,535–1,676,678 | 0.16–7.19 | 2.97 |
qBLS-7 | 7 | 21,897,341–24,428,396 | 93.87–104.72 | 3.73 | qBBS-9 | 9 | 14,761,639–16,192,828 | 63.27–69.41 | 2.24 |
qBLS-8.1 | 8 | 820,014–1,451,568 | 3.52–6.22 | 3.25 | qBBS-10 | 10 | 17,947,130–19,722,649 | 76.93–84.54 | 2.55 |
qBLS-8.2 | 8 | 25,566,791–25,809,447 | 109.60–110.64 | 3.00 | qBBS-11 | 11 | 419,178–1,236,632 | 1.79–5.30 | 2.58 |
qBLS-9 | 9 | 16,921,413–17,073,957 | 72.54–73.19 | 2.68 | qBBS-12.1 | 12 | 17,494,749–18,004,877 | 75.00–77.18 | 2.59 |
qBLS-12.1 | 12 | 26,231–4,961,252 | 0.11–21.27 | 4.84 | qBBS-12.2 | 12 | 23,219,979–23,404,674 | 99.53–100.32 | 2.26 |
BPB | BBS | BLS | |||
---|---|---|---|---|---|
Gene ID | Putative Function | Gene ID | Putative Function | Gene ID | Putative Function |
LOC_Os02g18000 | disease resistance protein RGA2 | LOC_Os01g65800 | powdery mildew resistant protein 5, putative, expressed | LOC_Os03g10900 | disease resistance protein |
LOC_Os07g29600 | zinc finger, C3HC4 type, domain containing protein | LOC_Os01g68330 | antigen peptide transporter-like 1, chloroplast precursor | LOC_Os03g10910 | NB-ARC/LRR disease resistance protein |
LOC_Os07g29820 | NBS-LRR disease resistance protein | LOC_Os01g68630 | leaf senescence related protein | LOC_Os03g11010 | resistance-associated macrophage protein |
LOC_Os09g13570 | bZIP transcription factor | LOC_Os02g32160 | methyl esterase-like gene | LOC_Os03g11340 | leucine-rich repeat resistance protein, putative, expressed |
LOC_Os09g14010 | disease resistance protein RPS2 | LOC_Os02g32980 | Germin-like protein | LOC_Os04g32850 | Rice blast resistance gene |
LOC_Os09g14490 | TIR-NBS type disease resistance protein | LOC_Os05g25770 | WRKY transcription factor | LOC_Os12g06920 | NBS-LRR disease resistance protein |
LOC_Os09g16000 | Rice blast resistance gene | LOC_Os06g10660 | Lysin motif-containing proteins | LOC_Os12g09240 | NBS-LRR disease resistance protein |
LOC_Os09g21796 | OsFBX327—F-box domain containing protein | LOC_Os09g25060 | WRKY transcription factor | LOC_Os12g39620 | disease resistance protein, putative, expressed |
LOC_Os09g25060 | WRKY transcription factor | LOC_Os09g25070 | WRKY transcription factor | LOC_Os12g40570 | WRKY transcription factor |
Disease | Chromosome | Materials | Marker Interval | Phenotypic Variance (%) | Reference |
---|---|---|---|---|---|
BPB | 1 | RILs developed from the cross of Lemont and TeQing | RG236-C112x | 3.6 | [15] |
7 | RILs developed from the cross of Lemont and TeQing | BCD855-CDO497 | 2.8 | [15] | |
10 | 44 CSSLs developed from the cross of Nona Bokra and Koshihikari | RM474-RM7361 | 22 | [12] | |
BLS | 3 | The near-isogenic line H359R developed from the cross of H359R Acc8558 and H359 | RM231–RM7 | / | [18] |
4 | RILs developed from the cross of H359 and Acc8558 | C624-C246 | / | [16] | |
4 | DH developed from the cross of TN1 and CJ06 | RM252-RM241 | 10.1937 | [24] |
Gene ID | Forward Primer(5′-3′) | Reverse Primer(5′-3′) |
---|---|---|
OsActin1 | TGGCATCTCTCAGCACATTCC | TGCACAATGGATGGGTCAGA |
LOC_Os01g65800 | CCGGAAATGGGAGAATGCTG | GCAAACCTCCAGCCTCAAAA |
LOC_Os01g68330 | GTTGGACAGGAACCTAGGCT | AGCCCACTCCACTTCTTCAT |
LOC_Os03g10900 | TCGGCCTCAGATACCTCAAC | CGTTCCTTGGTATGCTGTCG |
LOC_Os03g10910 | GCGTCCGATCTTTGAAGTCC | CTTGTTCGGGTGGTCATGG |
LOC_Os03g11010 | TCTATGCCACTGAAGTCCGG | CGGAGGCGAGAATACAGTGA |
LOC_Os03g11340 | GGTCCTTTCCCTACAGCAGT | GAATGGGCCCTGTCAACTTG |
LOC_Os04g32850 | GCGATGCCAAGATCAGGAAG | CCCTGTTGTTCTTCACGTCG |
LOC_Os12g06920 | TTGGTGCACTGGGTCAATTG | CCATCGCAGGGAGTACATCT |
LOC_Os12g09240 | ACTCACTCCTCACCAAGCTC | TCAAGCTCATCCATGCATGC |
LOC_Os12g39620 | GCGGCTCTTTCTGTCTTCTG | CGCACCGATAACCTTCAGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fang, Y.; Ding, D.; Gu, Y.; Jia, Q.; Zheng, Q.; Qian, Q.; Wang, Y.; Rao, Y.; Mao, Y. Identification of QTLs Conferring Resistance to Bacterial Diseases in Rice. Plants 2023, 12, 2853. https://doi.org/10.3390/plants12152853
Fang Y, Ding D, Gu Y, Jia Q, Zheng Q, Qian Q, Wang Y, Rao Y, Mao Y. Identification of QTLs Conferring Resistance to Bacterial Diseases in Rice. Plants. 2023; 12(15):2853. https://doi.org/10.3390/plants12152853
Chicago/Turabian StyleFang, Yuan, Di Ding, Yujia Gu, Qiwei Jia, Qiaolin Zheng, Qian Qian, Yuexing Wang, Yuchun Rao, and Yijian Mao. 2023. "Identification of QTLs Conferring Resistance to Bacterial Diseases in Rice" Plants 12, no. 15: 2853. https://doi.org/10.3390/plants12152853